CTCF binding to the first intron of the major immediate early (MIE) gene of human cytomegalovirus (HCMV) negatively regulates MIE gene expression and HCMV replication.

J Virol 2014 Jul 16;88(13):7389-401. Epub 2014 Apr 16.

Department of Microbiology/RCMI Program, Ponce School of Medicine and Health Sciences, Ponce, Puerto Rico, USA

Unlabelled: Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF.

Importance: Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.

Download full-text PDF

Source
http://dx.doi.org/10.1128/JVI.00845-14DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4054410PMC
July 2014
20 Reads
11 Citations
4.440 Impact Factor

Publication Analysis

Top Keywords

mie gene
48
gene expression
40
gene
16
ctcf
14
mie
13
mcmv mie
12
viral replication
12
ctcf-binding site
12
expression
11
murine cmv
8
sequence murine
8
ctcf binds
8
dna sequence
8
hcmv gene
8
repress mie
8
early stages
8
cmv mcmv
8
ctcf-binding motif
8
expression viral
8
factor ctcf
8

References

(Supplied by CrossRef)
The human cytomegalovirus
Landolfo et al.
Pharmacol. Ther. 2003

Mocarski et al.
2006
The pathogenicity of cytomegalovirus
Sweet et al.
FEMS Microbiol. Rev. 1999
The major immediate-early proteins IE1 and IE2 of human cytomegalovirus colocalize with and disrupt PML-associated nuclear bodies at very early times in infected permissive cells
Ahn et al.
J. Virol. 1997
A cis-acting element in the major immediate-early (IE) promoter of human cytomegalovirus is required for negative regulation by IE2
Liu et al.
J. Virol. 1991
Effect of a modulator deletion on transcription of the human cytomegalovirus major immediate-early genes in infected undifferentiated and differentiated cells
Meier et al.
J. Virol. 1997
The human cytomegalovirus IE2 86-kilodalton protein interacts with an early gene promoter via site-specific DNA binding and protein-protein associations
Scully et al.
J. Virol. 1995

Similar Publications