Publications by authors named "Yuanyuan Han"

116 Publications

First report of infecting and sp. LF.

Int J Parasitol Parasites Wildl 2021 Apr 20;14:84-90. Epub 2021 Jan 20.

Center of Tree Shrew Germplasm Resources, Institute of Medical Biology, Chinese Academy of Medical Science and Peking Union Medical College. Kunming, 650118, PR China.

belongs to the Asian and is transmitted by freshwater snails of the genus . Rodents are known definitive hosts of . In 2016, suspected schistosome eggs were found in the feces of the northern tree shrew () in a field in Lufeng County (latitude, 25°04'50″ N; longitude, 102°19'30″ E; altitude 1820 m), Yunnan Province, China. Morphological analysis suggested that the schistosome was 18S, 12S and CO1 genes sequencing and phylogenetic analysis showed that this species had the highest similarity to and occupied the same evolutionary branch as from Mianzhu, Sichuan, China. Meanwhile, based on 16S and 28S rDNA sequencing and morphological identification, the snail intermediate host was identified as a species of , and was found in irrigation channels. Phylogeny indicated that sp. LF was a sister taxon to . The was able to experimentally infect the captive-bred and eggs were recovered from all exposed. In this study, we report the infection of and sp. LF with in Lufeng, Yunnan, southwest China. These findings may improve our understanding of the host range, evolution, distribution, and phylogenetic position of .
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ijppaw.2021.01.005DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7843412PMC
April 2021

A dynamic recursive feature elimination framework (dRFE) to further refine a set of OMIC biomarkers.

Bioinformatics 2021 Jan 30. Epub 2021 Jan 30.

College of Computer Science and Technology, and Key Laboratory of Symbolic Computation and Knowledge Engineering of Ministry of Education, Jilin University, Changchun, Jilin, China, 130012.

Motivation: A feature selection algorithm may select the subset of features with the best associations with the class labels. The recursive feature elimination (RFE) is a heuristic feature screening framework and has been widely used to select the biological OMIC biomarkers. This study proposed a dynamic recursive feature elimination (dRFE) framework with more flexible feature elimination operations. The proposed dRFE was comprehensively compared with 11 existing feature selection algorithms and five classifiers on the eight difficult transcriptome datasets from a previous study, the ten newly collected transcriptome datasets and the five methylome datasets.

Results: The experimental data suggested that the regular RFE framework did not perform well, and dRFE outperformed the existing feature selection algorithms in most cases. The dRFE-detected features achieved Acc=1.0000 for the two methylome datasets GSE53045 and GSE66695. The best prediction accuracies of the dRFE-detected features were 0.9259, 0.9424, and 0.8601 for the other three methylome datasets GSE74845, GSE103186, and GSE80970, respectively. Four transcriptome datasets received Acc=1.0000 using the dRFE-detected features, and the prediction accuracies for the other six newly collected transcriptome datasets were between 0.6301 and 0.9917.

Supplementary Information: Supplementary data are available at Bioinformatics online.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/bioinformatics/btab055DOI Listing
January 2021

Denisovan DNA in Late Pleistocene sediments from Baishiya Karst Cave on the Tibetan Plateau.

Science 2020 10;370(6516):584-587

Key Laboratory of Vertebrate Evolution and Human Origins of Chinese Academy of Sciences, Institute of Vertebrate Paleontology and Paleoanthropology, CAS, Beijing 100044, China.

A late Middle Pleistocene mandible from Baishiya Karst Cave (BKC) on the Tibetan Plateau has been inferred to be from a Denisovan, an Asian hominin related to Neanderthals, on the basis of an amino acid substitution in its collagen. Here we describe the stratigraphy, chronology, and mitochondrial DNA extracted from the sediments in BKC. We recover Denisovan mitochondrial DNA from sediments deposited ~100 thousand and ~60 thousand years ago (ka) and possibly as recently as ~45 ka. The long-term occupation of BKC by Denisovans suggests that they may have adapted to life at high altitudes and may have contributed such adaptations to modern humans on the Tibetan Plateau.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1126/science.abb6320DOI Listing
October 2020

Effect of Propranolol on 18F-Fluorodeoxyglucose Uptake in Brown Adipose Tissue in Children and Young Adults with Neoplastic Diseases.

Mol Imaging Biol 2021 Apr 16;23(2):260-269. Epub 2020 Oct 16.

Department of Diagnostic Imaging, Division of Nuclear Medicine, St. Jude Children's Research Hospital, 262 Danny Thomas Place, Mail Stop 220, Memphis, TN, 38105, USA.

Purpose: To evaluate the effectiveness of propranolol at mitigating FDG uptake in brown adipose tissue (BAT) of pediatric patients with known or suspected malignancies.

Methods: PET/CT scans of 3 cohorts of patients treated from 2005 to 2017 were scored for the presence of FDG uptake by BAT at 7 sites: right or left neck/supraclavicular area, right or left axilla, mediastinum, posterior thorax, and abdomen/pelvis. Uptake was scored as follows: 0, none; 1, mild uptake < liver; 2, moderate uptake = liver; and 3, intense uptake > liver. Group 1 consisted of 323 patients (630 scans) who had no specific preparation to mitigate FDG uptake by BAT. Group 2 consisted of 345 patients (705 scans) who underwent only warming in an uptake room with a fixed temperature at 24 °C. Group 3 consisted of 622 patients (1457 scans) who underwent warming. In group 3, patients 8 years and older, 471 patients (1114 scans), were also pre-medicated with oral propranolol 60 min before injection of FDG. Generalized estimation equation, using the logit link method, was used to model the relationship between the incidence of BAT score > 0, in any site, as a function of age, sex, seasonal effect, and body surface area (BSA).

Results: In patients aged 8 years or older, the incidence of BAT uptake was 35-44 % and declined to 15 % with propranolol. BAT was most frequent in the neck (26 %), axilla (18 %), posterior thorax (18 %), mediastinum (14 %), and abdomen/pelvis (8 %); BAT was less common in warm months (p = 0.001). No substantial benefit was shown with pre-injection warming alone. No significant effect was found for age, sex, or BSA separately. When BAT uptake was present, it was usually intense.

Conclusion: Propranolol preparation minimizes FDG uptake by BAT and should be considered routine for pediatric FDG PET/CT cancer-related protocols in children, adolescents, and young adults.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s11307-020-01547-zDOI Listing
April 2021

Click chemistry based biopolymeric hydrogels for regenerative medicine.

Biomed Mater 2020 Oct 13. Epub 2020 Oct 13.

Biomedical Engineering, College of Biology , Hunan University, Changsha, 410082, CHINA.

Click chemistry is not a single specific reaction, but describes ways of generating products following examples in nature. Click reactions occur in one pot, are not disturbed by water, generate minimal and inoffensive byproducts, and are characterized by a high thermodynamic driving force that drives the reaction quickly and irreversibly to high yield of a single reaction product. Therefore, since over 15 years it has become a very useful bio-orthogonal method to prepare chemical cross-linked biopolymer-based hydrogel in presence of e.g. growth factors, live cells or in-vivo. Biopolymers are renewable and non-toxicity, providing a myriad of potential backbone's toolboxes for hydrogel design. The goal of this review is to summarize recent advances in the development of click chemistry based biopolymeric hydrogels and their applications in regenerative medicine. In particular, various click chemistry approaches including copper-catalyzed azide-alkyne cycloaddition reaction, copper-free click reaction (e.g. Diels-Alder reaction, strain-promoted azide-alkyne cycloaddition reaction, radical mediated thiol-ene reaction, and oxime-forming reaction), and pseudo-click reaction (e.g. thiol-Michael addition reaction and Schiff base reaction) are highlighted in the first part. In addition, numerous biopolymers including proteins (e.g. collagen, gelatin, silk, and mucin), polysaccharides (e.g. hyaluronic acid, alginate, dextran, and chitosan) and polynucleotides (e.g. DNA), are discussed. Finally, the biopolymeric hydrogels cross-linked by click chemistry intend for regeneration of skin, bone, spinal cord, cartilage, and cornea are treated. This article provides new insights for readers in terms of the design of regenerative medicine used biopolymeric hydrogels based on click chemistry reactions.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1088/1748-605X/abc0b3DOI Listing
October 2020

Identification of three molecular subtypes based on immune infiltration in ovarian cancer and its prognostic value.

Biosci Rep 2020 10;40(10)

Prenatal Diagnosis Center, Guizhou Provincial People's Hospital, Guiyang, China.

Background: Increasing studies suggest that tumor immune infiltration is a relative factor of prognosis in ovarian cancer (OvCa). The present study explored the composition of tumor-infiltrating immune cells (TIICs) in OvCa using CIBERSORT algorithm and further assessed their values for prognosis and therapeutic strategies by molecular subtypes.

Methods: Publicly available databases including The Cancer Genome Atlas (TCGA) and GTEx were searched. Ovarian tumor samples were available from TCGA, and normal ovarian samples were obtained from the GTEx dataset. The relative proportions of immune cell profiling in OvCa and normal samples were evaluated by CIBERSORT algorithm. Association between each immune cell subtype and survival was inferred by the fractions of 22 immune cell types. "CancerSubtypes" R-package was employed to identify the three types of molecular classification and analyze the functional enrichment in each subclass. Response to immunotherapy and anticancer drug targets was predicted via TIDE algorithm and GDSC dataset.

Results: Substantial variation reflecting individual difference was identified between cancer and normal tissues in the immune infiltration profiles. T cells CD4 memory activated, macrophages M1 were associated with improved overall survival (OS) as evaluated by univariate Cox regression and multivariate Cox. Three subtypes were identified by ´CancerSubtypes' R-package and every sub-cluster possessed specific immune cell characterization. Meanwhile, Cluster II exhibited poor prognosis and sensitive response to immunotherapy.

Conclusions: The cellular component of immune infiltration shows remarkable variation in OvCa. Profiling of immune infiltration is useful in prediction of prognosis of OvCa. The results from profiling might be considered in therapeutic modulation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1042/BSR20201431DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7593540PMC
October 2020

Guiding Lineage Specific Differentiation of SHED for Target Tissue/Organ Regeneration.

Curr Stem Cell Res Ther 2020 Sep 29. Epub 2020 Sep 29.

Biomedical Engineering and Biofunctional Materials Research Theme, Faculty of Dentistry, The University of Hong Kong. Hong Kong.

Stem cells from human exfoliated deciduous teeth (SHED) are considered one of the most attractive cell sources for tissue engineering due to their easy acquisition with no donor morbidity, ready availability, ability to selfrenew with high proliferation, capacity for multilineage differentiation and immunomodulatory functions. To date, SHED have been shown to be able to differentiate into odonto-/osteoblasts, neuronal cells, endothelial cells, hepatocyte-like cells, chondrocytes, epidermal cells among many other cell types. Accordingly, SHED possess a promising potential to be used in the cell-based therapy for various diseases, including reversible pulpitis, orofacial bone defects, neurodevelopmental disease and ischemic injury. Despite this potential, it has been a concern that tissue specific stem cells do not differentiate with the same efficacy into all the different lineages as they may have an inherent tendency to differentiate toward the tissues from which they were originally derived. Furthermore, stem cell niche comprises of a complex microenvironment where various cells, soluble signals, extracellular matrix and physical cues interplay to maintain the stemness of SHED and modulate their differentiation. Therefore, it is of significant importance to identify the specific microenvironmental cues that regulate lineage specific differentiation of SHED, which could inspire to develop functional approaches in target tissue regeneration. In this review, we highlight the recent studies that demonstrated multilineage differentiation capacity of SHED, focusing on how the microenvironment could be modified using different cues in order to achieve tissue specific regeneration.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2174/1574888X15666200929125840DOI Listing
September 2020

CD133CD34 cells can give rise to EPCs: A comparative rabbit and human study.

Blood Cells Mol Dis 2021 Feb 1;86:102487. Epub 2020 Sep 1.

Division of Restorative Dental Sciences, Faculty of Dentistry, The University of Hong Kong, Hong Kong SAR, China. Electronic address:

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bcmd.2020.102487DOI Listing
February 2021

Diffusion Tensor Imaging-Based Analysis of Baseline Neurocognitive Function and Posttreatment White Matter Changes in Pediatric Patients With Craniopharyngioma Treated With Surgery and Proton Therapy.

Int J Radiat Oncol Biol Phys 2021 Feb 6;109(2):515-526. Epub 2020 Sep 6.

Department of Radiation Oncology, St. Jude Children's Research Hospital, Memphis, Tennessee.

Purpose: To determine the preirradiation baseline association of white matter integrity with neurocognitive function and to assess posttreatment changes in pediatric patients with craniopharyngioma treated with proton therapy.

Methods And Materials: Ninety children and adolescents (2-20 years old) with craniopharyngioma were treated with proton therapy (54 Gy[RBE]) in a prospective therapeutic trial. Neurocognitive performance at the postoperative baseline before proton therapy and diffusion tensor imaging (DTI) data acquired at baseline and at annual follow-up were analyzed. Tract-based spatial statistics and structural connectomics were used to derive global and local white matter features from DTI. Baseline DTI features were compared for patients with average and below-average neurocognitive performance. Longitudinal DTI data were analyzed to determine the proton dose effect on white matter structures in relation to the irradiated brain volume and baseline age.

Results: Before proton therapy, patients with below-average working memory, processing speed, verbal fluency, verbal learning, or fine motor dexterity exhibited more globally degraded white matter structures compared with their counterparts with average performance, as indicated by lower mean fractional anisotropy, decreased global efficiency, or higher modularity. Surgery, obstructive hydrocephalus, and preoperative hypothalamic involvement appeared to be related to this degradation. In local analyses, tract-based spatial statistics revealed left-lateralized associations with verbal and motor functions, which supported surgical approaches to midline tumors via the right hemisphere. The mean fractional anisotropy of the brain and the global efficiency derived from DTI increased over the 5 years after proton therapy. The rate of increase was lower with larger irradiated brain volumes and in older children.

Conclusions: Below-average baseline neurocognitive performance in patients with craniopharyngioma before proton therapy appeared to be related to structural degradation of white matter tracts. Posttherapy longitudinal DTI showed improving trends in global integrity and efficiency measures, particularly in children in whom a smaller brain volume was irradiated.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ijrobp.2020.08.060DOI Listing
February 2021

Bcl-2 Overexpression and Hypoxia Synergistically Enhance Angiogenic Properties of Dental Pulp Stem Cells.

Int J Mol Sci 2020 Aug 26;21(17). Epub 2020 Aug 26.

Restorative Dental Sciences, Faculty of Dentistry, The University of Hong Kong, Hong Kong.

Post-implantation cell survival and angio-/vasculogenesis are critical for the success of cell-based regenerative strategies. The current study aimed to overexpress B-cell lymphoma 2 () gene in dental pulp stem cells (DPSCs) and examine the anti-apoptotic and angio-/vasculogenic effects both in-vitro and in-vivo. DPSCs were transduced with Bcl-2-green fluorescent protein (GFP) lentiviral particles and examined for cell proliferation and apoptosis. The cells were cultured under normoxic or hypoxic (0.5 mM CoCl) conditions and examined for the expression of angiogenic factors and effects on endothelial cell proliferation, migration and vessel morphogenesis. Cells with or without hypoxic preconditioning were used in in-vivo Matrigel plug assay to study the post-implantation cell survival and angio-/vasculogenesis. Bcl-2-overexpressing-DPSCs showed significantly lower apoptosis than that of null-GFP-DPSCs under serum-free conditions. Under hypoxia, Bcl-2-overexpressing-DPSCs expressed significantly higher levels of vascular endothelial growth factor compared to that under normoxia and null-GFP-DPSCs. Consequently, Bcl-2-overexpressing-DPSCs significantly enhanced endothelial cell proliferation, migration and vascular tube formation on Matrigel. Immunohistological assessment of in-vivo transplanted Matrigel plugs showed significantly higher cell survival and vasculature in hypoxic preconditioned Bcl-2-overexpressing-DPSC group compared to null-GFP-DPSC group. In conclusion, Bcl-2 overexpression and hypoxic-preconditioning could be synergistically used to enhance post-implantation cell survival and angio-/vasculogenic properties of DPSCs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/ijms21176159DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7503706PMC
August 2020

Response of the gut microbiota during the Clostridioides difficile infection in tree shrews mimics those in humans.

BMC Microbiol 2020 08 20;20(1):260. Epub 2020 Aug 20.

Center of Tree Shrew Germplasm Resources, Institute of Medical Biology, Chinese Academy of Medical Sciences and Peking Union Medical College, Yunnan Key Laboratory of Vaccine Research and Development on Severe Infectious Diseases, Yunnan Innovation Team of Standardization and Application Research in Tree Shrew, Zhao zong Road 66, Kunming, 650118, China.

Background: Clostridioides difficile is a major cause of antibiotic associated diarrhea. Several animal models are used to study C. difficile infection (CDI). The tree shrew has recently been developed as a model of primate processes. C. difficile infection has not been examined in tree shrews. We infected tree shrews with hyper-virulent C. difficile strains and examined the alterations in gut microbiota using 16S rRNA gene sequencing.

Results: C. difficile colonized the gastrointestinal tract of tree shrew and caused diarrhea and weight loss. Histopathologic examination indicated structures and mucosal cell destruction in ileal and colonic tissues. The gut microbial community was highly diversity before infection and was dominated by Firmicutes, Fusobacteria, Bacteroidetes, and Proteobacteria. Antibiotic administration decreased the diversity of the gut microbiota and led to an outgrowth of Lactobacillus. The relative abundance of Proteobacteria, Gammaproteobacteria, Enterobacteriales, Lachnospiraceae, Enterobacteriaceae, Escherichia, Blautia, and Tyzzerella increased following C. difficile infection. These taxa could be biomarkers for C. difficile colonization.

Conclusions: In general, the disease symptoms, histopathology, and gut microbiota changes following C. difficile infection in tree shrews were similar to those observed in humans.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12866-020-01943-zDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7441558PMC
August 2020

Defending Effects of Iodide Transfer in Placental Barrier Against Maternal Iodine Deficiency.

Thyroid 2020 Sep 16. Epub 2020 Sep 16.

Department of Dermatovenereology, Tianjin Medical University General Hospital, Tianjin, P.R. China.

Placental iodide transport is necessary for maintaining an adequate iodide supply to the developing fetus. We hypothesized that compounds from the placental barrier can compensate for decreases in maternal iodine intake and normalize fetal iodine levels. Pregnant rats administered different amounts of iodine (1.24, 2.5, 5, or 10 μg/day) were evaluated on gestational day (gd) 16 and 20. The iodine levels in maternal blood, amniotic fluid (AF), and placental tissue were estimated using As-Ce catalytic spectrophotometry. The protein and/or messenger RNA (mRNA) levels of sodium iodide symporter (NIS), pendrin, alpha-smooth muscle actin (α-SMA), and CD31 in the placental labyrinth, trophoblast cells isolated using laser capture microdissection (LCM), and/or fetomaternal thyroid were detected using immunoblotting, real-time polymerase chain reaction, and/or immunohistochemistry. When iodine intake was reduced, iodine levels in maternal blood gradually decreased; however, placental iodine levels were not significantly different between groups on gd16 and gd20. Minimal changes were observed in AF iodine levels on gd16, and a mild decreasing trend was observed (iodine dose, 10 to 1.24 μg/day) on gd20. NIS protein, which was linearly distributed along the basolateral membrane of maternal-fetal thyroid follicles, gradually increased with decreasing iodine levels. Regarding iodine deficiency in the placental labyrinth on gd16 and gd20, pendrin and glycosylated NIS proteins were significantly upregulated in a dose-dependent manner. However, the mRNA levels were unchanged. Furthermore, the conversion of NIS protein from the nonglycosylated to the glycosylated form increased. In trophoblast cells isolated using LCM, mRNA levels increased in the 1.24-μg/day group on gd16 but not mRNA levels. There was a smaller α-SMA area in the labyrinth zone on gd16 and gd20; however, the proportional CD31 area increased on gd16 and reduced on gd20 with decreased iodine levels. All mechanisms upregulating the expression of iodine transporters and changes in villous stroma and microvessel area in the placental labyrinth can promote iodide transfer from mother to fetus in iodine deficiency, especially before the onset of fetal thyroid function. Compensatory NIS protein regulation in the placenta against decreased iodine intake mainly occurs during translation and glycosylation modification after translation. Pendrin may be more important than NIS in the mediation of placental iodide transport.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1089/thy.2020.0510DOI Listing
September 2020

Comparison of the antipathogenic effect toward Staphylococcus aureus of N-linked and free oligosaccharides derived from human, bovine, and goat milk.

J Food Sci 2020 Aug 13;85(8):2329-2339. Epub 2020 Jul 13.

Glycomics and Glycan Bioengineering Research Center (GGBRC), College of Food Science and Technology, Nanjing Agricultural University, Nanjing, Jiangsu, China.

N-linked oligosaccharides (N-glycans) derived from milk were recently found to be antipathogenic. This study compares the antimicrobial activity of N-linked glycans and free oligosaccharides from human, bovine, and goat milk against Staphylococcus aureus. Milk N-glycans showed a bactericidal/bacteriostatic effect on the pathogen when compared to free milk oligosaccharides, evidenced by the clear zone from the halo assay, with the order of human milk >goat milk >bovine milk. None of the free milk oligosaccharide samples were bactericidal/bacteriostatic, despite its positive results in growth curve and minimum inhibitory concentration (MIC) assays which are believed to be related to hyperosmosis. Both N-glycans and free milk oligosaccharides can reduce the adhesion of Staphylococcus aureus to Caco-2 cells, however, N-glycans worked significantly more effective than free milk oligosaccharides. Structural analysis of all free oligosaccharide and N-glycan samples showed the obvious interspecies differences, and the structure/function relationship of the respected N-glycans is of interest for future study. The significant bactericidal/bacteriostatic activity possessed by human, bovine, and goat milk N-linked glycans holds great potential as a novel substitute for antibiotics.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/1750-3841.15150DOI Listing
August 2020

miR-512-3p Overcomes Resistance to Cisplatin in Retinoblastoma by Promoting Apoptosis Induced by Endoplasmic Reticulum Stress.

Med Sci Monit 2020 Jul 9;26:e923817. Epub 2020 Jul 9.

Department of Ophthalmology, Sino-Singapore Eco-City Hospital of Tianjin Medical University, Sino-Singapore Eco-City, Tianjin, China (mainland).

BACKGROUND Retinoblastoma (RB) seriously endangers the vision and even the life of patients. This study aimed to explore the endoplasmic reticulum stress (ERS) and drug resistance of RB and verify the effect of miR-512-3p as a regulator of XBP-1 shearing mechanism on ERS, proliferation, apoptosis, and autophagy levels of RB cells. MATERIAL AND METHODS Y79, weri-RB1, and HXO-RB44 cells were treated with cisplatin (DDP) gradient concentration to construct DDP-resistant cells. The drug inhibition rate and cell proliferation were assessed by CCK-8 assay. The cell transfection and cell apoptosis were detected by RT-qPCR analysis and TUNEL assay, respectively. The protein expression was detected by Western blot analysis. Dual-luciferase reporter assay confirmed the combination of miR-512-30p and XBP-1 transcript 1/2. RESULTS DDP inhibition rates for DDP-resistant RB cells were lower than that for RB cells. The XBP-1 expression was increased in DDP-resistant RB cells, and Y79 cells were chosen for the subsequent experiments. After transfection, miR-512-3p overexpression obviously inhibited the proliferation of DDP-resistant Y79 cells (Y79/DDP cells). miR-512-3p overexpression increased the DDP inhibition rate for Y79/DDP cells and apoptosis of Y79/DDP cells. miR-512-3p overexpression downregulated the expression of LC3 II/I in Y79/DDP cells. The effect of miR-512-3p inhibition on Y79/DDP cells was not as obvious as the effect of miR-512-3p overexpression on Y79/DDP cells. Furthermore, miR-512-3p was confirmed to be combined with XBP-1 transcript variant 1. CONCLUSIONS miR-512-3p improved the DDP resistance of RB cells by promoting ERS-induced apoptosis and inhibiting the proliferation and autophagy of RB cells.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.12659/MSM.923817DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7370580PMC
July 2020

Association between the 2D:4D ratio and schizophrenia.

J Int Med Res 2020 Jun;48(6):300060520929148

The Mental Health Center, West China Hospital, Sichuan University, Chengdu, China.

Objective: To investigate the potential association between the ratio of the second digit length to the fourth digit length (2D:4D) and schizophrenia, to provide evidence regarding the pathogenesis of schizophrenia.

Methods: In this study, we enrolled 843 patients with schizophrenia (387 men and 456 women), all of whom met the diagnostic criteria of the Diagnostic and Statistical Manual of Mental Disorders, fourth edition (DSM-IV), and 1050 normal healthy controls (477 men and 573 women). The digit lengths of both hands were measured in all subjects and the 2D:4D ratio was analyzed.

Results: In the healthy controls, the 2D:4D ratio was sexually dimorphic, with a larger value in women than in men. In addition, the 2D:4D ratio in the schizophrenia patients was significantly larger than in the healthy controls. The 2D:4D ratio of the right hand was more sexually dimorphic than the left hand. Furthermore, the difference in 2D:4D ratios between the male patients and male controls was significantly larger than in their female counterparts.

Conclusions: By analyzing the 2D:4D ratio and considering alternative factors related to schizophrenia, our findings support the hypothesis that there are abnormal cerebral conditions in schizophrenia patients.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1177/0300060520929148DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7325465PMC
June 2020

A novel ratiometric near-infrared fluorescent probe for monitoring cyanide in food samples.

Food Chem 2020 Nov 18;331:127359. Epub 2020 Jun 18.

School of the Environment and Safety Engineering, Jiangsu University, Zhenjiang, Jiangsu 212013, PR China.

Cyanide is a highly toxic anion. Nonetheless, many food plants could produce endogenous cyanide, which causes great danger to human health. Thus, monitoring cyanide in food samples is critically significant. Herein, we rationally developed the first ratiometric near-infrared fluorescent probe for sensing cyanide in food samples. The probe displayed noticeable fluorescence in near-infrared region. Moreover, upon treatment with cyanide, the probe exhibited highly selective and sensitive ratiometric fluorescence response, with limit of detection determined to be 0.075 μM and limit of quantification determined to be 0.25 μM. The ratios of fluorescent intensities at 519 and 688 nm (I/I) was linear with added cyanide concentrations from 0 to 80 μM. The relative standard deviations for repeatability and reproducibility varied from 0.55 to 8.94 and from 1.17 to 9.46, respectively. Significantly, probe Hy has been successfully applied for monitoring cyanide in various food samples, such as almonds, sprouting potatoes, and bamboo shoots.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.foodchem.2020.127359DOI Listing
November 2020

Tailoring ultra-fast charge transfer in MoS.

Phys Chem Chem Phys 2020 May;22(18):10335-10342

Division of Molecular and Condensed Matter Physics, Department Physics and Astronomy, Uppsala University, Box 516, SE-75221 Uppsala, Sweden.

Charge transfer dynamics are of importance in functional materials used in devices ranging from transistors to photovoltaics. The understanding of charge transfer in particular of how fast electrons tunnel away from an excited state and where they end up, is necessary to tailor materials used in devices. We have investigated charge transfer dynamics in different forms of the layered two-dimensional material molybdenum disulphide (MoS2, in single crystal, nanocrystalline particles and crystallites in a reduced graphene oxide network) using core-hole clock spectroscopy. By recording the electrons in the sulphur KLL Auger electron kinetic energy range we have measured the prevalence of localised and delocalised decays from a state created by core excitation using X-rays. We show that breaking the crystal symmetry of the single crystal into either particles or sheets causes the charge transfer from the excited state to occur faster, even more so when incorporating it in a graphene oxide network. The interface between the MoS2 and the reduced graphene oxide forms a Schottky barrier which changes the ratio between local and delocalised decays creating two distinct regions in the charge transfer dependent on the energy of the excited electron. Thereby we show that ultra-fast charge transfer in MoS2 can be tailored, a result which can be used in the design of emergent devices.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1039/d0cp00857eDOI Listing
May 2020

Isolation and identification of two new strains of mammalian orthoreovirus from Chinese tree shrews.

Arch Virol 2020 Jul 25;165(7):1541-1550. Epub 2020 Apr 25.

Center of Tree Shrew Germplasm Resources, Institute of Medical Biology, Chinese Academy of Medical Sciences, Peking Union Medical College, 935 Jiao Ling Road, Kunming, China.

Chinese tree shrews have been used extensively in studies of different types of cancer and for the modeling of viral infections. In the present study, we report the isolation and characterization of two strains of mammalian orthoreovirus (MRV), MRV1/TS/2011 and MRV3/TS/2012, which were isolated from the feces of tree shrews in Yunnan, China. These two strains of MRV were isolated and cultured in both primary tree shrew intestinal epithelial cells (pTIECs) and primary tree shrew alveolar epithelial cells (pTAECs). A neutralization test using immunofluorescence was employed to determine the subtype of each isolate. Viral RNA was extracted and analyzed by polyacrylamide gel electrophoresis (PAGE), and the sequence was determined by next-generation sequencing for construction of a phylogenetic tree and analysis of gene polymorphism. Electron microscopy examination revealed the presence of virus particles with the typical morphological characteristics of MRV. Serotype analysis showed that strain MRV1/TS/2011 was of type I and strain MRV3/TS/2012 was of type III. A sequence comparison showed that the isolates were 25.4% identical in the S1 gene.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00705-020-04635-1DOI Listing
July 2020

Clinical, imaging, and molecular analysis of pediatric pontine tumors lacking characteristic imaging features of DIPG.

Acta Neuropathol Commun 2020 04 23;8(1):57. Epub 2020 Apr 23.

Department of Radiation Oncology, St. Jude Children's Research Hospital, Memphis, TN, USA.

Diffuse intrinsic pontine glioma (DIPG) is most commonly diagnosed based on imaging criteria, with biopsy often reserved for pontine tumors with imaging features not typical for DIPG (atypical DIPG, 'aDIPG'). The histopathologic and molecular spectra of the clinical entity aDIPG remain to be studied systematically. In this study, thirty-three patients with newly diagnosed pontine-centered tumors with imaging inconsistent with DIPG for whom a pathologic diagnosis was subsequently obtained were included. Neoplasms were characterized by routine histology, immunohistochemistry, interphase fluorescence in situ hybridization, Sanger and next-generation DNA/RNA sequencing, and genome-wide DNA methylome profiling. Clinicopathologic features and survival outcomes were analyzed and compared to those of a contemporary cohort with imaging features consistent with DIPG (typical DIPG, 'tDIPG'). Blinded retrospective neuroimaging review assessed the consistency of the initial imaging-based diagnosis and correlation with histopathology. WHO grade II-IV infiltrating gliomas were observed in 54.6% of the cases; the remaining were low-grade gliomas/glioneuronal tumors or CNS embryonal tumors. Histone H3 K27M mutation, identified in 36% of the cases, was the major prognostic determinant. H3 K27M-mutant aDIPG and H3 K27M-mutant tDIPG had similar methylome profiles but clustered separately from diffuse midline gliomas of the diencephalon and spinal cord. In the aDIPG cohort, clinicoradiographic features did not differ by H3 status, yet significant differences in clinical and imaging features were observed between aDIPG without H3 K27M mutation and tDIPG. Neuroimaging review revealed discordance between the classification of aDIPG and tDIPG and did not correlate with the histology of glial/glioneuronal tumors or tumor grade. One patient (3.1%) developed persistent neurologic deficits after surgery; there were no surgery-related deaths. Our study demonstrates that surgical sampling of aDIPG is well-tolerated and provides significant diagnostic, therapeutic, and prognostic implications, and that neuroimaging alone is insufficient to distinguish aDIPG from tDIPG. H3 K27M-mutant aDIPG is epigenetically and clinically similar to H3 K27M-mutant tDIPG.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s40478-020-00930-9DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7181591PMC
April 2020

COVID-19 in a patient with long-term use of glucocorticoids: A study of a familial cluster.

Clin Immunol 2020 05 8;214:108413. Epub 2020 Apr 8.

Department of Pulmonary and Critical Care Medicine, The Third Xiangya Hospital of Central South University, Changsha, China. Electronic address:

Clusters of patients with novel coronavirus disease 2019 (COVID-19) have been successively reported globally. Studies show clear person-to-person transmission. The average incubation period is 2-14 days, and mostly 3-7 days. However, in some patients, this period may be longer. Here, we report a familial cluster of COVID-19 where a 47-year-old woman with long-term use of glucocorticoids did not develop any symptoms within the 14-day quarantine period but was confirmed with COVID-19 by tested positive of antibody on day 40 after she left Wuhan. Almost at the same time, her father and sister were diagnosed with COVID-19. The results suggest that the long-term use of glucocorticoids might cause atypical infections, a long incubation period, and extra transmission of COVID-19.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.clim.2020.108413DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7139268PMC
May 2020

WGCNA analysis of the subcutaneous fat transcriptome in a novel tree shrew model.

Exp Biol Med (Maywood) 2020 06 26;245(11):945-955. Epub 2020 Mar 26.

Center of Tree Shrew Germplasm Resources, Institute of Medical Biology, Chinese Academy of Medical Sciences and Peking Union Medical College, Yunnan Key Laboratory of Vaccine Research and Development on Severe Infectious Diseases, Kunming 650118, China.

Impact Statement: We constructed the transcriptomic network in adipose tissue in lean, moderate obesity and severe obesity groups of tree shrew for the first time. Compared to other laboratory animal models, the tree shrew is a prospective laboratory animal that has a closer genetic association with primates than with rodents. It is widely used in biomedical researches. Enrichment analyses revealed several molecular biological processes were involved in the ribosome, lysosome, and ubiquitin-mediated proteolysis process. These results provided insights into new targets for the prevention and therapy of obesity and a novel research model for obesity.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1177/1535370220915180DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7427174PMC
June 2020

Simultaneous Discrimination of Hypochlorite and Single Oxygen during Sepsis by a Dual-Functional Fluorescent Probe.

Anal Chem 2020 04 6;92(8):6072-6080. Epub 2020 Apr 6.

School of Chemistry and Chemical Engineering, School of Medicine, School of the Environment and Safety Engineering, Key Laboratory of Modern Agriculture Equipment and Technology, Jiangsu University, Zhenjiang, Jiangsu 212013, P. R. China.

Hypochlorite (ClO) and singlet oxygen (O) commonly coexist in living systems and exert important interplaying roles in many diseases. To dissect their complex inter-relationship, it is urgently required to construct a fluorescent probe that can discriminate ClO and O in living organisms. Herein, by taking the 3-(aliphaticthio)-propan-1-one group as the unique recognition unit for both ClO and O, we proposed the first fluorescent probe, , to simultaneously discriminate ClO and O with high sensitivity and selectivity. Probe itself showed fluorescence in blue channel. After treatment with ClO and O, respectively, pronounced fluorescence enhancements were observed in the green channel and red channel correspondingly. Moreover, upon development of the probe with aggregation-induced emission (AIE) characteristics, the probe could work well in a solution with high water volume fraction. Probe was also able to accumulate into mitochondria and was utilized as an effective tool to image exogenous and endogenous ClO and O in mitochondria. Significantly, as the first trial, probe was employed to simultaneously monitor the variation of ClO and O level in cecal tissues of rat in the cecal ligation and puncture (CLP)-induced polymicrobial sepsis model. The results demonstrated that the expressed ClO and O levels were tightly correlated with the severity of sepsis, inferring that the overproduction of ClO and O is an important factor in the pathogenesis of sepsis. The probe illustrated herein may provide a guide for further exploring the functions of ClO and O in various diseases.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acs.analchem.0c00492DOI Listing
April 2020

Common and specific gene signatures among three different endometriosis subtypes.

PeerJ 2020 5;8:e8730. Epub 2020 Mar 5.

Department of Obstetrics and Gynecology, The Second Xiangya Hospital, Central South University, Changsha, Hunan, China.

Aims: To identify the common and specific molecular mechanisms of three well-defined subtypes of endometriosis (EMs): ovarian endometriosis (OE), peritoneal endometriosis (PE), and deep infiltrating endometriosis (DIE).

Methods: Four microarray datasets: GSE7305 and GSE7307 for OE, E-MTAB-694 for PE, and GSE25628 for DIE were downloaded from public databases and conducted to compare ectopic lesions (EC) with eutopic endometrium (EU) from EMs patients. Differentially expressed genes (DEGs) identified by limma package were divided into two parts: common DEGs among three subtypes and specific DEGs in each subtype, both of which were subsequently performed with the Kyoto Encyclopedia of Genes (KEGG) pathway enrichment analysis. The protein-protein interaction (PPI) network was constructed by common DEGs and five hub genes were screened out from the PPI network. Besides, these five hub genes together with selected interested pathway-related genes were further validated in an independent OE RNA-sequencing dataset GSE105764.

Results: A total of 54 EC samples from three EMs subtypes (OE, PE, DIE) and 58 EU samples were analyzed, from which we obtained 148 common DEGs among three subtypes, and 729 specific DEGs in OE, 777 specific DEGs in PE and 36 specific DEGs in DIE. The most enriched pathway of 148 shared DEGs was arachidonic acid (AA) metabolism, in which most genes were up-regulated in EC, indicating inflammation was the most common pathogenesis of three subtypes. Besides, five hub genes AURKB, RRM2, DTL, CCNB1, CCNB2 identified from the PPI network constructed by 148 shared DEGs were all associated with cell cycle and mitosis, and down-regulated in EC, suggesting a slow and controlled proliferation in ectopic lesions. The KEGG pathway analysis of specific DEGs in each subtype revealed that abnormal ovarian steroidogenesis was a prominent feature in OE; OE and DIE seems to be at more risk of malignant development since both of their specific DEGs were enriched in the pathways in cancer, though enriched genes were different, while PE tended to be more associated with dysregulated peritoneal immune and inflammatory microenvironment.

Conclusion: By integrated bioinformatic analysis, we explored common and specific molecular signatures among different subtypes of endometriosis: activated arachidonic acid (AA) metabolism-related inflammatory process and a slow and controlled proliferation in ectopic lesions were common features in OE, PE and DIE; OE and DIE seemed to be at more risk of malignant development while PE tended to be more associated with dysregulated peritoneal immune and inflammatory microenvironment, all of which could deepen our perception of endometriosis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.7717/peerj.8730DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7060988PMC
March 2020

Nanoparticle Bridges for Studying Electrical Properties of Organic Molecules and Gas Sensor Applications.

Methods Mol Biol 2020 ;2118:305-325

Division of Applied Materials Science, Department of Engineering Sciences, Uppsala University, UPPSALA, Sweden.

Molecules have high potential for novel applications as building blocks for electronic devices such as sensors due to the versatility of their electronic properties. Their use in devices offers a great potential for further miniaturization of electronic devices. We describe a method where nanoparticles functionalized with short-chain organic molecules are used to build a molecular electronics device (nanoMoED) sensor for studying electrical properties of organic molecules. We also report the application of such a nanoMoED for detecting environmental gases. Here we provide a detailed description of the nanoMoED fabrication process, nanoparticle synthesis and functionalization, the basics of the electrical measurements, and nanoMoED applications. The platform described here is capable of detecting electrical current flowing through just a few molecules. The versatility of such nanoMoEDs makes this platform suitable for a wide range of molecular electronics and molecular sensing applications.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/978-1-0716-0319-2_23DOI Listing
January 2021

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

J Clin Lab Anal 2020 Jul 6;34(7):e23265. Epub 2020 Mar 6.

School of Medicine, Guizhou University, Guiyang, China.

Background: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population.

Methods: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed.

Results: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein.

Conclusion: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/jcla.23265DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7370744PMC
July 2020

Comparative genomic analysis of Proteus spp. isolated from tree shrews indicated unexpectedly high genetic diversity.

PLoS One 2020 21;15(2):e0229125. Epub 2020 Feb 21.

Center of Tree Shrew Germplasm Resources, Institute of Medical Biology, Chinese Academy of Medical Sciences and Peking Union Medical College, Yunnan Key Laboratory of Vaccine Research and Development on Severe Infectious Diseases, Yunnan Innovation Team of Standardization and Application Research in Tree Shrew, Kunming, China.

Proteus spp. are commensal gastrointestinal bacteria in many hosts, but information regarding the mutual relationships between these bacteria and their hosts is limited. The tree shrew is an alternative laboratory animal widely used for human disease research. However, little is known about the relationship between Proteus spp. and tree shrews. In this study, the complete genome sequencing method was used to analyse the characteristics of Proteus spp. isolated from tree shrews, and comparative genomic analysis was performed to reveal their relationships. The results showed that 36 Proteus spp. bacteria were isolated, including 34 Proteus mirabilis strains and two Proteus vulgaris strains. The effective rate of sequencing was 93.53%±2.73%, with an average GC content of 39.94%±0.25%. Briefly, 3682.89±90.37, 2771.36±36.01 and 2832.06±42.49 genes were annotated in the NCBI non-redundant nucleotide database (NR), SwissProt database and KEGG database, respectively. The high proportions of macrolide-, vancomycin-, bacitracin-, and tetracycline-resistance profiles of the strains were annotated in the Antibiotic Resistance Genes Database (ARDB). Flagella, lipooligosaccharides, type 1 fimbriae and P fimbriae were the most abundantly annotated virulence factors in the Virulence Factor Database (VFDB). SNP variants indicated high proportions of base transitions (Ts), homozygous mutations (Hom) and non-synonymous mutations (Non-Syn) in Proteus spp. (P<0.05). Phylogenetic analysis of Proteus spp. and other references revealed high genetic diversity for strains isolated from tree shrews, and host specificity of Proteus spp. bacteria was not found. Overall, this study provided important information on characteristics of genome for Proteus spp. isolated from tree shrews.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0229125PLOS
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7034874PMC
May 2020

GTSE1, CDC20, PCNA, and MCM6 Synergistically Affect Regulations in Cell Cycle and Indicate Poor Prognosis in Liver Cancer.

Anal Cell Pathol (Amst) 2019 30;2019:1038069. Epub 2019 Dec 30.

MOE Key Laboratory of Bioinformatics, Center for Synthetic and Systems Biology, Bioinformatics Division, BNRist, Department of Automation, Tsinghua University, Beijing 100084, China.

GTSE1 is well correlated with tumor progression; however, little is known regarding its role in liver cancer prognosis. By analyzing the hepatocellular carcinoma (HCC) datasets in GEO and TCGA databases, we showed that high expression of GTSE1 was correlated with advanced pathologic stage and poor prognosis of HCC patients. To investigate underlying molecular mechanism, we generated GTSE1 knockdown HCC cell line and explored the effects of GTSE1 deficiency in cell growth. Between GTSE1 knockdown and wild-type HCC cells, we identified 979 differentially expressed genes (520 downregulated and 459 upregulated genes) in the analysis of microarray-based gene expression profiling. Functional enrichment analysis of DEGs suggested that S phase was dysregulated without GTSE1 expression, which was further verified from flow cytometry analysis. Moreover, three other DEGs: CDC20, PCNA, and MCM6, were also found contributing to GTSE1-related cell cycle arrest and to be associated with poor overall survival of HCC patients. In conclusion, GTSE1, together with CDC20, PCNA, and MCM6, may synergistically promote adverse prognosis in HCC by activating cell cycle. Genes like GTSE1, CDC20, PCNA, and MCM6 may be promising prognostic molecular biomarkers in liver cancer.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2019/1038069DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7012210PMC
August 2020

Association of polymorphisms in the HBG1-HBD intergenic region with HbF levels.

J Clin Lab Anal 2020 Jun 18;34(6):e23243. Epub 2020 Feb 18.

School of Medicine, Guizhou University, Guiyang, China.

Background: Increased levels of fetal hemoglobin (HbF) can improve the clinical course of the patients with sickle cell anemia (SCA) or β-thalassemia. The HBG1-HBD intergenic region plays an important role in this process. However, very few studies investigated whether the variations in this region have an effect on HbF expression.

Methods: We retrieved all the SNP data in the HBG1-HBD intergenic region and defined the haplotype blocks, then performed cluster analysis and selected a tagSNP. A total of 500 normal individuals and 300 β-thalassemia carriers were enrolled. After routine blood and hemoglobin capillary electrophoresis testing, β-thalassemia mutations were detected using PCR-reverse dot blot. The genotypes of the rs4910736 (A > C) and rs10128556 (C > T) were determined using Sanger sequencing; the relationship between the two SNPs and the levels of HbF was analyzed.

Results: Two haplotype blocks were constructed. Block 1 included seven haplotypes divided into two groups M and N by 11 tagSNPs, among which rs4910736 was selected as a tagSNP, while block 2 included three haplotypes. We found that the haplotypes of block 1 were statistically associated with HbF levels, but the non-tagSNP rs10128556 was shown to be more strongly associated with HbF levels than rs4910736.

Conclusion: This work proved that the haplotypes in the HBG1-HBD intergenic region and SNP rs10128556 are both statistically associated with HbF levels, revealing the association of polymorphisms in the HBG1-HBD intergenic region with HbF levels.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/jcla.23243DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7307336PMC
June 2020

mRNA profiling reveals response regulators of decreased fungal keratitis symptoms in a tree shrew model.

Gene 2020 May 11;737:144450. Epub 2020 Feb 11.

Institute of Medical Biology, Chinese Academy of Medical Science and Peking Union Medical College, Kunming, China; Yunnan Key Laboratory of Vaccine Research and Development on Severe Infectious Diseases, Kunming, China; Yunnan Innovation Team of Standardization and Application Research in Tree Shrew, Kunming, China. Electronic address:

Fungal keratitis is a corneal disease with a high blindness rate caused by pathogenic fungal infections. The pathogenesis of fungal keratitis and the immune response after fungal infection are still unclear. Notably, the pathological features of fungal keratitis in tree shrews are similar to those in humans. In the present study, mRNA profiling of tree shrew corneas with fungal keratitis was performed. GO and KEGG enrichment analyses were performed on the differentially expressed mRNAs, and the GO biological process ontology was used to analyze functional trends in the differentially expressed mRNAs. In total, 151 downregulated and 71 upregulated mRNAs were shared among the 7-day, 14-day and 30-day infection groups. These differentially expressed mRNAs were significantly enriched in the GO category immune response (GO: 0002376) and the KEGG pathways cytokine receptor binding (KEGG ID: tup04060) and cell adhesion (KEGG ID: tup04514). The downregulated mRNAs were significantly enriched in the corneal epithelial cell adhesion function. Fifty-eight initially upregulated mRNAs gradually decreased in expression, and these mRNAs were significantly enriched in the functions lipopolysaccharide (LPS) and antibacterial polypeptide recognition, cell differentiation, and cell rearrangement. Zeta chain of T-cell receptor associated protein kinase 70 (ZAP70), lymphocyte cytosolic protein 2 (LCP2), C-C motif chemokine and its receptor showed high degrees of connectivity in the protein-protein interaction (PPI) network. We speculate that the decrease in symptoms of tree shrew fungal keratitis may be related to the upregulation of genes involved in immune regulation and macrophage colony stimulation. This study showed that the C-C motif chemokine and its receptor may play a key role in regulating tree shrew fungal keratitis, providing a theoretical basis for studying the pathogenesis of human fungal keratitis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.gene.2020.144450DOI Listing
May 2020

Tree shrew bone marrow-derived mesenchymal stem cells express CD81, OCLN, and miR-122, facilitating the entire hepatitis C virus life cycle.

J Med Virol 2020 Feb 13. Epub 2020 Feb 13.

Center of Tree Shrew Germplasm Resources, Institute of Medical Biology, Chinese Academy of Medical Science and Peking Union Medical College, Kunming, China.

Hepatitis C virus (HCV) infection is a major cause of chronic liver disease and associated cirrhosis, and hepatocellular carcinoma worldwide. At present, there is no prophylactic vaccine against HCV due to the lack of in vivo and in vitro model systems. Although most recombinants of all major HCV genotypes replicate in Huh-7 cell line and derivatives, these cells are human hepatoma-derived cell line. Therefore, the development of un-tumor-derived cell systems facilitating the entire HCV life cycle is urgently needed. In this study, we aimed to establish a novel tree shrew-derived bone marrow-derived mesenchymal stem cell (BM-MSC) system to reconstruct the HCV life cycle. We transduction cluster of differentiation 81 (CD81), occludin (OCLN), and microRNA-122 (miR-122) into BM-MSCs, then used a well-established HCV, produced from the J6/JFH1-Huh7.5.1 culture system, to infect the cells. We observed that BM-MSCs transduction with CD81/OCLN or CD81/OCLN/miR-122 support HCV RNA replication and infectious virus production. We also found that the addition of exogenous vascular endothelial growth factor (VEGF) can enhance HCV infectivity in BM-MSCs, with HCV virus load up to 10 copies/mL. In conclusion, we identified the minimum essential factors required for HCV replication in tree shrew-derived nonhuman nonhepatic BM-MSCs. Further, we identified that exogenous addition of VEGF, and exogenous expression of CD81, OCLN, and miR-122, facilitates efficient viral replication and production of infectious particles. Our results describe a novel cell system capable of supporting the entire HCV life cycle, which may provide an essential tool for anti-HCV drug discovery, vaccine development, and study of pathogenesis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/jmv.25710DOI Listing
February 2020