Publications by authors named "Youyun Zhao"

9 Publications

  • Page 1 of 1

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

Virol J 2021 02 18;18(1):38. Epub 2021 Feb 18.

Department of Clinical Laboratory, Hubei Provincial Hospital of Traditional Chinese Medicine, Wuhan, 430061, Hubei, China.

Background: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously.

Methods: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected.

Results: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found.

Conclusion: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12985-021-01510-6DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7891017PMC
February 2021

Peripheral blood inflammatory markers in predicting prognosis in patients with COVID-19. Some differences with influenza A.

J Clin Lab Anal 2021 Jan 22;35(1):e23657. Epub 2020 Nov 22.

Department of Clinical Laboratory, Hubei Provincial Hospital of Traditional Chinese Medicine, Wuhan, China.

Background: To evaluate the ability of peripheral blood inflammatory markers in predicating the typing of COVID-19, prognosis, and some differences between COVID-19 and influenza A patients.

Methods: Clinical data on 285 cases laboratory-confirmed as SARS-CoV-2 infection were obtained from a Wuhan local hospital's electronic medical records according to previously designed standardized data collection forms. Additional 446 Influenza A outpatients' hematologic data were enrolled for comparison.

Results: NLR, SII, RLR, PLR, HsCRP, and IL-6 were significant higher and LMR was lower in severe COVID-19 patients than in mild COVID-19 patients (p < .001). PLR and LMR were lower in the individuals with influenza A than those with COVID-19 (p < .01). COVID-19 patients with higher levels of NLR, SII, RLR, PLR, HsCRP, and IL-6 and lower LMR were significantly associated with the severe type. AUC of NLR (0.76) was larger while the specificity of IL-6 (86%) and sensitivity of HsCRP (89%) were higher than other inflammatory markers in predicating the typing of COVID-19. PT had obvious correlation with all the inflammatory markers except RPR. NLR showed positive correlations with AST, TP, BUN, CREA, PT, and D-dimer. Patients with high IL-6 levels have a relatively worse prognosis (HR = 2.30).

Conclusion: Peripheral blood inflammatory markers reflected the intensity of inflammation and associated with severity of COVID-19.NLR was more useful to predict severity as well as IL-6 to predict prognosis of COVID-19. PLR and LMR were initially found to be higher in SARS-CoV-2 virus-infected group than in influenza A.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/jcla.23657DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7744870PMC
January 2021

Fungal antigenemia in patients with severe Coronavirus disease 2019 (COVID-19): The facts and challenges.

J Microbiol Immunol Infect 2020 Aug 25;53(4):657-659. Epub 2020 May 25.

Influenza Reference Laboratory, Institute of Health Inspection and Testing, Hubei Provincial Center for Disease Control and Prevention, Wuhan 430079, China. Electronic address:

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jmii.2020.05.010DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7247483PMC
August 2020

Escherichia coli PagP Enzyme-Based De Novo Design and In Vitro Activity of Antibacterial Peptide LL-37.

Med Sci Monit 2017 May 27;23:2558-2564. Epub 2017 May 27.

Department of Laboratory Medicine, Huangshi Central Hospital, (Affiliated Hospital of Hubei Polytechnic University), Edong Healthcare Group, Huangshi, Hubei, China (mainland).

BACKGROUND The aim of this study was to investigate the antimicrobial property of peptide LL-37 sequences. MATERIAL AND METHODS Humanized antibacterial peptide LL-37 and the mutant were prepared by chemical synthesis. The physicochemical properties of antibacterial peptide LL-37 were analyzed by SWISS-MODEL online prediction tool. Molecular docking between antibacterial peptide LL-37 fragments and palmitoyl transferase PagP was made with Lamarckian genetic algorithm by AutoDock1.5.6. RESULTS The systems contacted each other at 8.75 picosec. After 20 picsec, the system had no trend of dissociation, and the bond energy of weak bond -C-O-H…NH2-CH2- was calculated. The hydrophobic groups were important factors that led to contact and merged the two parts. The contacted weak bond -C-O-H…NH2-CH2- was the bridge for contacting LL-37 with palmitoyl transferase PagP. The binding sites of antibacterial peptide LL-37 and palmitoyl transferase PagP mainly included LYS8, GLU11, LEU28, LYS12, PHE27, ILE13, and PHE6 of antibacterial peptide LL-37 and ARG94, TRP89, ASN65, SER3, GLU90, GLU90, ASN100, HIS102, and THR92 of palmitoyl transferase PagP. CONCLUSIONS Antibacterial peptide LL-37 had stronger antibacterial effect via inhibition of activity of PagP.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5458668PMC
http://dx.doi.org/10.12659/msm.902095DOI Listing
May 2017

Prevalence of mutations in HBV DNA polymerase gene associated with nucleos(t)ide resistance in treatment-naive patients with Chronic Hepatitis B in Central China.

Braz J Infect Dis 2016 Mar-Apr;20(2):173-8. Epub 2016 Feb 12.

Institute of Liver Disease, Hubei Provincial Hospital of Traditional Chinese Medicine, Wuhan, China.

Objective: There are a lot of disagreements in the studies on hepatitis B virus (HBV) DNA polymerase mutation rate associated with nucleos(t)ide analogues (NAs) in treatment-naive chronic hepatitis B (CHB) patients. This is the first study aimed to investigate the prevalence of spontaneous HBV resistance mutations in Central China.

Methods: This study included treatment-naive patients with CHB from June 2012 to May 2015 receiving care at the Institute of Liver Disease in Central China. All patients completed a questionnaire covering different aspects, such as family medical history, course of liver disease, medication history, alcohol use, among others. Mutations in HBV DNA polymerase associated with NAs resistance were detected using INNO-LiPA assay.

Results: 269 patients were infected with HBV genotype B (81.4%), C (17.9%), and both B and C (0.7%). Mutations in HBV DNA polymerase were detected in 24 patients (8.9%) including rtM204I/V (n=6), rtN236T (n=5), rtM250V (n=2), rtL180M (n=2), rtT184G (n=1), rtM207I (n=1), rtS202I (n=1), rtM204V/I & rtL180M (n=5), and rtM204I & rtM250V (n=1).

Conclusion: Spontaneous HBV resistance mutations in HBV DNA polymerase were found in treatment-naive patients with CHB in Central China. These findings suggest that we should analyze HBV DNA polymerase resistance mutation associated with NAs before giving antiviral therapy such as lamivudine (LAM), adefovir (ADV), and telbivudine (LdT).
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bjid.2015.12.006DOI Listing
December 2016

Relationship between cervical disease and infection with human papillomavirus types 16 and 18, and herpes simplex virus 1 and 2.

J Med Virol 2012 Dec;84(12):1920-7

The State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, China.

Persistent infection with high-risk HPV, particularly Type HPV 16 and 18, is necessary in the development of cervical cancer, but apart from HPV infection, other causative factors of most cervical cancers remain unknown. The aim of this study was to determine the prevalence of HPV 16 and HPV 18 and HSV 1 and HSV 2 in cervical samples, and to assess the role of HSVs in cervical carcinogenesis. Two hundred thirty-three healthy controls and 567 cases (333 of cervicitis, 210 of cervical intraepithelial neoplasia, and 24 of squamous cell carcinoma) in cervical exfoliative cells were tested for HPV 16, HPV 18, HSV 1, and HSV 2 DNA using the triplex real-time polymerase chain reaction method. In contrast to healthy women, positive rate of HPV is related significantly to cervical lesions (odds ratios (ORs) = 4.1, P < 0.01 for cervical intraepithelial neoplasia; ORs = 24.9, P < 0.01 for squamous cell carcinoma), but not cervicitis (ORs = 2.3, P > 0.05). HSV 2 prevalence in cervical intraepithelial neoplasia and squamous cell carcinoma was higher than in healthy women (ORs = 4.9, P < 0.05 for cervical intraepithelial neoplasia; ORs = 4.7, P < 0.05 for squamous cell carcinoma). HSV 2 coinfection with HPV in cervical intraepithelial neoplasia and squamous cell carcinoma was strongly higher than in healthy women (ORs = 34.2, P < 0.01 for cervical intraepithelial neoplasia; ORs = 61.1, P < 0.01 for squamous cell carcinoma). The obtained results indicated that the presence of HPV is associated closely with cervical cancer, and that HSV 2 infection or co-infection with HPV might be involved in cervical cancer development, while HSV 1 might not be involved.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/jmv.23353DOI Listing
December 2012

A novel multiplex real-time PCR assay for the detection and quantification of HPV16/18 and HSV1/2 in cervical cancer screening.

Mol Cell Probes 2012 Apr 25;26(2):66-72. Epub 2012 Jan 25.

The State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Hubei, Wuhan 430072, China.

Infection with human papillomavirus (HPV), particularly HPV16 and HPV18, is the main cause of invasive cervical cancer, although other factors such as herpes simplex virus (HSV) may act in conjunction with HPV in this context. To explore the possibility of developing a system for rapid diagnosis and clinical screening of cervical cancer, we developed a multiplex real-time PCR assay that can simultaneously detect and quantify HPV16/18 and HSV1/2. To evaluate its possibilities and practical uses, 177 samples collected from patients with suspected HPV and HSV infection in exfoliated cervical cells, genital herpes or labial herpes were tested by multiplex real-time PCR and compared with results obtained by DNA sequencing. Each virus was detected over a range from 1.0 × 10(1) to 1.0 × 10(7) copies/reaction. The clinical sensitivity was 100% for HPV16/18 and HSV1/2. The clinical specificity was 97.1% for HPV16, 98.1% for HPV18, 97.0% for HSV1 and 96.0% for HSV2. The kappa value was 0.96 for HPV16, 0.92 for HPV18, 0.94 for HSV1 and 0.93 for HSV2, when DNA sequencing was used as the reference standard. In summary, this novel multiplex real-time PCR allows the rapid and specific detection of HPV16/18 and HSV1/2, as well as coinfection with HPV and HSV, in clinical samples. In the future, this multiplex real-time PCR assay will assist in cervical cancer screening, viral treatment evaluation and epidemiological studies in which high throughput analysis is required.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.mcp.2012.01.003DOI Listing
April 2012

A highly sensitive TaqMan real-time PCR assay for early detection of Schistosoma species.

Acta Trop 2011 Oct-Nov;120(1-2):88-94. Epub 2011 Jul 8.

State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, China.

Schistosomiasis is a major infectious disease and a public health concern in many areas in China and other countries. Sensitive method for detection of the parasite is critical for early diagnosis and for monitoring of effective treatment of the disease. In this study, we developed a highly sensitive TaqMan real-time PCR assay for the detection of Schistosoma japonicum DNA in mouse feces and serum samples. This assay was based on the DNA sequence of the S. japonicum 18S rRNA gene and was able to detect 10 fg of S. japonicum genomic DNA, which is 100 times more sensitive than conventional PCR. We were able to detect the S. japonicum DNA one week post-infection in mouse sera and 4 weeks post-infection in feces, which was one week earlier than egg detection by microscopy in feces. This assay was also highly specific for Asian Schistosomes which are causative species of human Schistosomiasis. In single sex male cercariae infected mice, parasite DNA was only detected in the first 4 weeks post-infection, suggesting that the DNA was derived from decaying worms' corpse in the first 4 weeks whereas the DNA was mainly from decaying parasite eggs afterwards. Therefore we conclude that the established TaqMan real-time PCR assay is a sensitive, specific and convenient method that could be used for the early diagnostic evaluation of S. japonicum infection in humans and for monitoring outbreaks in endemic areas with low prevalence.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.actatropica.2011.06.006DOI Listing
March 2012

Novel multiplex real-time PCR system using the SNP technology for the simultaneous diagnosis of Chlamydia trachomatis, Ureaplasma parvum and Ureaplasma urealyticum and genetic typing of serovars of C. trachomatis and U. parvum in NGU.

Mol Cell Probes 2011 Feb 15;25(1):55-9. Epub 2010 Dec 15.

The State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, China.

To explore the possibilities of a novel multiplex real-time PCR system for rapid diagnosis, genetic typing of serovars and clinical application in NGU, we developed a multiplex real-time PCR system for the simultaneous diagnosis of Chlamydia trachomatis, Ureaplasma parvum and Ureaplasma urealyticum and molecular detection of serovars of C. trachomatis and U. parvum in NGU using the SNP technology and TaqMan-LNA probe. In 57 pathogen-positive clinical specimens, we identified the following C. trachomatis serovars: D (20.05%, 12/57), E (36.84%, 21/57), F (19.30%, 11/57), G (8.77%, 5/57), H (5.26%, 3/57), J (3.51%, 2/57), and K (5.26%, 3/57). In 115 pathogen-positive clinical specimens, we identified the following U. parvum serovars: 1 (0.87%, 2/115), 3 (55.65%, 64/115), 6 (20.87%, 24/115) and 14 (21.74%, 25/115). Our fast pathogen diagnosis and serotyping assay using real-time TaqMan-LNA PCR may improve our ability to study the pathogenesis and epidemiology of NGU.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.mcp.2010.12.001DOI Listing
February 2011