Publications by authors named "Yefu Wang"

48 Publications

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

Virol J 2021 02 18;18(1):38. Epub 2021 Feb 18.

Department of Clinical Laboratory, Hubei Provincial Hospital of Traditional Chinese Medicine, Wuhan, 430061, Hubei, China.

Background: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously.

Methods: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected.

Results: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found.

Conclusion: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12985-021-01510-6DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7891017PMC
February 2021

Acute and Subchronic Toxicities and Safety Pharmacology Studies of a Bacillus Subtilisin in Dogs.

Biol Pharm Bull 2021 Feb 4;44(2):211-218. Epub 2020 Dec 4.

State Key Laboratory of Virology, Wuhan University School of Life Sciences.

Subtilisin NAT, a Bacillus subtilisin, is widely applied as a functional food and considered to be one of the most exploitable potential oral thrombolytic agents. Subtilisin QK, another Bacillus subtilisin, is a serine protease fermented by Bacillus subtilis 02 and has a better thrombolytic effect. Therefore, subtilisin QK is typically used for evaluating the safety of Bacillus subtilisins. Here, we conduct several good laboratory practice (GLP)-compliant studies in non-rodent animal, i.e., in Beagle dogs, including acute toxicity, subchronic toxicity, and safety pharmacology studies. No adverse effects were evident in the acute and 28-d subchronic toxicity studies at doses up to 40000 FU/kg and 16000 FU/kg/d, respectively. In evaluating the pharmacological safety of up to 2000FU/kg subtilisin QK, we found no significant differences between the electrocardiograms, blood pressures, and respiration of beagle dogs. These findings suggest the safety of Bacillus subtilisin, providing reliable pharmacological and toxicological data for its development and popularization as a functional food and drug.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1248/bpb.b20-00659DOI Listing
February 2021

Decreased Resting-State Interhemispheric Functional Connectivity in Medication-Free Obsessive-Compulsive Disorder.

Front Psychiatry 2020 15;11:559729. Epub 2020 Sep 15.

National Clinical Research Center for Mental Disorders, and Department of Psychiatry, The Second Xiangya Hospital of Central South University, Changsha, China.

Objective: Decreased homotopic connectivity of brain networks such as the cortico-striato-thalamo-cortical (CSTC) circuits may contribute to the pathophysiology of obsessive-compulsive disorder (OCD). However, little is known about interhemispheric functional connectivity (FC) at rest in OCD. In this study, the voxel-mirrored homotopic connectivity (VMHC) method was applied to explore interhemispheric coordination at rest in OCD.

Methods: Forty medication-free patients with OCD and 38 sex-, age-, and education level-matched healthy controls (HCs) underwent a resting-state functional magnetic resonance imaging. The VMHC and support vector machine (SVM) methods were used to analyze the data.

Results: Patients with OCD had remarkably decreased VMHC values in the orbitofrontal cortex, thalamus, middle occipital gyrus, and precentral and postcentral gyri compared with HCs. A combination of the VMHC values in the thalamus and postcentral gyrus could optimally distinguish patients with OCD from HCs.

Conclusions: Our findings highlight the contribution of decreased interhemispheric FC within and outside the CSTC circuits in OCD and provide evidence to the pathophysiology of OCD.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fpsyt.2020.559729DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7522198PMC
September 2020

TSPAN1 promotes autophagy flux and mediates cooperation between WNT-CTNNB1 signaling and autophagy via the -FAM83A-TSPAN1 axis in pancreatic cancer.

Autophagy 2020 Oct 22:1-21. Epub 2020 Oct 22.

National "111" Center for Cellular Regulation and Molecular Pharmaceutics, Key Laboratory of Fermentation Engineering (Ministry of Education), Hubei University of Technology , Wuhan, China.

Pancreatic cancer is one of the most aggressive tumors associated with a poor clinical prognosis, weakly effective therapeutic options. Therefore, there is a strong impetus to discover new therapeutic targets in pancreatic cancer. In the present study, we first demonstrated that TSPAN1 is upregulated in pancreatic cancer and that TSPAN1 depletion decreases pancreatic cancer cell proliferation and . TSPAN1 expression was correlated with poor overall survival of pancreatic cancer patients. Moreover, we demonstrated that TSPAN1 is a novel positive regulator of macroautophagy/autophagy characterized by decreased LC3-II and SQSTM1/p62 expressions, inhibited puncta formation of GFP-LC3 and autophagic vacuoles. We also demonstrated that mutation impaired autophagy in the zebrafish model. Furthermore, we showed that TSPAN1 promoted autophagy maturation via direct binding to LC3 by two conserved LIR motifs. Mutations in the LIR motifs of TSPAN1 resulted in a loss of the ability to induce autophagy and promote pancreatic cancer proliferation. Second, we discovered two conservative TCF/LEF binding elements present in the promoter region of the gene, which was further verified through luciferase activity and ChIP assays. Furthermore, TSPAN1 was upregulated by FAM83A through the canonical WNT-CTNNB1 signaling pathway. We further demonstrated that both TSPAN1 and FAM83A are both direct targets of (microRNA 454). Additionally, we revealed the role of -FAM83A-TSPAN1 in the proliferation of pancreatic cancer cells and . Our findings suggest that components of the -FAM83A-TSPAN1 axis may be valuable prognosis markers or therapeutic targets for pancreatic cancer.: AMPK: adenosine 5'-monophosphate (AMP)-activated protein kinase; APC: APC regulator of WNT signaling pathway; ATG: autophagy related; AXIN2: axin 2; BECN1: beclin 1; CCND1: cyclin D1; CSNK1A1/CK1α: casein kinase 1 alpha 1; CTNNB1/β-catenin: catenin beta 1; DAPI: 4'6-diamino-2-phenylindole; EBSS: Earle's balanced salt solution; EdU: 5-ethynyl-20-deoxyuridine; FAM83A: family with sequence similarity 83 member A; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GFP: green fluorescent protein; GSEA: gene set enrichment analysis; GSK3B: glycogen synthase kinase 3 beta; IHC: immunohistochemical; LAMP1: lysosomal associated membrane protein 1; LIR: LC3-interacting region; MAP1LC3/LC3, microtubule associated protein 1 light chain 3; : microRNA 454; miRNA: microRNA; MKI67: antigen identified by monoclonal antibody Ki 67; MTOR: mechanistic target of rapamycin kinase; MTT: 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; MYC: MYC proto-oncogene, bHLH transcription factor; OS: overall survival; PDAC: pancreatic ductal adenocarcinoma; RAB7A: RAB7A, member RAS oncogene family; shRNA: short hairpin RNA; SQSTM1: sequestosome 1; TBE: TCF/LEF binding element; TCGA: The Cancer Genome Atlas; TCF/LEF: transcription factor/lymphoid enhancer binding factor; TCF4: transcription factor 4; TSPAN1: tetraspanin 1; TUNEL: terminal deoxynucleotidyl transferase mediated dUTP nick end labeling; UTR: untranslated region; WT: wild type.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/15548627.2020.1826689DOI Listing
October 2020

An Addition of U0126 Protecting Heart Grafts From Prolonged Cold Ischemia-Reperfusion Injury in Heart Transplantation: A New Preservation Strategy.

Transplantation 2021 02;105(2):308-317

Department of Pathology and Laboratory Medicine, Western University, London, ON, Canada.

Background: Ischemia-reperfusion injury (IRI) is the major cause of primary graft dysfunction in organ transplantation. The mitogen-activated protein kinase/extracellular signal-regulated kinase (ERK) signaling pathway plays a crucial role in cell physiological and pathological processes including IRI. This study aims to investigate whether inhibition of ERK signaling with U0126 can prevent prolonged cold IRI in heart transplantation.

Methods: Rat cardiac cell line H9c2 cells were treated with U0126 before exposure to hypothermic hypoxia/reoxygenation (H/R) conditions. The effect of U0126 on H9c2 cells in response to H/R stress was determined by measuring cell death, reactive oxygen species production, mitochondrial membrane potential, and ERK signaling activation. Mouse syngeneic heterotopic heart transplantation was conducted, where a donor heart was preserved in the University of Wisconsin (UW) solution supplemented with U0126 for 24 hours at 4°C before transplantation. Heart graft function, histopathologic changes, apoptosis, and fibrosis were measured to assess IRI.

Results: Phosphorylated ERK was increased in both in vitro H/R-injured H9c2 cells and in vivo heart grafts with IRI. Pretreatment with U0126 inhibited ERK phosphorylation and prevented H9c2 cells from cell death, reactive oxygen species generation, and mitochondrial membrane potential loss in response to H/R. Preservation of donor hearts with U0126-supplemented solution improved graft function and reduced IRI by reductions in cell apoptosis/death, neutrophil infiltration, and fibrosis of the graft.

Conclusions: Addition of U0126 to UW solution reduces ERK signal activation and attenuates prolonged cold IRI in a heart transplantation model. ERK inhibition with U0126 may be a useful strategy to minimize IRI in organ transplantation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1097/TP.0000000000003402DOI Listing
February 2021

Quantitative pharmacokinetic evaluation of Subtilisin QK-2 after a bolus IV injection in a rat model using a novel sandwich enzyme-linked immunosorbent assay.

J Pharm Biomed Anal 2020 Jul 17;186:113264. Epub 2020 Mar 17.

State Key Laboratory of Virology, Modern Research Center, College of Life Sciences, Wuhan University, Wuhan 430072, China. Electronic address:

Intravascular thrombosis is a main cause of multiple cardiovascular diseases. A high thrombolytic activity of the microbial fibrinolytic enzyme Subtilisin QK-2, which is highly homologous to Nattokinase, shows great exploitable potential in thrombolytic therapy. However, the lack of a sensitive detection method limits the further analysis of Subtilisin QK-2 in vivo. We prepared a polyclonal antibody and four monoclonal antibodies (IgG1, titers of 1:500,000) to establish a sensitive sandwich ELISA for Subtilisin QK-2 detection. The limit of detection (LOD) of this ELISA was 1.160 ng/mL. The linear range of the standard curve was 1.96-250 ng/mL (R = 0.9912). The cut-off value was 0.236. Subsequently, a pharmacokinetic dose (IV bolus) was administered and analyzed with the established ELISA. The concentration-time profiles were best fitted to a two-compartment model. T1/2α values for doses of 2 mg/kg, 4 mg/kg, and 8 mg/kg were 29.90 ± 10.02 min, 27.17 ± 1.96 min, and 21.83 ± 9.95 min, and T1/2β values were 144.43 ± 49.73 min, 173.46 ± 52.58 min, and 159.49 ± 48.75 min, respectively. Subtilisin QK-2 was eliminated through a mechanism with first-order kinetics. In conclusion, this study provides useful data for further research and clinical applications of Subtilisin QK-2 in the treatment of cardiovascular diseases.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jpba.2020.113264DOI Listing
July 2020

STYK1 promotes autophagy through enhancing the assembly of autophagy-specific class III phosphatidylinositol 3-kinase complex I.

Autophagy 2020 10 7;16(10):1786-1806. Epub 2019 Nov 7.

National "111" Center for Cellular Regulation and Molecular Pharmaceutics, Hubei University of Technology , Wuhan, China.

Macroautophagy/autophagy plays key roles in development, oncogenesis, and cardiovascular and metabolic diseases. Autophagy-specific class III phosphatidylinositol 3-kinase complex I (PtdIns3K-C1) is essential for autophagosome formation. However, the regulation of this complex formation requires further investigation. Here, we discovered that STYK1 (serine/threonine/tyrosine kinase 1), a member of the receptor tyrosine kinases (RTKs) family, is a new upstream regulator of autophagy. We discovered that STYK1 facilitated autophagosome formation in human cells and zebrafish, which was characterized by elevated LC3-II and lowered SQSTM1/p62 levels and increased puncta formation by several marker proteins, such as ATG14, WIPI1, and ZFYVE1. Moreover, we observed that STYK1 directly binds to the PtdIns3K-C1 complex as a homodimer. The binding with this complex was promoted by Tyr191 phosphorylation, by means of which the kinase activity of STYK1 was elevated. We also demonstrated that STYK1 elevated the serine phosphorylation of BECN1, thereby decreasing the interaction between BECN1 and BCL2. Furthermore, we found that STYK1 preferentially facilitated the assembly of the PtdIns3K-C1 complex and was required for PtdIns3K-C1 complex kinase activity. Taken together, our findings provide new insights into autophagy induction and reveal evidence of novel crosstalk between the components of RTK signaling and autophagy. : AICAR: 5-aminoimidazole-4-carboxamide ribonucleotide; AMPK: adenosine 5'-monophosphate (AMP)-activated protein kinase; ATG: autophagy related; ATP: adenosine triphosphate; BCL2: BCL2 apoptosis regulator; BECN1: beclin 1; Bre A: brefeldin A; Co-IP: co-immunoprecipitation; CRISPR: clustered regularly interspaced short palindromic repeats; DAPI: 4',6-diamidino-2-phenylindole; EBSS: Earle's balanced salt solution; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GFP: green fluorescent protein; GSEA: gene set enrichment analysis; MAP1LC3/LC3, microtubule associated protein 1 light chain 3; MAPK8/JNK1: mitogen-activated protein kinase 8; mRFP: monomeric red fluorescent protein; MTOR: mechanistic target of rapamycin kinase; MTT: 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; PIK3C3: phosphatidylinositol 3-kinase catalytic subunit type 3; PIK3R4: phosphoinositide-3-kinase regulatory subunit 4; qRT-PCR: quantitative reverse transcription PCR; RACK1: receptor for activated C kinase 1; RUBCN: rubicon autophagy regulator; siRNA: small interfering RNA; SQSTM1: sequestosome 1; STYK1/NOK: serine/threonine/tyrosine kinase 1; TCGA: The Cancer Genome Atlas; Ub: ubiquitin; ULK1: unc-51 like autophagy activating kinase 1; UVRAG: UV radiation resistance associated; WIPI1: WD repeat domain, phosphoinositide interacting 1; ZFYVE1: zinc finger FYVE-type containing 1.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/15548627.2019.1687212DOI Listing
October 2020

Insulin and its single-chain analogue.

Appl Microbiol Biotechnol 2019 Nov 21;103(21-22):8737-8751. Epub 2019 Oct 21.

State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, 430072, China.

Insulin therapy remains the most effective method to treat diabetes mellitus (DM), and the demand for this valuable hormone has exceeded that of any other protein-based medicine as a result of the dramatic increase in the number of diabetic patients worldwide. Understanding the structure of insulin and the interaction with its receptor is important for developing proper formulations. As a result of the relatively low thermal stability of native insulin and its two-chain analogues, the application of single-chain insulin (SCI) analogues, which can be obtained relatively easily by recombinant DNA technology or chemical synthetic methods, represents a promising alternative approach. In this review, the basic knowledge of insulin (discovery, biosynthesis, and structure) and the current model of the interaction with its receptor are outlined. Furthermore, we outline the strategies for the design and production of various SCI analogues and their reported applications.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00253-019-10170-0DOI Listing
November 2019

Increased cerebellar-default-mode network connectivity at rest in obsessive-compulsive disorder.

Eur Arch Psychiatry Clin Neurosci 2020 Dec 30;270(8):1015-1024. Epub 2019 Sep 30.

Department of Psychiatry, Qiqihar Medical University, Qiqihar, Heilongjiang, 161006, China.

Abnormalities of the cerebellum and default-mode network (DMN) in patients with obsessive-compulsive disorder (OCD) have been widely reported. However, alterations of reciprocal functional connections between the cerebellum and DMN at rest in OCD remain unclear. Forty patients with OCD and 38 gender-, age-, and education-matched healthy controls (HCs) underwent resting-state functional magnetic resonance imaging scan. Seed-based functional connectivity (FC) and support vector machine (SVM) were applied to analyze the imaging data. Compared with HCs, patients with OCD exhibited increased FCs between the left Crus I-left superior medial prefrontal cortex (MPFC) and between the right Crus I-left superior MPFC, left middle MPFC, and left middle temporal gyrus (MTG). A significantly negative correlation was observed between the right Crus I-left MTG connectivity and the Yale-Brown Obsessive-Compulsive Scale compulsion subscale scores in the OCD group (r = - 0.476, p = 0.002, Bonferroni corrected). SVM classification analysis indicated that a combination of the left Crus I-left superior MPFC connectivity and the right Crus I-left middle MPFC connectivity can be used to discriminate patients with OCD from HCs with a sensitivity of 85.00%, specificity of 68.42%, and accuracy of 76.92%. Our study highlights the contribution of the cerebellar-DMN connectivity in OCD pathophysiology and provides new findings to OCD research.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00406-019-01070-5DOI Listing
December 2020

Oral delivery of single-chain insulin (SCI-59) analog by bacterium-like particles (BLPs) induces oral tolerance and prevents autoimmune diabetes in NOD mice.

Immunol Lett 2019 10 29;214:37-44. Epub 2019 Aug 29.

State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, 430072, China.

Oral tolerance, induced by oral administration of autoantigens, is a promising therapeutic approach to treat type 1 diabetes mellitus (T1DM). However, the degradation of antigens passing through the gastrointestinal tract (GIT) leads to low induction efficiency. Based on our previous study, a single-chain insulin (SCI-59) analog, bound to the surface of lactic acid bacteria (LAB) bacterium-like particles (BLPs), was more stable in the simulated gastric fluid, compared to free SCI-59 and insulin. Based on the analysis of diabetes progression, a significant decrease in the incidence of diabetes was observed in mice fed BLPs-SCI-59. Oral administration of BLPs-SCI-59 can enhance glucose tolerance in NOD mice and this effect may result from the protection of pancreatic islet beta cells, as compared to the free SCI-59 group and BLPs group. Oral administration of BLPs-SCI-59 can significantly reduce insulitis and preserve the ability of insulin secretion in treated mice. Oral vaccination with BLPs-SCI-59 induced SCI-59 specific T cell tolerance in treated mice, which may due to the repair of Th1/Th2 imbalance and increased CD4CD25FoxP3 regulatory T cells (Tregs). These results show that oral vaccination with BLPs-SCI-59 is a promising way to prevent T1DM in NOD mice.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.imlet.2019.08.008DOI Listing
October 2019

Integral membrane protein 2A inhibits cell growth in human breast cancer via enhancing autophagy induction.

Cell Commun Signal 2019 08 22;17(1):105. Epub 2019 Aug 22.

The State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, China.

Background: Breast cancer is a life-threatening disease in females and the leading cause of mortality among the female population, presenting huge challenges for prognosis and treatment. ITM2A is a member of the BRICHOS superfamily, which are thought to have a chaperone function. ITM2A has been identified to related to ovarian cancer progress recently. However, the biological role of ITM2A in breast cancer remains largely unclear.

Methods: Quantitative real-time polymerase chain reaction (qRT-PCR), western blotting assay and immunohistochemistry staining were used to analyzed the expression level of ITM2A. The patient overall survival versus ITM2A expression level was evaluated by Kaplan-Meier analysis. MTT assay, EdU incorporation assay and colony formation assay were used to evaluated the role of ITM2A on breast cancer cell proliferation. Autophagy was explored through autophagic flux detection using a confocal microscope and autophagic vacuoles investigation under a transmission electron microscopy (TEM). In vitro kinase assay was used to investigated the phosphorylation modification of ITM2A by HUNK.

Results: Our data showed that the expression of integral membrane protein 2A (ITM2A) was significantly down-regulated in human breast cancer tissues and cell lines. Kaplan-Meier analysis indicated that patients presenting with reduced ITM2A expression exhibited poor overall survival, and expression significantly correlated with age, progesterone receptor status, TNM classification and tumor stage. ITM2A overexpression significantly inhibited the proliferation of breast cancer cells. By studying several autophagic markers and events in human breast cancer SKBR-3 cells, we further demonstrated that ITM2A is a novel positive regulator of autophagy through an mTOR-dependent manner. Moreover, we found that ITM2A was phosphorylated at T35 by HUNK, a serine/threonine kinase significantly correlated with human breast cancer overall survival and HER2-induced mammary tumorigenesis.

Conclusion: Our study provided evidence that ITM2A functions as a novel prognostic marker and represents a potential therapeutic target.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12964-019-0422-7DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6704577PMC
August 2019

The Function and Therapeutic Potential of Epstein-Barr Virus-Encoded MicroRNAs in Cancer.

Mol Ther Nucleic Acids 2019 Sep 15;17:657-668. Epub 2019 Jul 15.

Institute for Translational Medicine, Medical College of Qingdao University, Dengzhou Road 38, Qingdao 266021, China. Electronic address:

Epstein-Barr virus (EBV) is a ubiquitous human γ-herpesvirus that infects over 90% of the global population. EBV is considered a contributory factor in a variety of malignancies including nasopharyngeal carcinoma, gastric carcinoma, Burkitt lymphoma, and Hodgkin's lymphoma. Notably, EBV was the first virus found to encode microRNAs (miRNAs). Increasing evidence indicates that EBV-encoded miRNAs contribute to the carcinogenesis and development of EBV-associated malignancies. EBV miRNAs have been shown to inhibit the expression of genes involved in cell proliferation, apoptosis, invasion, and immune signaling pathways. Therefore, EBV miRNAs perform a significant function in the complex host-virus interaction and EBV-driven carcinogenesis. However, the integrated mechanisms underlying the roles of EBV miRNAs in carcinogenesis remain to be further explored. In this review, we describe recent advances regarding the involvement of EBV miRNAs in the pathogenesis of EBV-associated malignancies and discuss their potential utility as cancer biomarkers. An in-depth investigation into the pro-carcinogenic role of EBV miRNAs will expand our knowledge of the biological processes associated with virus-driven tumors and contribute to the development of novel therapeutic strategies for the treatment of EBV-associated malignancies.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.omtn.2019.07.002DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6698931PMC
September 2019

Affinity binding of aptamers to agarose with DNA tetrahedron for removal of hepatitis B virus surface antigen.

Colloids Surf B Biointerfaces 2019 Jun 20;178:80-86. Epub 2019 Feb 20.

State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, 430072, PR China. Electronic address:

DNA nanostructures are effective intermediates for immobilizing biomolecules because of their high level of controllability, the flexibility to create desired nanostructures through precision "bottom-up" assembly and the convenience to building fine nanostructures. The purpose of this study was to demonstrate the potential use of aptamers bound to agarose through a DNA tetrahedral structure to make a novel type of immunosorbent for the removal of hepatitis B virus surface antigens. Our results show that the proposed immunosorbent exhibits favorable biocompatibility and specificity. Electrophoresis and confocal microscopy were used to confirm the formation of immunosorbents. The ARCHITECT HBsAg assay was performed to quantitatively measure hepatitis B surface antigen. The cytotoxic potential of the immunosorbent was determined by an in vitro viability assay using V79 lung fibroblasts, demonstrating that the immunosorbents are noncytotoxic. The high adsorption capacity of the novel DNA nanostructure-based adsorbents towards hepatitis B surface antigen indicated the potential application of these materials for the treatment of Hepatitis B infection.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.colsurfb.2019.02.040DOI Listing
June 2019

The Removal of HBV in Plasma by Extracorporeal Immunoadsorption from Plasma: A Potential Therapy of Hepatitis B Patients.

Biomed Res Int 2018 23;2018:1269063. Epub 2018 Dec 23.

State Key Laboratory of Virology, Modern Virology Research Center, College of Life Sciences, Wuhan University, Wuhan 430072, China.

Objective: To establish a novel HBV specific immunoadsorbent for the removing of HBV particles.

Methods: The anti-HBsAg monoclonal antibody was immobilized on sepharose beads to produce a sepharose anti-HBs column. Then the immunoadsorbent was evaluated and characterized by scanning electron microscopy. In addition, time-dependent effects of the eradication capacity of anti-HBsAg functionalized sepharose beads against HBV were investigated.

Results: Proposed immunoadsorbents exhibited a favorable biocompatibility as well as specificity. With the optimized recycle time, the decontamination performance of HBV particles and quantity of HBsAg were assessed either by real-time quantitative PCR or ELISA, which showed that the immunoadsorbent could remove approximately 90% of the HBV and 90% of the HBsAg from human plasma samples.

Conclusions: All these results indicated that the novel immunoadsorbent could effectively remove HBV particles and likely serve as a novel therapy option or at least supplementary for the treatment regimen of HBV.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2018/1269063DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6323487PMC
May 2019

Identification of glycerol-3-phosphate dehydrogenase 1 as a tumour suppressor in human breast cancer.

Oncotarget 2017 Nov 19;8(60):101309-101324. Epub 2017 Sep 19.

Institute of Biomedical and Pharmaceutical Sciences, Key Laboratory of Fermentation Engineering (Ministry of Education), Hubei Provincial Cooperative Innovation Center of Industrial Fermentation, Hubei Key Laboratory of Industrial Microbiology, Hubei University of Technology, Wuhan, Hubei, China.

In the present study, we found the mRNA expression level of glycerol-3-phosphate dehydrogenase (GPD1) was significantly downregulated in human breast cancer patients. Patients with reduced GPD1 expression exhibited poorer overall metastatic relapse-free survival ( = 0.0013). Further Cox proportional hazard model analysis revealed that the reduced expression of GPD1 is an independent predictor of overall survival in oestrogen receptor-positive ( = 0.0027, HR = 0.91, 95% CI = 0.85-0.97, = 3,917) and nodal-negative ( = 0.0013, HR = 0.87, 95% CI = 0.80-0.95, = 2,456) breast cancer patients. We also demonstrated that GPD1 was a direct target of miR-370, which was significantly upregulated in human breast cancer. We further showed that exogenous expression of GPD1 in human MCF-7 and MDA-MB-231 breast cancer cells significantly inhibited cell proliferation, migration, and invasion. Our results, therefore, suggest a novel tumour suppressor function for GPD1 and contribute to the understanding of cancer metabolism.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18632/oncotarget.21087DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5731876PMC
November 2017

Pygopus2 inhibits the efficacy of paclitaxel-induced apoptosis and induces multidrug resistance in human glioma cells.

Oncotarget 2017 Apr;8(17):27915-27928

Institute of Biomedical and Pharmaceutical Sciences, Key Laboratory of Fermentation Engineering (Ministry of Education), College of Bioengineering, Hubei University of Technology, Wuhan, 430068, China.

Anti-microtubule drugs, such as paclitaxel (PTX), are extensively used for the treatment of numerous cancers. However, growing evidence has shown that PTX resistance, either intrinsic or acquired, frequently occurs in patients and results in the failure of treatment, contributing to the high cancer mortality rate. Therefore, it is necessary to identify the genes or pathways involved in anti-microtubule drug resistance for future successful treatment of cancers. Pygopus2 (Pygo2), which contains a Zn-coordinated plant homeodomain (PHD) finger domain, is critical for β-catenin-dependent transcriptional switches in normal and malignant tissues and is over-expressed in various cancers, including human brain glioma. In this study, we report that over-expression of Pygo2 inhibited the efficacy of PTX and contributed to cell multidrug resistance in two different ways. First, over-expression of Pygo2 inhibited the PTX-induced phosphorylation of B-cell lymphoma 2 (Bcl-2), suppressing the proteolytic cleavage of procaspase-8/9 and further inhibiting the activation of caspase-3, which also inhibits the activation of the JNK/SAPK pathway, ultimately inhibiting cell apoptosis. Second, over-expression of Pygo2 facilitated the expression of P-glycoprotein, which acts as a drug efflux pump, by promoting the transcription of Multi-drug resistance 1 (MDR1) at the MDR1 promoter loci, resulting in acceleration of the efflux of PTX.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18632/oncotarget.15843DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5438618PMC
April 2017

Secretory expression and surface display of a new and biologically active single-chain insulin (SCI-59) analog by lactic acid bacteria.

Appl Microbiol Biotechnol 2017 Apr 24;101(8):3259-3271. Epub 2017 Jan 24.

State Key Laboratory of Virology, College of Life Sciences|, Wuhan University, Wuhan, 430072, China.

Insulin plays an important role in drug therapies for diabetes mellitus and as the main route of insulin delivery, subcutaneous injection may cause local discomfort, hypoglycemia, hyperinsulinemia, and patient non-compliance. Therefore, oral delivery of insulin is more preferred. However, there is a low bioavailability due to insulin degradation by proteolytic enzymes and severe pH conditions along the gastrointestinal tract. In order to use the food-grade bacteria lactic acid bacteria (LAB) as oral delivery vehicles, a new and bioactive single-chain insulin (SCI-59) analog, containing the insulin B- and A-chains connected by an eight-residue linker (RSRGLPFR), was secretory expressed in Lactococcus lactis NZ3900 without using an antibiotic resistance gene and displayed onto the surface of various non-viable bacteria (NVBs) without genetic modification. Both the free SCI-59 and SCI-59 displayed on the surface of NVBs are biologically active as assayed by their ability to stimulate Akt signaling in differentiated 3T3-L1 adipocytes. Modification of the pH of the medium by NaOH addition at early time during induction can enhance the bioactivity of SCI-59. The C-terminal fused anchoring domain, three LysM repeats, does not affect the formation of disulfide bonds and/or the folding of SCI-59, and SCI-59 could be exposed properly and fully when SCI-59-3LysM bound to the surface of NVBs. Compared to the free form SCI-59, SCI-59 displayed on the surface of NVBs is more stable in simulate gastric juice. It may open new prospects for possible oral treatments of diabetes using live LAB secreting or NVBs carrying bioactive SCI analogs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00253-017-8125-8DOI Listing
April 2017

Tumor-Specific D-Dimer Concentration Ranges and Influencing Factors: A Cross-Sectional Study.

PLoS One 2016 11;11(11):e0165390. Epub 2016 Nov 11.

The State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, Hubei 430072, China.

D-dimer level in cancer patients is associated with risk of venous thromboembolism and deep venous thrombosis. Most cancer patients have "abnormal" D-dimer levels based on the current normal reference range. To investigate tumor-specific D-dimer reference range, we compared D-dimer levels for nine different tumour types with healthy controls by using simultaneous quantile regression and constructing a median, 5th percentile, and 95th percentile model of normal tumour D-dimer concentration. Associations with tumour primary site, stage, pathological type, and treatment were also explored. Additionally, 190 patients were tracked to reveal the relevance of initial D-dimer levels to cancer prognosis. D-dimer ranges (median, 5th, 95th) in various cancers (mg/L) were: liver 1.12, 0.27, 5.25; pancreatic 0.96, 0.23, 4.81; breast 0.44, 0.2, 2.17; gastric 0.65, 0.22, 5.03; colorectal 0.73, 0.22, 4.45; lung 0.7, 0.25, 4.0; gynaecological 0.61, 0.22, 3.98; oesophageal 0.23, 0.7, 3.45; and head and neck 0.22, 0.44, 2.19. All were significantly higher than that of healthy controls (0.18, 0.07, 0.57). D-dimer peaked 1-2 days postoperatively but had decreased to the normal range by 1 week. Additionally, cancer patients with high initial D-dimer were shown a tendency of poor prognosis in survival rate. In conclusion, D-dimer levels in cancer depend on patient age, tumour primary site, and tumour stage. Thrombosis prevention is necessary if D-dimer has not decreased to the tumor-specific baseline a week after surgery.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0165390PLOS
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5105993PMC
June 2017

Surface display on lactic acid bacteria without genetic modification: strategies and applications.

Appl Microbiol Biotechnol 2016 Nov 20;100(22):9407-9421. Epub 2016 Sep 20.

State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, 430072, People's Republic of China.

Microbial cell surface display has attracted greater attention than ever and has numerous potential applications in biotechnology. With the safety and probiotic properties, lactic acid bacteria (LAB) have been used widely in food and industrial applications. In order to circumvent using genetically modified microorganisms which face low public acceptance and severe regulatory scrutiny, surface-engineered LAB without genetical modification are more preferred. According to the way used to obtain the fusion protein containing the passenger molecule and anchoring domain, the genetic or chemical approaches can be used to construct these surface-engineered LAB. In addition to the viable wide-type LAB, non-living bacterial-like particles (BLP) can be attached by these fusion proteins added from outside. Compared to the living LAB, BLP have a higher binding capacity and less anticarrier response. Mucosal vaccines are the predominant application of these surface-engineered LAB with no genetical modification.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00253-016-7842-8DOI Listing
November 2016

Prognostic significance of PLIN1 expression in human breast cancer.

Oncotarget 2016 Aug;7(34):54488-54502

Institute of Biomedical and Pharmaceutical Sciences, and Provincial Cooperative Innovation Center, College of Bioengineering, Hubei University of Technology, Wuhan, Hubei, China.

Breast cancer is a heterogeneous disease associated with diverse clinical, biological and molecular features, presenting huge challenges for prognosis and treatment. Here we found that perilipin-1 (PLIN1) mRNA expression is significantly downregulated in human breast cancer. Kaplan-Meier analysis indicated that patients presenting with reduced PLIN1 expression exhibited poorer overall metastatic relapse-free survival (p = 0.03). Further Cox proportional hazard models analysis revealed that the reduced expression of PLIN1 is an independent predictor of overall survival in estrogen receptor positive (p < 0.0001, HR = 0.87, 95% CI = 0.81-0.92, N = 3,600) and luminal A-subtype (p = 0.02, HR = 0.88, 95% CI = 0.78-0.98, N = 1,469) breast cancer patients. We also demonstrated that the exogenous expression of PLIN1 in human breast cancer MCF-7 and MDA-MB-231 cells significantly inhibits cell proliferation, migration, invasion and in vivo tumorigenesis in mice. Together, these data provide novel insights into a prognostic significance of PLIN1 in human breast cancer and reveal a potentially new gene therapy target for breast cancer.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18632/oncotarget.10239DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5342357PMC
August 2016

Recent advances in the production of recombinant subunit vaccines in Pichia pastoris.

Bioengineered 2016 Apr;7(3):155-65

b State Key Laboratory of Virology , College of Life Sciences, Wuhan University , Wuhan , China.

Recombinant protein subunit vaccines are formulated using defined protein antigens that can be produced in heterologous expression systems. The methylotrophic yeast Pichia pastoris has become an important host system for the production of recombinant subunit vaccines. Although many basic elements of P. pastoris expression system are now well developed, there is still room for further optimization of protein production. Codon bias, gene dosage, endoplasmic reticulum protein folding and culture condition are important considerations for improved production of recombinant vaccine antigens. Here we comment on current advances in the application of P. pastoris for the synthesis of recombinant subunit vaccines.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/21655979.2016.1191707DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4927204PMC
April 2016

Subtilisin QK-2: secretory expression in Lactococcus lactis and surface display onto gram-positive enhancer matrix (GEM) particles.

Microb Cell Fact 2016 May 12;15:80. Epub 2016 May 12.

State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, 430072, People's Republic of China.

Background: Purified from the supernatant of Bacillus subtilis QK02 culture broth, Subtilisin QK-2 is a type of effective thrombolytic reagent that has great exploitable potential. However, the unbearable flavor that occurs with fermentation and the complicated methods that are required to obtain pure products limit the application of this enzyme. Lactic acid bacteria (LAB)-based delivery vehicles are promising as cheap and safe options for medicinal compounds. The secretory expression and surface display using LAB may popularize Subtilisin QK-2 more easily and conveniently with minimal adverse effects.

Results: Subtilisin QK-2 was expressed successfully in two forms using lactic acid bacteria. For the secretory expression in Lactococcus lactis, Subtilisin QK-2 was efficiently secreted into the culture using the promoter P nisA and signal peptide SPUsp. The expression levels were not different in L. lactis NZ9000 and NZ3900 without the effect of different selection markers. However, leaky expression was only detected in L. lactis NZ3900. The biological activity of this secreted Subtilisin QK-2 was enhanced by modulating the pH of medium to slightly alkaline during induction and by codon optimization of either the entire gene sequence (qk') or only the propeptide gene sequence (qkpro'). For surface display onto gram-positive enhancer matrix (GEM) particles, n LysM repeats from the C-terminal region of the major autolysin AcmA of L. lactis were fused to either the C-terminus (n = 1, 3, 5) or the N-terminus (n = 1) of the Subtilisin QK-2. These fusion proteins were secreted into the culture medium, and the QK-3LysM was able to bind to the surface of various LAB GEM particles without a loss of fibrinolytic activity. Furthermore, the binding capacity significantly increased with a higher concentration of QK-3LysM. Compared to the free-form Subtilisin QK-2, the QK-3LysM displayed on the surface of GEM particles was more stable in the simulated gastric juice.

Conclusions: Combined with the safety and popularity of LAB, Subtilisin QK-2 may be easily applied worldwide to prevent and control thrombosis diseases.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12934-016-0478-7DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4866291PMC
May 2016

Adsorption and separation of HCV particles by novel affinity aptamer-functionalized adsorbents.

J Chromatogr B Analyt Technol Biomed Life Sci 2016 Apr 5;1017-1018:174-181. Epub 2016 Mar 5.

State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, PR China. Electronic address:

A novel type of aptamer-functionalized immunoadsorbent was prepared and characterized to remove HCV particles, a promising option of extracorporeal immunoadsorption (ECI) therapy against HCV. Herein, we fabricated a HCV-specific immunoadsorbent where single-stranded DNA aptamers reported and studied previously, modified with amino group at the 5' terminus, was immobilized covalently onto surfaces of carboxylated-derivative sepharose 4FF beads through N-hydroxysuccinimide (NHS) linkage. Then the adsorbents was evaluated and characterized by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Subsequently, we also confirmed that proposed immunoadsorbents exhibited a favorable biocompatibility as well as specificity. In addition, time-dependent effects of the eradication capacity of aptamer functionalized sepharose beads against HCV was investigated. With the optimized time point, the decontamination performance of HCV particles was assessed by real-time quantitative PCR (qPCR) followed by nucleic acid-based hybridization (NAH), which shows sorbents with an aptamer density of 2nmolligand/ml resin could remove approximately 80% (i.e. 8.9×10(6) HCV particles/ml resin) of the HCV genotype 2a cultivated in vitro and 75% (vary with the intial concentration of HCV from about 7.5×10(4)-4.4×10(5) HCV particles/ml resin) of the HCV samples from human plasma samples. All these results indicated that the novel aptamer-based adsorbents could effectively remove HCV particles and likely serve as a novel therapy option or at least supplementary for the treatment regimen of HCV.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jchromb.2016.03.004DOI Listing
April 2016

Pygo2 functions as a prognostic factor for glioma due to its up-regulation of H3K4me3 and promotion of MLL1/MLL2 complex recruitment.

Sci Rep 2016 Feb 23;6:22066. Epub 2016 Feb 23.

Membrane Protein Disease and Cancer Research Center, Provincial Cooperative Innovation Center of Industrial Fermentation, College of Bioengineering, Hubei University of Technology, Wuhan, Hubei, 430068, China.

Pygo2 has been discovered as an important Wnt signaling component contributing to the activation of Wnt-target gene transcription. In the present study, we discovered that Pygo2 mRNA and protein levels were up-regulated in the majority of (152/209) human brain glioma tissues and five glioma cell lines, and significantly correlated with the age, the WHO tumor classification and poor patient survival. The histone methyltransferase complex components (WDR5, Ash2, and menin, but not CXCC1 or NCOA6) were down-regulated at the promoter loci of Wnt target genes after Pygo2 knockdown, and this was accompanied by the down-regulation of Wnt/β-catenin pathway activity. Further, we demonstrated that the involvement of Pygo2 in the activation of the Wnt pathway in human glioma progression is through up-regulation of the H3K4me3 (but not H3K4me2) by promoting the recruitment of the histone methyltransferase MLL1/MLL2 complex to Wnt target gene promoters. Thus, our study provided evidence that Pygo2 functions as a novel prognostic marker and represents a potential therapeutic target.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/srep22066DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4763266PMC
February 2016

Expression and immunogenic characterization of recombinant gp350 for developing a subunit vaccine against Epstein-Barr virus.

Appl Microbiol Biotechnol 2016 Feb 3;100(3):1221-1230. Epub 2015 Oct 3.

State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, 430072, China.

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus that is linked to the development of various malignancies. There is an urgent need for effective vaccines against EBV. EBV envelope glycoprotein gp350 is an attractive candidate for a prophylactic vaccine. This study was undertaken to produce the truncated (codons 1-443) gp350 protein (gp350(1-443)) in Pichia pastoris and evaluate its immunogenicity. The gp350(1-443) protein was expressed as a secretory protein with an N-terminal His-tag in P. pastoris and purified through Ni-NTA chromatography. Immunization with the recombinant gp350(1-443) could elicit high levels of gp350(1-443)-specific antibodies in mice. Moreover, gp350(1-443)-immunized mice developed strong lymphoproliferative and Th1/Th2 cytokine responses. Furthermore, the recombinant gp350(1-443) could stimulate CD4(+) and CD8(+) T cell responses in vaccinated mice. Collectively, these findings demonstrated that the yeast-expressed gp350(1-443) retained strong immunogenicity. This study will provide a useful source for developing EBV subunit vaccine candidates.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00253-015-7027-xDOI Listing
February 2016

Long-term supranutritional supplementation with selenate decreases hyperglycemia and promotes fatty liver degeneration by inducing hyperinsulinemia in diabetic db/db mice.

PLoS One 2014 1;9(7):e101315. Epub 2014 Jul 1.

State Key Laboratory for Animal Nutrition, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing, P. R. China.

There are conflicting reports on the link between the micronutrient selenium and the prevalence of diabetes. To investigate the possibility that selenium acts as a "double-edged sword" in diabetes, cDNA microarray profiling and two-dimensional differential gel electrophoresis coupled with mass spectrometry were used to determine changes in mRNA and protein expression in pancreatic and liver tissues of diabetic db/db mice in response to dietary selenate supplementation. Fasting blood glucose levels increased continuously in db/db mice administered placebo (DMCtrl), but decreased gradually in selenate-supplemented db/db mice (DMSe) and approached normal levels after termination of the experiment. Pancreatic islet size was increased in DMSe mice compared with DMCtrl mice, resulting in a clear increase in insulin production and a doubling of plasma insulin concentration. Genes that encode proteins involved in key pancreatic β-cell functions, including regulation of β-cell proliferation and differentiation and insulin synthesis, were found to be specifically upregulated in DMSe mice. In contrast, apoptosis-associated genes were downregulated, indicating that islet function was protected by selenate treatment. Conversely, liver fat accumulation increased in DMSe mice together with significant upregulation of lipogenic and inflammatory genes. Genes related to detoxification were downregulated and antioxidant enzymatic activity was reduced, indicating an unexpected reduction in antioxidant defense capacity and exacerbation of fatty liver degeneration. Moreover, proteomic analysis of the liver showed differential expression of proteins involved in glucolipid metabolism and the endoplasmic reticulum assembly pathway. Taken together, these results suggest that dietary selenate supplementation in db/db mice decreased hyperglycemia by increasing insulin production and secretion; however, long-term hyperinsulinemia eventually led to reduced antioxidant defense capacity, which exacerbated fatty liver degeneration.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0101315PLOS
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4077766PMC
November 2015

Visual detection and evaluation of latent and lytic gene expression during Epstein-Barr virus infection using one-step reverse transcription loop-mediated isothermal amplification.

Int J Mol Sci 2013 Dec 9;14(12):23922-40. Epub 2013 Dec 9.

The State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, Hubei, China.

Epstein-Barr virus (EBV)-associated disease exhibits distinct gene expression patterns characterized by the transcription of EBV nuclear antigen (EBNA) 1, EBNA2, latent membrane protein (LMP) 1, LMP2A, and BZLF1 (Zebra). A series of visual reverse transcript loop-mediated isothermal amplification (RT-LAMP) assays were performed to examine the expression of EBNA1, EBNA2, LMP1, LMP2A and BZLF1. The sensitivity of RT-LAMP for these transcripts was approximately equivalent to real-time RT-PCR (RT-qPCR), which was developed to quantify relative levels of EBV transcripts, and 10 to 100-fold more sensitive than conventional RT-PCR. Cross-reactions to other viruses were not observed upon examination of cell lines infected with herpes simplex viruses-1 and -2 (HSV-1 and -2), varicella zoster virus (VZV), human cytomegalovirus (HCMV) or Kaposi's sarcoma-associated herpesvirus. When applied to 146 specimens, RT-LAMP exhibited high clinical sensitivity and specificity, with an excellent agreement (κ > 0.92) compared to RT-qPCR. These assays are convenient for rapid early diagnosis and for surveillance of EBV-infected individuals by evaluating the EBV transcriptional profile, because the results can be visualized with the naked eye. These assays may be employed in further investigations because they can aid the design of improved therapeutic regimens and can be used specifically in resource-poor settings.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/ijms141223922DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3876086PMC
December 2013

Expression, purification, and immunogenic characterization of Epstein-Barr virus recombinant EBNA1 protein in Pichia pastoris.

Appl Microbiol Biotechnol 2013 Jul 18;97(14):6251-62. Epub 2013 May 18.

State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, People's Republic of China.

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus associated with the development of both lymphoid and epithelial tumors. EBNA1 is the only viral protein expressed in all EBV-associated malignancies and plays important roles in EBV latency. Thus, EBNA1 is thought to be a promising antigen for immunotherapy of all EBV-associated malignancies. This study was undertaken to produce recombinant EBNA1 protein in Pichia pastoris and evaluate its immunogenicity. The truncated EBNA1 (E1ΔGA, codons 390-641) was expressed as a secretory protein with an N-terminal histidine tag in the methylotrophic yeast P. pastoris and purified by Ni-NTA affinity chromatography. The purified proteins were then used as antigens to immunize BALB/c mice for production of polyclonal antibodies. Western blot analysis showed that the polyclonal antibodies specifically recognized the EBNA1 protein in B95-8 cell lysates. The recombinant E1ΔGA also induced strong lymphoproliferative and Th1 cytokine responses in mice. Furthermore, mice immunized with E1ΔGA developed CD4+ and CD8+ T cell responses. These findings showed that the yeast-expressed E1ΔGA retained good immunogenicity and might be a promising vaccine candidate against EBV-associated malignancies.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00253-013-4967-xDOI Listing
July 2013

SHP-1 regulation of mast cell function in allergic inflammation and anaphylaxis.

PLoS One 2013 4;8(2):e55763. Epub 2013 Feb 4.

Division of Allergy and Clinical Immunology, Johns Hopkins Asthma and Allergy Center, Baltimore, Maryland, USA.

Allergic inflammation and severe allergic reactions (anaphylaxis) are important in allergen induced diseases. Bacterial products such as lipopolysaccharide (LPS) are ubiquitous and can facilitate allergen induced Th2 immune responses. Phosphatase SHP-1 is critical in regulating immunological homeostasis and in allergen induced Th2 immune responses in the lung. However, the mechanisms underlying the initiation of allergic inflammation and allergen induced anaphylaxis are still not completely elucidated and it is unclear whether SHP-1 plays any role in LPS-induced airway inflammation and in allergen-induced anaphylaxis. In this study we tested the hypothesis that phosphatase SHP-1 plays an important role in allergic inflammation and anaphylaxis and determined whether its effects are through regulation of mast cell functions. SHP-1 deficient (mev/+ and mev/mev) and mast cell deficient (Kit(W-sh)) mice were examined in their responses to LPS airway stimulation and to ovalbumin (OVA) allergen induced systemic anaphylaxis. Compared to wild type mice, mev/+ mice had significantly enhanced LPS induced airway inflammation and OVA induced anaphylactic responses, including hypothermia and clinical symptoms. These changes were mast cell dependent as Kit(W-sh) mice had reduced responses whereas adoptive transfer of mast cells restored the responses. However, T and B cells were not involved and macrophages did not play a significant role in LPS induced airway inflammation. Interestingly, basophil differentiation from SHP-1 deficient bone marrow cells was significantly reduced. These findings provided evidence that through regulation of mast cell functions SHP-1 plays a critical role as a negative regulator in allergic inflammation and in allergen induced anaphylaxis. In addition, SHP-1 seems to be required for normal basophil development.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0055763PLOS
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3563592PMC
July 2013

Recombinant VP1 protein expressed in Pichia pastoris induces protective immune responses against EV71 in mice.

Biochem Biophys Res Commun 2013 Jan 15;430(1):387-93. Epub 2012 Nov 15.

State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, PR China.

Human enterovirus 71 (EV71) is one of the major causative agents of hand, foot and mouth disease and is also associated with serious neurological diseases in children. Currently, there are no effective antiviral drugs or vaccines against EV71 infection. VP1, one of the major immunogenic capsid proteins of EV71, is widely considered to be the candidate antigen for an EV71 vaccine. In this study, VP1 of EV71 was expressed as a secretory protein with an N-terminal histidine tag in the methylotrophic yeast Pichia pastoris, and purified by Ni-NTA affinity chromatography. Immunogenicity and vaccine efficacy of the recombinant VP1 were assessed in mouse models. The results showed that the recombinant VP1 could efficiently induce anti-VP1 antibodies in BALB/c mice, which were able to neutralize EV71 viruses in an in vitro neutralization assay. Passive protection of neonatal mice further confirmed the prophylactic efficacy of the antisera from VP1 vaccinated mice. Furthermore, VP1 vaccination induced strong lymphoproliferative and Th1 cytokine responses. Taken together, our study demonstrated that the yeast-expressed VP1 protein retained good immunogenicity and was a potent EV71 vaccine candidate.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bbrc.2012.11.035DOI Listing
January 2013