Publications by authors named "Wen Zhu"

430 Publications

Efficient recovery of rare earth elements from discarded NdFeB magnets by mechanical activation coupled with acid leaching.

Environ Sci Pollut Res Int 2021 Nov 29. Epub 2021 Nov 29.

School of Environment and Energy, South China University of Technology, Guangzhou, 510006, People's Republic of China.

Due to the increasing demands and supply shortages for rare earth elements (REEs), the recovery of REEs from discarded NdFeB with high REE content has become extremely important. In this paper, a hydrometallurgical coupling process involving mechanical activation and selective acid leaching was proposed for the recovery of REEs from discarded NdFeB magnets. The effects of ball milling activation speed, hydrochloric acid concentration, and solid-liquid ratio on the leaching efficiencies of REEs in NdFeB magnets were studied. The results indicated that the ball milling activation method could enhance the reactivity of the samples through the action of mechanical force, which promoted the leaching efficiency and leaching speed of REEs. Under the optimum conditions (650-rpm activation speed, 0.4 M hydrochloric acid, 100 g/L solid-liquid ratio), the leaching efficiency of REEs increased up to 99% with low hydrochloric acid consumption and the leaching speed of REEs was triple than that of without activation. The final purity of recovered rare earth oxides reached up to 99.9%. All results demonstrated that ball milling activation coupled with selective leaching of hydrochloric acid could be an effective and environment-friendly strategy to achieve the recovery of REEs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s11356-021-17761-3DOI Listing
November 2021

Nanoconfined and Catalyzed MgH Self-Assembled on 3D TiC MXene Folded Nanosheets with Enhanced Hydrogen Sorption Performances.

ACS Nano 2021 Oct 26. Epub 2021 Oct 26.

National Engineering Research Center of Light Alloys Net Forming & State Key Laboratory of Metal Matrix Composites, Shanghai Jiao Tong University, Shanghai, 200240, People's Republic of China.

MXenes are considered as potential support materials for nanoconfinement of MgH/Mg to improve the hydrogen storage properties. However, it has never been realized so far due to the stacking and oxidation problems caused by unexpected surface terminations (-OH, -O, .) on MXenes. In this study, hexadecyl trimethylammonium bromide was used to build a 3D TiCT architecture of folded nanosheets to reduce the stacking risk of flakes, and a bottom-up self-assembly strategy was successfully applied to synthesize ultradispersed MgH nanoparticles anchored on the surface of the annealed 3D TiCT (Ti-MX). The composite with a 60 wt % loading of MgH NPs, [email protected], starts to decompose at 140 °C and is capable of releasing 3.0 wt % H at 150 °C within 2.5 h. In addition, a reversible capacity up to 4.0 wt % H was still maintained after 60 cycles at 200 °C without obvious loss in kinetics. high-resolution TEM observations of the decomposition process together with other analyses revealed that the nanosize effect caused by the nanoconfinement and the multiphasic interfaces between MgH(Mg) and Ti-MX, especially the formed catalytic TiH, were main reasons accounting for the superior hydrogen sorption performances.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsnano.1c08343DOI Listing
October 2021

ASO Visual Abstract: Laparoscopic in Situ Anatomical Mesohepatectomy for Solitary Massive HCC Using Combined Intrafascial and Extrafascial Approaches with Indocyanine Green Navigation (with Video).

Ann Surg Oncol 2021 Oct 25. Epub 2021 Oct 25.

Department of Hepatobiliary Surgery I, General Surgery Center, Zhujiang Hospital, Southern Medical University, Guangzhou, China.

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1245/s10434-021-10968-1DOI Listing
October 2021

Bilobalide inhibits inflammation and promotes the expression of Aβ degrading enzymes in astrocytes to rescue neuronal deficiency in AD models.

Transl Psychiatry 2021 10 20;11(1):542. Epub 2021 Oct 20.

Department of Integrative Medicine, Zhongshan Hospital, Fudan University, 200032, Shanghai, China.

The pathogenesis of Alzheimer's disease (AD) involves multiple cell types including endothelial cells, glia, and neurons. It suggests that therapy against single target in single cell type may not be sufficient to treat AD and therapies with protective effects in multiple cell types may be more effective. Here, we comprehensively investigated the effects of bilobalide on neuroinflammation and Aβ degrading enzymes in AD cell model and mouse model. We find that bilobalide inhibits Aβ-induced and STAT3-dependent expression of TNF-α, IL-1β, and IL-6 in primary astrocyte culture. Bilobalide also induces robust expression of Aβ degrading enzymes like NEP, IDE, and MMP2 to facilitate astrocyte-mediated Aβ clearance. Moreover, bilobalide treatment of astrocyte rescues neuronal deficiency in co-cultured APP/PS1 neurons. Most importantly, bilobalide reduces amyloid and inflammation in AD mouse brain. Taken together, the protective effects of bilobalide in in vitro cultures were fully recapitulated in in vivo AD mouse model. Our study supports that bilobalide has therapeutic potential for AD treatment.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41398-021-01594-2DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8528910PMC
October 2021

Laparoscopic in Situ Anatomical Mesohepatectomy for Solitary Massive HCC Using Combined Intrafascial and Extrafascial Approaches With Indocyanine Green Navigation (with Video).

Ann Surg Oncol 2021 Oct 13. Epub 2021 Oct 13.

Department of Hepatobiliary Surgery I, General Surgery Center, Zhujiang Hospital, Southern Medical University, Guangzhou, China.

Background: Laparoscopic anatomic mesohepatectomy for patients with hepatocellular carcinoma (HCC) remains technically challenging, especially for those with a massive tumor larger than 10 cm.

Methods: In this study, a 65-year-old man with a 13 × 10-cm solitary liver tumor located at segments 4, 5, and 8 underwent laparoscopic mesohepatectomy. To reduce the possibility of releasing cancer cells from the primary tumor, the in situ resection strategy for tumor removal was implemented. The intrafascial approach was used to dissect the right Glissonean pedicle, to transect the right anterior hepatic artery, and to ligate the right anterior portal vein. The extrafascial and transfissural approach was performed along the umbilical fissure to transect the Glissonean pedicle of segment 4. Indocyanine green (ICG) then was applied using "reverse staining" to visualize the resection extent and the right posterior hepatic duct (RPHD). During parenchymal resection, the right anterior Glissonean pedicle was adequately exposed and transected via the extrafascial approach above the plane of the RPHD. Finally, the right coronary ligament was dissected, and the tumor was removed.

Results: The operation was completed in 360 min, with a blood loss of 200 mL. The histopathologic diagnosis indicated a moderately differentiated HCC. The patient was discharged on postoperative day 8 without any complications.

Conclusion: Laparoscopic in situ anatomic mesohepatectomy using combined intra- and extrafascial approaches with ICG navigation may be feasible for patients with a centrally located solitary massive HCC.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1245/s10434-021-10886-2DOI Listing
October 2021

Thermal evolution of NASICON type solid-state electrolytes with lithium at high temperature scanning electron microscopy.

Chem Commun (Camb) 2021 Oct 21;57(84):11076-11079. Epub 2021 Oct 21.

Hydro-Québec's Center of Excellence in Transportation Electrification and Energy Storage, Varennes, Québec J3X 1S1, Canada.

We present the thermal evolution of two NASICON-type ceramics namely LATP (LiAlTi(PO)) and LAGP (LiAlGe(PO)) by monitoring the electrode-electrolyte interfaces (, Li/LATP and Li/LAGP) at temperatures up to 330 °C scanning electron microscopy, post-mortem energy-dispersive spectroscopy, and X-ray diffraction. Upon melting of Li and contacting electrolytes, LAGP decomposes completely to form Li based alloys, while LATP is partially decomposed without alloying.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1039/d1cc04059fDOI Listing
October 2021

SnSnanosheet arrays anchoring on functionalized carbon cloth for quasi-solid-state flexible supercapacitor with satisfactory electrochemical performance and mechanical stability.

Nanotechnology 2021 Oct 18;32(50). Epub 2021 Oct 18.

School of Materials Science and Engineering, Jiangsu University, Zhenjiang 212013, Jiangsu, People's Republic of China.

Increasing requirements for wearable devices stimulate the development of flexible energy storage components. Herein, a flexible integrated electrode consisting of SnSnanosheet arraysanchored on the functionalized carbon cloth was prepared via a facile one-step hydrothermal method. Through pretreatment of carbon cloth, rough morphology is appeared on the surface of carbon fiber, which is conducive to optimizing the accessible load of SnS. The SnSnanosheet arrays and the carbon fiber as conductive skeleton cooperate with each other to provide a highly open surface, leading to the enhancement in capacitance (194.4 mF cm) and the outstanding retention after long-term service (86.5% after 10 000 cycles). A quasi-solid-state asymmetric flexible supercapacitor was assembled to evaluate the practical application under various conditions, suggesting satisfactory electrochemical performance as a maximum energy density of 10.95Wh cmat the power density of 4.75 mW cmand mechanical stability under actual conditions.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1088/1361-6528/ac2b70DOI Listing
October 2021

Author Correction: Acupuncture elicits neuroprotective effect by inhibiting NAPDH oxidase-mediated reactive oxygen species production in cerebral ischaemia.

Sci Rep 2021 Sep 27;11(1):19570. Epub 2021 Sep 27.

Acupuncture and Moxibustion Department, Beijing Hospital of Traditional Chinese Medicine Affiliated To Capital Medical University, 23 Meishuguanhou Street, Dongcheng District, Beijing, 100010, China.

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41598-021-98780-5DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8476527PMC
September 2021

Prediction of presynaptic and postsynaptic neurotoxins based on feature extraction.

Math Biosci Eng 2021 06;18(5):5943-5958

Yangtze Delta Region Institute (Quzhou), University of Electronic Science and Technology of China, Quzhou, China.

A neurotoxin is essentially a protein that mainly acts on the nervous system; it has a selective toxic effect on the central nervous system and neuromuscular nodes, can cause muscle paralysis and respiratory paralysis, and has strong lethality. According to their principle of action, neurotoxins are divided into presynaptic neurotoxins and postsynaptic neurotoxins. Correctly identifying presynaptic and postsynaptic nerve toxins provides important clues for future drug development and the discovery of drug targets. Therefore, a predictive model, Neu_LR, was constructed in this paper. The monoMonokGap method was used to extract the frequency characteristics of presynaptic and postsynaptic neurotoxin sequences and carry out feature selection, then, based on the important features obtained after dimensionality reduction, the prediction model Neu_LR was constructed using a logistic regression algorithm, and ten-fold cross-validation and independent test set validation were used. The final accuracy rates were 99.6078 and 94.1176%, respectively, which proved that the Neu_LR model had good predictive performance and robustness, and could meet the prediction requirements of presynaptic and postsynaptic neurotoxins. The data and source code of the model can be freely download from https://github.com/gyx123681/.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3934/mbe.2021297DOI Listing
June 2021

First report of late blight caused by Phytophthora infestans in potato in Tibet Autonomous Region of China.

Plant Dis 2021 Sep 13. Epub 2021 Sep 13.

Fujian Agriculture and Forestry University, Key Laboratory of Biopesticide and Chemical Biology, No. 15 shangxiadian road, cangshan district, Fuzhou, Fujian, China, 350002;

Late blight caused by Phytophthora infestans (Mont.) De Bary is the most destructive diseases in the potato field. Although it has been studied worldwide, it has not been reported in Tibet Autonomous Region of China, lying on the world's highest plateau. To investigate whether the disease caused by P. infestans occurred in such region, a survey on potato disease was conducted in the summer in 2020. In August, potato (Solanum tuberosum) of the cultivar 'Longshu 10' with diseased leaves was observed in a potato field in Shigatse city in Tibet Autonomous Region (29.3N,88.8E). The necrotic brown lesions were shaped in round or irregularly with whitish growth of sporangium-producing structures on the underleaf surface, similar to typical late blight symptom. Affected leaves were collected for pathogen isolation. The abaxial side of the decayed leaves showed grey zones of sporulation. Upon isolation, three isolates were used for further investigation. The mycelium grew averagely at a linear rate of 4.35 mm per day at 19oC on Rye B agar (RBA, containing 50 g/L rye and 12 g/L agar), forming white colony. The opaque and lemon-shaped spores with a papilla at the distal end (Figure S1) had an average size of 36.2ⅹ20.3 µm, the shape and size consistent with P. infestans (Cardenas et al. 2011; Winton et al. 2007). The ribosomal ITS1-5.8S-ITS2 region was amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4 (Glass and Donaldson 1995). The sequences with 829 bp in size obtained from three isolates were identical, among which one of the sequences from Tibet isolate RKZ_27 was submitted to GenBank with Accession No. of MW559423. A BLAST search in NCBI (National Center for Biothchnology Information) revealed MW559423 had the highest similarity (100%) to P. infestans sequences (GenBank Accession No. of MK507866, MH401206 and KU992300). In addition, a partial nucleus DNA sequence from elongation factor 1-α (EF1-α) was amplified using primer set of EF_F/ EF_R (EF_F: 5'GGCCTTGACGACATCCAGAA3'; EF_R: 5'TAGCAGCTCAACCCGAAGTG3'), and a partial mitochondria DNA sequence (P2 region) including partial ATP synthase F1 subunit α gene (atp1), tRNA-Glu gene and partial NADH dehydrogenase subunit 4 (ND4) was amplified using primer set of P2F/P2R (P2F: 5'TTCCCTTTGTCCTCTACCGAT3'; P2R: 5'TTACGGCGGTTTAGCACATACA3') (Vargas et al. 2009). The EF1-α and P2 region for three isolates were all identical and one of each sequence was submitted to GenBank with Accession No. of MZ189257 and MZ399710, respectively, which had 99.78% (XM_002998924.1) and 100% (MG869098) similarity with P. infestans, respectively. Phylogenetic analyses showed that the RKZ_27 was close to P. infestans (Figure S2). Pathogenicity was confirmed by inoculating ten potato leaves cv. 'Favorita' for each isolate with a 5 mm in diameter mycelium plug on each leaf. After 3 days of incubation at 19 oC in air-tight plastic bags, the inoculated leaves developed typical symptoms of late blight. All control leaves treated with distilled water remained healthy. The pathogenicity of three isolates were also confirmed by inoculating potato seedlings cv. 'Favorita' with sporangia suspension. The pathogen re-isolation on inoculated symptomatic leaves and seedlings were confirmed to be P. infestans by the morphological characteristics, which was fulfilled Koch postulates. The pathogenicity test both on leaves and seedlings were conducted twice. To our knowledge, this is the first report of P. infestans in potato field in Tibet Autonomous Region of China. The finding of potato late blight in this region have important epidemiological implications for the growers especially under favorable environmental conditions.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-08-21-1660-PDNDOI Listing
September 2021

Tetrahydropalmatine attenuates MSU crystal-induced gouty arthritis by inhibiting ROS-mediated NLRP3 inflammasome activation.

Int Immunopharmacol 2021 Nov 3;100:108107. Epub 2021 Sep 3.

The First College of Clinical Medicine, Nanjing University of Chinese Medicine, Nanjing 210029, PR China. Electronic address:

Activation of NACHT, LRR, and PYD domains-containing protein 3 (NLRP3) inflammasome plays a crucial role in the inflammatory responses of monosodium urate (MSU) crystal-induced gouty arthritis. Therefore, the molecular basis of NLRP3 inflammasome is very valuable in developing potential therapeutic drugs for gout. Tetrahydropalmatine (THP), the main active component of the traditional Chinese medicinal herb Corydalis yanhusuo, has shown prominent anti-inflammatory and analgesic activities, but to date, these effects have not been investigated exhaustively on gout. This study indicated that THP attenuated pain and swelling in an MSU-induced acute gout model by decreasing pro-inflammatory cytokine production and inflammatory cell infiltration. THP exerted its actions by suppressing NLRP3 inflammasome activation and subsequent formation of caspase-1. Furthermore, results showed that THP alleviated MSU-induced reactive oxygen species (ROS) generation, upstream of NLRP3 inflammasome activation, by an increase in the activities of antioxidant enzymes both in vitro and in vivo. In conclusion, our study suggests that THP suppressed ROS-mediated NLRP3 inflammasome activation in MSU-induced inflammatory responses, which highlights its therapeutic potential in gouty arthritis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.intimp.2021.108107DOI Listing
November 2021

Vitamin D and asthma occurrence in children: A systematic review and meta-analysis.

J Pediatr Nurs 2021 Aug 5. Epub 2021 Aug 5.

Department of Pediatrics, Second Hospital of Jiaxing City, Zhejiang Province, PR China. Electronic address:

Problem: The association between serum 25-Hydroxyvitamin D (25-OHD) level and asthma occurrence in children was controversial.

Eligibility Criteria: The Pubmed, Ovid Medline, Embase, Cochrane Library were systematically searched up to April 13th 2020. All the study measured the serum 25-OHD level in children, or classified the children based on the 25-OHD level into severe vitamin D deficiency, insufficient deficiency and comparing the prevalence of asthma in childhood were included in our study.

Sample: A total of 35 studies were included in our meta-analysis. Among them, 24 studies were included for analyzing the association between 25-OHD level and asthma, and 12 studies evaluated the treatment effect of vitamin D.

Results: The children with asthma (5711 participants) had significant lower 25-OHD level than children without asthma (21,561 participants) (21.7 ng/ml versus 26.5 ng/ml, SMD = -1.36, 95% = -2.40--0.32, P = 0.010). Besides, the children with asthma treated with vitamin D supplement had a significantly lower recurrence rate than the placebo group (18.4% versus 35.9%, RR = 0.35, 95%CI = 0.35-0.79, P = 0.002).

Conclusions: Children with asthma had a lower 25-OHD level than healthy children. Vitamin D supplement could decrease the asthma recurrence rate in the follow-up years.

Implications: This study implies that lower 25-OHD may cause asthma in childhood.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.pedn.2021.07.005DOI Listing
August 2021

Fine-Tuning of Alkaline Residues on the Hydrophilic Face Provides a Non-toxic Cationic α-Helical Antimicrobial Peptide Against Antibiotic-Resistant ESKAPE Pathogens.

Front Microbiol 2021 15;12:684591. Epub 2021 Jul 15.

Institute of Biomedicine and Hubei Key Laboratory of Embryonic Stem Cell Research, College of Basic Medicine, Hubei University of Medicine, Shiyan, China.

Antibiotic-resistant ESKAPE pathogens (, , , , , and ) has become a serious threat to public health worldwide. Cationic α-helical antimicrobial peptides (CαAMPs) have attracted much attention as promising solutions in post-antibiotic era. However, strong hemolytic activity and inefficacy have hindered their pharmaceutical development. Here, we attempt to address these obstacles by investigating BmKn2 and BmKn2-7, two scorpion-derived CαAMPs with the same hydrophobic face and a distinct hydrophilic face. Through structural comparison, mutant design and functional analyses, we found that while keeping the hydrophobic face unchanged, increasing the number of alkaline residues (i.e., Lys + Arg residues) on the hydrophilic face of BmKn2 reduces the hemolytic activity and broadens the antimicrobial spectrum. Strikingly, when keeping the total number of alkaline residues constant, increasing the number of Lys residues on the hydrophilic face of BmKn2-7 significantly reduces the hemolytic activity but does not influence the antimicrobial activity. BmKn2-7K, a mutant of BmKn2-7 in which all of the Arg residues on the hydrophilic face were replaced with Lys, showed the lowest hemolytic activity and potent antimicrobial activity against antibiotic-resistant ESKAPE pathogens. Moreover, experiments indicate that BmKn2-7K displays potent antimicrobial efficacy against both the penicillin-resistant and the carbapenem- and multidrug-resistant , and is non-toxic at the antimicrobial dosages. Taken together, our work highlights the significant functional disparity of Lys Arg in the scorpion-derived antimicrobial peptide BmKn2-7, and provides a promising lead molecule for drug development against ESKAPE pathogens.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fmicb.2021.684591DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8319832PMC
July 2021

Interaction effects of asthma and rhinitis control on work productivity and activity impairment: A cross-sectional study.

Allergy Asthma Proc 2021 Sep 14;42(5):409-416. Epub 2021 Jul 14.

Department of Respiratory and Critical Care Medicine, Clinical Research Center for Respiratory Disease, West China Hospital, Sichuan University, Chengdu, Sichuan, China.

Symptomatic asthma and rhinitis negatively impact patients' work productivity and activity. However, little is known about the potential interaction effect of both asthma and rhinitis control on work productivity and activity impairment. This study aimed to explore whether there are interaction effects of asthma and rhinitis control on work productivity and activity impairment in patients with asthma and with rhinitis. A total of 206 adult patients were prospectively recruited and were divided into four groups: both poorly controlled (BPC) n = 53), poorly controlled asthma (PCA) with controlled rhinitis (CR) (n = 38), well controlled asthma with uncontrolled rhinitis (n = 43), and both well controlled (BWC) (n = 72) based on the symptom control status of asthma and rhinitis. Work productivity loss and activity impairment, asthma control, and rhinitis control were assessed by using work productivity and activity impairment questionnaire: general health, the asthma control test, and the rhinitis control assessment test, respectively. General linear regression models were used to study the contribution of asthma control, rhinitis control, and the interaction effect on work productivity and activity impairment. Work productivity loss was most frequently reported in patients in the BPC group. Compared with the patients in the BWC group, the patients in the PCA-CR group had significantly higher activity impairment and worse asthma-related quality of life (both p < 0.001). There were significant interaction effects of asthma and rhinitis control, which accounted for the increase in presenteeism, work productivity loss, and activity impairment (all p < 0.001). Although differences in absenteeism were not significant among the groups, there was a significant interaction effect of control levels accounted for absenteeism (p = 0.035). Distinct interaction effects of asthma and rhinitis control reflected a link between upper and lower airways, which indicated that rhinitis control and the interaction effects of asthma and rhinitis control cannot be neglected during asthma management.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2500/aap.2021.42.210052DOI Listing
September 2021

Efficacy and Safety of Tripterygium Wilfordii Hook. F for Connective Tissue Disease-Associated Interstitial Lung Disease:A Systematic Review and Meta-Analysis.

Front Pharmacol 2021 10;12:691031. Epub 2021 Jun 10.

Affiliated Hospital of Nanjing University of Chinese Medicine, Nanjing, China.

Tripterygium wilfordii Hook. F (TwHF), a Chinese herbal medicine used to treat CTD-ILD patients in China, has been previously found to have immunoinhibitory, antifibrotic and anti inflammatory effects. It has also shown good results in treating autoimmune and inflammatory diseases. This systematic review and meta-analysis aims to evaluate the efficacy and safety of TwHF for CTD-ILD. A systematic search was performed on PubMed, Embase, Cochrane Library, Web of Science, PsycINFO, Scopus, CNKI, Wanfang, VIP, and CBM databases up to May 2021. Randomized controlled trials (RCTs) comparing TwHF plus conventional therapy versus conventional therapy alone were included. We followed the PRISMA checklist, and applied Cochrane handbook 5.1.0 and RevMan 5.3 for data analysis and quality evaluation of the included studies. Based on Cochrane handbook 5.1.0, nine RCTs consisting 650 patients met the inclusion/exclusion criteria and were selected for further analysis. The obtained data showed significant improvement in lung function with TwHF plus conventional treatment compared with conventional treatment (post-treatment FVC% (MD= 8.68, 95%Cl (5.10, 12.26), < 0.00001), FEV1% (MD = 11.24, 95%Cl (6.87, 15.61), < 0.00001), TLC% (MD = 5.28, 95%Cl (0.69, 9.87), = 0.02)], but no significant difference in the post-treatment DLCO% [(MD = 4.40, 95%Cl (-2.29, 11.09), = 0.20)]. Moreover, the data showed that TwHF combined with conventional treatment significantly reduced the HRCT integral of patients [MD = -0.65, 95% (-1.01, -0.30), 0.0003], the level of erythrocyte sedimentation rate (MD = -9.52, 95%Cl (-11.55, -7.49), < 0.00001), c-reactive protein (CRP) (MD = -8.42, 95%Cl (-12.47, -4.38), < 0.0001), and rheumatoid factor (MD = -25.48, 95%Cl (-29.36, -21.60), < 0.00001). Compared to conventional therapy, TwHF combined with conventional therapy significantly improved clinical effects (RR = 1.33, 95%Cl (1.17, 1.51), < 0.0001), in five trials with 354 patients. In terms of improvement of symptoms and signs, the TwHF group showed a more significant improvement than the conventional treatment group (Cough (MD = -0.96, 95%Cl (-1.43, -0.50), < 0.0001), velcro rales (MD = -0.32, 95%Cl (-0.44, -0.20), < 0.00001), shortness of breath (MD = -1.11, 95%Cl (-1.67, -0.56), < 0.0001)], but no statistical difference in dyspnea (MD = -0.66, 95%Cl (-1.35, 0.03), = 0.06). There was no statistical significance in the incidence of adverse reactions. The performed meta-analysis indicated that TwHF combined with conventional treatment was more beneficial to patients for improving symptoms, lung function and laboratory indicators. As it included studies with relatively small sample size, the findings require confirmation by further rigorously well-designed RCTs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fphar.2021.691031DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8222720PMC
June 2021

Knowledge of a cancer diagnosis is a protective factor for the survival of patients with breast cancer: a retrospective cohort study.

BMC Cancer 2021 Jun 27;21(1):739. Epub 2021 Jun 27.

Department of Medical Psychology, College of Psychology, Naval Medical University, 800 Xiangyin Rd, Shanghai, 200433, China.

Background: The health burden of breast cancer is rising in China. The effect of informed diagnosis on long-term survival is not fully understood. This retrospective cohort study aims to explore the association between early informed diagnosis and survival time in breast cancer patients.

Methods: A total of 12,327 breast cancer patients were enrolled between October 2002 and December 2016. Potential factors, including knowing the cancer diagnosis status, sex, age, clinical stage, surgery history, grade of reporting hospital and diagnostic year were, analyzed. We followed up all participants every 6 months until June 2017. Propensity score matching (PSM) was used to balance the clinicopathologic characteristics between patients who knew their diagnosis and those who did not.

Results: By June 2017, 18.04% of the participants died of breast cancer. Before PSM, both the 3-year and 5-year survival rates of patients who knew their cancer diagnosis were longer (P < 0.001). After PSM, the above conclusion was still established. By stratified analysis, except for the subgroups of male patients and stage III patients, patients who knew their diagnosis showed a better prognosis in all the other subgroups (P < 0.05). Cox regression analysis showed that knowing a cancer diagnosis was an independent risk factor for survival in breast cancer patients (P < 0.001).

Conclusions: Being aware of their cancer diagnosis plays a protective role in extending the survival time of breast cancer patients, which suggests that medical staff and patients' families should disclose the cancer diagnosis to patients in a timely manner. Further prospective studies need to be made to validate our findings.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12885-021-08512-1DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8237449PMC
June 2021

Effect of Emerging Major Infectious Diseases on Sleep Quality of Medical Workers: Findings from Medical Workers Providing Support During the COVID-19 Pandemic.

Med Sci Monit 2021 Jun 12;27:e931881. Epub 2021 Jun 12.

Department of Health Services Management, School of Health Services Management, Anhui Medical University, Hefei, Anhui, China (mainland).

BACKGROUND The coronavirus disease 2019 (COVID-19) outbreak has exerted immense pressure on medical systems in China and abroad. This study aimed to compare the sleep quality of medical personnel conscripted to the Wuhan Union Cancer Centre to offer support during the early stages of the COVID-19 pandemic to the sleep quality of those who remained at Anhui Medical University Hospital and to determine the role of interventions in improving sleep quality. MATERIAL AND METHODS Questionnaires were completed by 369 individuals who were conscripted to support Wuhan (N=137) and others who were not (the control group; N=232). The Pittsburgh Sleep Quality Index (PSQI) was used to measure the duration and quality of sleep. The Anhui Provincial Health Commission organized a comprehensive intervention, consisting of physical-psychological-social dimensions, over the course of 2 weeks. RESULTS Only 34.21% of the Wuhan support workers reported better sleep quality, as opposed to the 55.60% of the control group at stage 1 (t/χ²=14.005, P<.001). Furthermore, despite the Wuhan support group being more prone to poor sleep quality, their sleep quality significantly improved after the interventions. CONCLUSIONS The findings from this study showed that medical staff who were conscripted to offer support during the early stages of the COVID-19 pandemic suffered from impaired quality of sleep. The use of questionnaire-based sleep assessments may provide individualized approaches to supporting medical personnel during future epidemics and pandemics. Furthermore, our results indicate that relevant interventions can significantly improve sleep quality, while a prolonged break after interventions does not affect sleep quality.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.12659/MSM.931881DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8207954PMC
June 2021

An Smp43-Derived Short-Chain α-Helical Peptide Displays a Unique Sequence and Possesses Antimicrobial Activity against Both Gram-Positive and Gram-Negative Bacteria.

Toxins (Basel) 2021 05 11;13(5). Epub 2021 May 11.

Department of Biochemistry and Molecular Biology, Institute of Basic Medical Sciences, College of Basic Medicine, Hubei University of Medicine, Shiyan 442000, China.

Scorpion venoms are rich resources of antimicrobial peptides (AMPs). While the short-chain noncysteine-containing AMPs have attracted much attention as templates for drug development, the antimicrobial potential of long-chain noncysteine-containing AMPs has been largely overlooked. Here, by using the online HeliQuest server, we designed and analyzed a series of 14-residue fragments of Smp43, a 43-residue long-chain noncysteine-containing AMP identified from the venom of . We found that Smp43(1-14) shows high antimicrobial activity against both Gram-positive and Gram-negative bacteria and is nontoxic to mammalian cells at the antimicrobial dosage. Sequence alignments showed that the designed Smp43(1-14) displays a unique primary structure that is different from other natural short-chain noncysteine-containing AMPs from scorpions, such as Uy17, Uy192 and IsCT. Moreover, the peptide Smp43(1-14) caused concentration-dependent fluorescence increases in the bacteria for all of the tested dyes, propidium iodide, SYTOX Green and DiSC-5, suggesting that the peptide may kill the bacteria through the formation of pore structures in the plasma membrane. Taken together, our work sheds light on a new avenue for the design of novel short-chain noncysteine-containing AMPs and provides a good peptide template with a unique sequence for the development of novel drugs for use against bacterial infectious diseases.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/toxins13050343DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8150835PMC
May 2021

Pharmacophore-inspired discovery of FLT3 inhibitor from kimchi.

Food Chem 2021 Nov 18;361:130139. Epub 2021 May 18.

State Key Laboratory Cultivation Base for TCM Quality and Efficacy, Nanjing University of Chinese Medicine, Nanjing 210046, China; State Key Laboratory of Pharmaceutical Biotechnology, Institute of Functional Biomolecules, Nanjing University, Nanjing 210023, China. Electronic address:

Globally consumed kimchi is manufactured through fermenting cruciferous vegetables containing indole glucosinolates (IG). But few reports describe the IG metabolism during the fermentation. Here, we show that indole-3-carbinol (I3C), a breakdown product of IG, is transformed during the kimchi fermentation into 3,3'-diindolylmethane (DIM) and 2-(indol-3-ylmethyl)-3,3'-diindolylmethane (LTr1). LTr1 was found to kill the acute myeloid leukemia (AML) cells with FMS-like tyrosine kinase 3 (FLT3) receptor mutations, by inhibiting the FLT3 phosphorylation and the expression of downstream proteins (STAT5, ERK, and AKT). In the immune-depleted mice xenografted with human MV4-11 cells, LTr1 was demonstrated to reduce the tumor growth and synergize with sorafenib, an anti-AML agent in clinic. The work updates the chemical and biological knowledge about kimchi, and in particular establishes LTr1 as an FLT3 inhibitor that is effective and synergistic with sorafenib in treating AML.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.foodchem.2021.130139DOI Listing
November 2021

Identification of the scorpion venom-derived antimicrobial peptide Hp1404 as a new antimicrobial agent against carbapenem-resistant Acinetobacter baumannii.

Microb Pathog 2021 Aug 20;157:104960. Epub 2021 May 20.

Department of Biochemistry and Molecular Biology, Institute of Basic Medical Sciences, College of Basic Medicine, Hubei University of Medicine, Shiyan, 442000, China; Hubei Key Laboratory of Wudang Local Chinese Medicine Research, Hubei University of Medicine, Shiyan, 442000, China. Electronic address:

Carbapenem-resistant Acinetobacter baumannii (CRAB) is becoming a troublesome issue worldwide, and anti-CRAB drug research and development is urgently needed. To identify new anti-CRAB drug leads, we investigated seven scorpion venom-derived α-helical peptides that differ in their sequence composition and length. Three peptides, Hp1404, ctriporin and Im5, showed antimicrobial activities against Acinetobacter baumannii. Further antimicrobial assays revealed that Hp1404 exhibited the best cell selectivity with high anti-CRAB and low hemolytic activities. Fluorescence assays demonstrated that Hp1404 can induce dose-dependent disruptions of the bacterial cell membrane, implying a membrane-lytic mode of action. Taken together, our work sheds light on the potential of the scorpion venom-derived peptide Hp1404 for the development of novel antimicrobial agents against CRAB infections.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.micpath.2021.104960DOI Listing
August 2021

SARS-CoV-2 receptor binding domain-specific antibodies activate platelets with features resembling the pathogenic antibodies in heparin-induced thrombocytopenia.

Res Sq 2021 Apr 26. Epub 2021 Apr 26.

Severe COVID-19 is associated with unprecedented thromboembolic complications. We found that hospitalized COVID-19 patients develop immunoglobulin Gs (IgGs) that recognize a complex consisting of platelet factor 4 and heparin similar to those developed in heparin-induced thrombocytopenia and thrombosis (HIT), however, independent of heparin exposure. These antibodies activate platelets in the presence of TLR9 stimuli, stimuli that are prominent in COVID-19. Strikingly, 4 out of 42 antibodies cloned from IgG1 RBD-binding B cells could activate platelets. These antibodies possessed, in the heavy-chain complementarity-determining region 3, an RKH or Y motif that we recently described among platelet-activating antibodies cloned from HIT patients. RKH and Y motifs were prevalent among published RBD-specific antibodies, and 3 out of 6 such antibodies tested could activate platelets. Features of platelet activation by these antibodies resemble those by pathogenic HIT antibodies. B cells with an RKH or Y motif were robustly expanded in COVID-19 patients. Our study demonstrates that SARS-CoV-2 infection drives the development of a subset of RBD-specific antibodies that can activate platelets and have activation properties and structural features similar to those of the pathogenic HIT antibodies.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.21203/rs.3.rs-462080/v1DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8132233PMC
April 2021

MDMPR: Mouse Developmental and Metabolic Phenotype Repository.

Yi Chuan 2021 Apr;43(4):375-384

Cambridge-Suda Genomic Resource Center, Soochow University, Suzhou 215123, China.

Mouse Developmental and Metabolic Phenotype Repository (MDMPR) is an open access, real-time database which dedicates to share mouse resources and phenotype data. MDMPR is supported by the National Key Research and Development Project "Establishment of Mouse Developmental and Metabolic Phenotype Repository" within the Key Project of "Developmental Programming and Its Metabolic Regulation" from the Ministry of Science and Technology of the People's Republic of China's program. In the next 5 years, MDMPR will create 500 mutant mouse models related to development and metabolism, perform standard phenotyping analysis, and establish a phenotype database. MDMPR is a combination of resources and data repository, has several sub-systems, including the ES cell database, the project management system, the breeding management system, the sperm bank management system and the phenotyping database. These systems digitalize all data and ensure their authenticity in real-time. Besides the gradual increase of data during the project, MDMPR will also integrate other resources, such as human KO ES cell database, STRING database, database of Core Transcriptional Regulatory Circuitries and Enhancer-Indel database. MDMPR is anticipated to contribute to various areas of developmental and metabolic research to investigators through more convenient accesses to the resources and data in one-stop manner, thereby accelerating the research processes and ultimately serving the medical causes of human health.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.16288/j.yczz.21-005DOI Listing
April 2021

Permeant fluorescent probes visualize the activation of SARM1 and uncover an anti-neurodegenerative drug candidate.

Elife 2021 05 4;10. Epub 2021 May 4.

State Key Laboratory of Chemical Oncogenomics, Key Laboratory of Chemical Genomics, Peking University Shenzhen Graduate School, Shenzhen, China.

SARM1 regulates axonal degeneration through its NAD-metabolizing activity and is a drug target for neurodegenerative disorders. We designed and synthesized fluorescent conjugates of styryl derivative with pyridine to serve as substrates of SARM1, which exhibited large red shifts after conversion. With the conjugates, SARM1 activation was visualized in live cells following elevation of endogenous NMN or treatment with a cell-permeant NMN-analog. In neurons, imaging documented mouse SARM1 activation preceded vincristine-induced axonal degeneration by hours. Library screening identified a derivative of nisoldipine (NSDP) as a covalent inhibitor of SARM1 that reacted with the cysteines, especially Cys311 in its ARM domain and blocked its NMN-activation, protecting axons from degeneration. The Cryo-EM structure showed that SARM1 was locked into an inactive conformation by the inhibitor, uncovering a potential neuroprotective mechanism of dihydropyridines.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.7554/eLife.67381DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8143800PMC
May 2021

Prediction of Target-Drug Therapy by Identifying Gene Mutations in Lung Cancer With Histopathological Stained Image and Deep Learning Techniques.

Front Oncol 2021 13;11:642945. Epub 2021 Apr 13.

Key Laboratory of Computational Science and Application of Hainan Province, Haikou, China.

Lung cancer is a kind of cancer with high morbidity and mortality which is associated with various gene mutations. Individualized targeted-drug therapy has become the optimized treatment of lung cancer, especially benefit for patients who are not qualified for lung lobectomy. It is crucial to accurately identify mutant genes within tumor region from stained pathological slice. Therefore, we mainly focus on identifying mutant gene of lung cancer by analyzing the pathological images. In this study, we have proposed a method by identifying gene mutations in lung cancer with histopathological stained image and deep learning to predict target-drug therapy, referred to as DeepIMLH. The DeepIMLH algorithm first downloaded 180 hematoxylin-eosin staining (H&E) images of lung cancer from the Cancer Gene Atlas (TCGA). Then deep convolution Gaussian mixture model (DCGMM) was used to perform color normalization. Convolutional neural network (CNN) and residual network (Res-Net) were used to identifying mutated gene from H&E stained imaging and achieved good accuracy. It demonstrated that our method can be used to choose targeted-drug therapy which might be applied to clinical practice. More studies should be conducted though.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fonc.2021.642945DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8076857PMC
April 2021

A Sensitive LC-MS/MS Method for the Determination of Afatinib in Human Plasma and Its Application to a Bioequivalence Study.

J Chromatogr Sci 2021 Apr 29. Epub 2021 Apr 29.

BE/Phase I clinical center, The first affiliated hospital of Xiamen university, Xiamen, Fujian 361000, China.

A high performance liquid chromatography-tandem mass spectrometry assay for the determination of afatinib (AFT) in human plasma was established. A simple sample preparation of protein precipitation was used and separation was achieved on a C18 column by the gradient mixture of mobile Phase A of water (containing 0.1% ammonia) and the mobile Phase B of acetonitrile and water (V:V = 95:5, containing 0.2% ammonia). The multiple reaction monitoring mode was used to monitor the precursor-to-production transitions of m/z 486.2 → m/z 371.4 for AFT and m/z 492.2 → m/z 371.3 for AFT-d6 (internal standard) at positive ionization mode. The calibration curve ranged from 0.100 to 25.0 ng·mL-1 and the correlation coefficient was greater than 0.99. The intra- and inter-batch precision was less than or equal to 10.0%. Accuracy determined at four concentrations was in the range of 92.3-103.3%. In summary, our method was sensitive, simple and reliable for the quantification of AFT and was successfully applied to a bioequivalence study.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/chromsci/bmab040DOI Listing
April 2021

[Intraocular pressure with miniscleral contact lenses].

Vestn Oftalmol 2021 ;137(2):52-58

City Multidisciplinary Hospital No. 2, St. Petersburg, Russia.

According to literature data, some experts do not exclude the possibility that scleral lens wear could influence intraocular pressure.

Purpose: To evaluate the influence of rigid gas permeable miniscleral contact lenses on intraocular pressure (IOP), keratometry readings and corneal thickness, and to study the correlation between scleral (IOPs) and corneal (IOPc) intraocular pressure using the Icare ic100 tonometer (model TAO11, Icare Finland Oy).

Material And Methods: The study included 99 volunteers without history of ocular diseases. The first group consisted of 66 participants (122 eyes) aged 22.3±2.2 years - IOPc and IOPs were measured by the Icare ic100 tonometer in order to determine the correlation. The second group (33 participants, aged 22.7±1.7 years) - day 1, diurnal IOPc and IOPs fluctuations were measured; on day 2, a miniscleral lens (diameter 14.9 mm) was placed on the study eye and was worn for 6 hours, the paired eye served as control. IOP was measured before, after lens placement, after 2 hours of lens wear, and before and after lens removal. Corneal topography was evaluated before and after lens removal.

Results: In the first group, there was a weak but significant correlation between IOPc and IOPs (Spearman correlation coefficient 0.285, =0.001). In the second group, IOPc in the study eye before lens placement (14.8±3.8 mm Hg) and IOPc after its removal (13.6±3.9 mm Hg) were not different from those in the control eye. There were also no statistically significant changes in IOPs before, during lens wear, and after lens removal. The central corneal thickness increased by 2.9% (<0.001) after 6 hours of lens wear.

Conclusion: In young individuals without history of ocular diseases, wearing the miniscleral lens for 6 hours does not have significant influence on IOP and does not cause clinically significant corneal edema.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.17116/oftalma202113702152DOI Listing
April 2021

Augmented Reality Navigation for Stereoscopic Laparoscopic Anatomical Hepatectomy of Primary Liver Cancer: Preliminary Experience.

Front Oncol 2021 25;11:663236. Epub 2021 Mar 25.

Department of Hepatobiliary Surgery, Zhujiang Hospital, Southern Medical University, Guangzhou, China.

Background: Accurate determination of intrahepatic anatomy remains challenging for laparoscopic anatomical hepatectomy (LAH). Laparoscopic augmented reality navigation (LARN) is expected to facilitate LAH of primary liver cancer (PLC) by identifying the exact location of tumors and vessels. The study was to evaluate the safety and effectiveness of our independently developed LARN system in LAH of PLC.

Methods: From May 2018 to July 2020, the study included 85 PLC patients who underwent three-dimensional (3D) LAH. According to whether LARN was performed during the operation, the patients were divided into the intraoperative navigation (IN) group and the non-intraoperative navigation (NIN) group. We compared the preoperative data, perioperative results and postoperative complications between the two groups, and introduced our preliminary experience of this novel technology in LAH.

Results: There were 44 and 41 PLC patients in the IN group and the NIN group, respectively. No significant differences were found in preoperative characteristics and any of the resection-related complications between the two groups (All > 0.05). Compared with the NIN group, the IN group had significantly less operative bleeding ( = 0.002), lower delta Hb% ( = 0.039), lower blood transfusion rate ( < 0.001), and reduced postoperative hospital stay ( = 0.003). For the IN group, the successful fusion of simulated surgical planning and operative scene helped to determine the extent of resection.

Conclusions: The LARN contributed to the identification of important anatomical structures during LAH of PLC. It reduced vascular injury and accelerated postoperative recovery, showing a potential application prospects in liver surgery.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fonc.2021.663236DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8027474PMC
March 2021

Two new cationic α-helical peptides identified from the venom gland of Liocheles australasiae possess antimicrobial activity against methicillin-resistant staphylococci.

Toxicon 2021 Jun 6;196:63-73. Epub 2021 Apr 6.

Department of Biochemistry and Molecular Biology, Institute of Basic Medical Sciences, College of Basic Medicine, Hubei University of Medicine, Shiyan, 442000, China; Hubei Key Laboratory of Wudang Local Chinese Medicine Research, Hubei University of Medicine, Shiyan, 442000, China. Electronic address:

Methicillin-resistant staphylococci have become growing threats to human health, and novel antimicrobials are urgently needed. Natural antimicrobial peptides (AMPs) are promising alternatives to traditional antibiotics. Here, two novel cationic α-helical antimicrobial peptides, Lausporin-1 and Lausporin-2, were identified from the venom gland of the scorpion L. australasiae through a cDNA library screening strategy. Biochemical analyses demonstrated that Lausporin-1 and Lausporin-2 are cationic α-helical amphipathic molecules. Antimicrobial assays demonstrated that the two peptides possess antibacterial activities against several species of antibiotic-resistant staphylococci. Importantly, they are active against methicillin-resistant Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus capitis, with the minimum inhibitory concentrations ranging from 2.5 to 10 μg/ml. Moreover, both peptides can induce dose-dependent plasma membrane disruptions of the bacteria. In short, our work expands the knowledge of the scorpion L. australasiae venom-derived AMPs and sheds light on the potential of Lausporin-1 and Lausporin-2 in the development of novel drugs against methicillin-resistant staphylococci.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.toxicon.2021.04.002DOI Listing
June 2021

Importance of Microvascular Invasion Risk and Tumor Size on Recurrence and Survival of Hepatocellular Carcinoma After Anatomical Resection and Non-anatomical Resection.

Front Oncol 2021 17;11:621622. Epub 2021 Mar 17.

Department of Hepatobiliary Surgery, Zhujiang Hospital, Southern Medical University, Guangzhou, China.

To establish a valid prediction model to prognose the occurrence of microvascular invasion (MVI), and to compare the efficacy of anatomic resection (AR) or non-anatomic resection (NAR) for hepatocellular carcinoma (HCC). Two hundred twenty-eight patients with HCC who underwent surgical treatment were enrolled. Their hematological indicators, MRI imaging features, and outcome data were acquired. In the multivariable analysis, alpha-fetoprotein >15 ng/mL, neutrophil to lymphocyte ratio >3.8, corona enhancement, and peritumoral hypointensity on hepatobiliary phase were associated with MVI. According on these factors, the AUROC of the predictive model in the primary and validation cohorts was 0.884 (95% CI: 0.829, 0.938) and 0.899 (95% CI: 0.821, 0.967), respectively. Patients with high risk of MVI or those with low risk of MVI but tumor size >5 cm in the AR group were associated with a lower rate of recurrence and death than patients in the NAR group; however, when patients are in the state of low-risk MVI with tumor size >5 cm, there is no difference in the rate of recurrence and death between AR and NAR. Our predictive model for HCC with MVI is convenient and accurate. Patients with high-risk of MVI or low-risk of MVI but tumor size >5 cm executing AR is of great necessity.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fonc.2021.621622DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8010691PMC
March 2021
-->