Publications by authors named "Shi Yan"

1,858 Publications

  • Page 1 of 1

Analysis and Prediction of Subway Tunnel Surface Subsidence Based on Internet of Things Monitoring and BP Neural Network.

Comput Intell Neurosci 2022 14;2022:9447897. Epub 2022 May 14.

School of Civil Engineering, Southeast University, Nanjing 211189, China.

With the acceleration of the urban development process and the rapid growth of China's population, the subway has become the first choice for people to travel, and the urban underground space has been continuously improved. The subway construction has become the focus of urban underground space development in the 21st century. During the construction of subway tunnels, the problem of surface settlement will inevitably be caused, and the problem of surface settlement will have a certain safety impact on the safe use of surface buildings. The impact of surface construction is predicted, so as to select the best construction technology and avoid the problem of surface subsidence to the greatest extent. On the basis of analyzing the principle of surface subsidence, this paper studies the optimal control strategy and process of subsidence in subway tunnel engineering. The research results of the article show the following. (1) The two sections of the pebble soil layer have basically the same subsidence trend. Among them, the first section has a larger settlement amplitude and both sides are steeper. The second section is mainly cobble clay soil. The pebble layer has good mechanical properties. If it can be well filled, its stability will be improved. The comparative analysis of the two sections shows that with the increase of the soil cover thickness, the maximum subsidence at the surface gradually decreases. The reason is that when the stratum loss is the same, the greater the soil cover thickness, the greater the settlement width. Sections 2 and 3 of a single silty clay have relatively close settlement laws, and the settlement changes on both sides of the tunnel are similar. (2) The surface subsidence caused by the excavation of the side hole accounts for more than 50% of the total surface subsidence, and the width of the settlement tank after the excavation of the side hole is increased by 8-10 meters compared with the excavation of the middle hole. (3) The prediction error of the BP neural network model proposed in this paper is the lowest among the four models, whether it is the prediction of the cumulative maximum surface subsidence or the location of the cumulative maximum surface subsidence, and the average relative error of the cumulative maximum surface subsidence is 3.27%, the root mean square error is 3.87, the average relative error of the location of the cumulative maximum surface subsidence is 7.96%, and the root mean square error is 21.06. In the prediction process of the cumulative maximum surface subsidence, the prediction error value of the Elman neural network is relatively large, and the GRNN generalized neural network and RBF neural network have no significant changes; in the process of predicting the position where the cumulative maximum surface subsidence occurs, the prediction error value of RBF neural network is maximum.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2022/9447897DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9124096PMC
May 2022

NiFe nanosheets as urea oxidation reaction electrocatalysts for urea removal and energy-saving hydrogen production.

Biosens Bioelectron 2022 May 17;211:114380. Epub 2022 May 17.

State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun, Jilin, 130022, China; University of Science and Technology of China, Hefei, Anhui, 230026, China. Electronic address:

The preparation of high-performance electrocatalysts is a breakthrough to solve the increasingly prominent problems of environmental degradation and energy depletion. Urea oxidation reaction (UOR) plays a vital role in treating urea-rich wastewater and assisting hydrogen production with low energy consumption. To alleviate the sluggish intrinsic reaction kinetic barrier of six-electron transfer involved in UOR, we develop a NiFe ultra-thin two-dimensional nanosheet array supported on nickel foam as UOR electrocatalyst by one-step hydrothermal method. Benefiting from the in-situ synthesis strategy, abundant mesoporous structure, and the electronic structure change of Ni after the introduction of Fe, NiFe nanosheets (NiFe NSs) exhibit remarkable UOR catalytic activity and excellent long-term stability. Moreover, we assemble a two-electrode electrolytic cell with NiFe NSs/NF as the anode. The results show that the cell voltage of urea assisted water electrolysis for hydrogen production decreased by 15.2% rather than the regular water splitting, as well as that the urea concentration in electrolyte is degraded 55.6% after electrolysis for 36 h at 1.70 V. This work indicates a feasibility verification for the electrocatalytic removal of urea in wastewater treatment, and an efficient and energy-saving method for urea-assisted electrolytic hydrogen production based on NiFe nanosheets.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bios.2022.114380DOI Listing
May 2022

Photoprotective effects of Sargassum thunbergii on ultraviolet B-induced mouse L929 fibroblasts and zebrafish.

BMC Complement Med Ther 2022 May 21;22(1):144. Epub 2022 May 21.

School of Life Sciences, Xiamen University, South Xiangan Road, Xiang'an District, Xiamen, 361102, Fujian, China.

Background: Chronic exposure to ultraviolet B (UVB) causes a series of adverse skin reactions, such as erythema, sunburn, photoaging, and cancer, by altering signaling pathways related to inflammation, oxidative stress, and DNA damage. Marine algae have abundant amounts and varieties of bioactive compounds that possess antioxidant and anti-inflammatory properties. Thus, the objective of this study was to investigate the photoprotective effects of an ethanol extract of Sargassum thunbergii.

Methods: Sargassum thunbergii phenolic-rich extract (STPE) was prepared, and its activity against UVB damage was evaluated using L929 fibroblast cells and zebrafish. STPE was extracted and purified by 40% ethanol and macroporous resin XDA-7. Reactive oxygen species (ROS) and antioxidant markers, such as superoxide dismutase (SOD), catalase (CAT) activities, and malondialdehyde (MDA) content were analyzed. The effect of STPE on UVB-induced inflammation was determined by inflammatory cytokine gene and protein expression. The expression of signaling molecules in the Nuclear Factor KappaB (NF-κB) pathway was determined by western blotting. DNA condensation was analyzed and visualized by Hoechst 33342 staining. In vivo evaluation was performed by tail fin area and ROS measurement using the zebrafish model.

Results: The total polyphenol content of STPE was 72%. STPE reduced ROS content in L929 cells, improved SOD and CAT activities, and significantly reduced MDA content, thereby effectively alleviating UVB radiation-induced oxidative damage. STPE inhibited the mRNA and protein expression of TNF-α, IL-6, and IL-1α. STPE reversed DNA condensation at concentrations of 20 and 40 μg/mL compared with the UVB control. Moreover, STPE inhibited NF-κB signaling pathway activation and alleviated DNA agglutination in L929 cells after UVB irradiation. Additionally, 1.67 μg/mL STPE significantly increased the tail fin area in zebrafish, and 0.8-1.6 μg/mL STPE effectively eliminated excessive ROS after UVB radiation.

Conclusions: STPE inhibited UVB-induced oxidative stress, inflammatory cytokine expression, and DNA condensation via the downregulation of the NF-κB signaling pathway, suggesting that it prevents UVB-induced photodamage, and has potential for clinical development for skin disease treatment.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12906-022-03609-xDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9123674PMC
May 2022

Pre-diagnostic dietary consumption of calcium and magnesium and calcium-to-magnesium intake ratio and ovarian cancer mortality: results from the ovarian cancer follow-up study (OOPS).

Eur J Nutr 2022 May 21. Epub 2022 May 21.

Department of Obstetrics and Gynecology, Shengjing Hospital of China Medical University, No. 36, San Hao Street, Shenyang, Liaoning, 110004, People's Republic of China.

Purpose: Previous studies have indicated that dietary consumption of calcium (Ca), magnesium (Mg), and the Ca-to-Mg (Ca:Mg) ratio were associated with different health outcomes. However, no study has evaluated the association of pre-diagnostic Ca, Mg, and Ca:Mg ratio consumption with ovarian cancer (OC) survival.

Methods: The aforementioned associations were investigated in a cohort of 853 Chinese women diagnosed with OC between 2015 and 2020. A validated food frequency questionnaire was used to evaluate pre-diagnostic diet information. Deaths were recorded until March 31, 2021 via medical records and active follow-up. Cox proportional hazards model was applied to calculate the adjusted hazard ratios (HRs) and 95% confidence intervals (CIs).

Results: A total of 130 deaths were observed during a median follow-up of 37.2 months. After adjustment for potential confounders, pre-diagnostic Ca (HR = 1.45, 95% CI = 0.47-4.46, p for trend = 0.69) and Mg (HR = 0.90, 95% CI = 0.39-2.08, p for trend = 0.77) intakes were found to be unrelated to OC survival, whereas a higher Ca:Mg intake ratio was significantly associated with worse survival (HR = 2.72, 95% CI = 1.28-5.78, p for trend < 0.05). A significant result was also observed when treating the Ca:Mg ratio as a continuous variable (HR = 1.69, 95% CI = 1.12-2.55) for one-unit increment.

Conclusion: Pre-diagnostic consumption of Ca and Mg was unrelated to OC survival, while a higher Ca:Mg intake ratio was strongly associated with worse survival among OC patients.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00394-022-02883-2DOI Listing
May 2022

Mechanism of INSR clustering with insulin activation and resistance revealed by super-resolution imaging.

Nanoscale 2022 May 26;14(20):7747-7755. Epub 2022 May 26.

State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun, Jilin, 130022, P. R. China.

Insulin receptor (INSR) is a key protein in the INSR signaling pathway and plays a critical role in biological processes, especially in the regulation of glucose homeostasis. Many metabolic diseases are often accompanied by abnormal INSR signaling. However, the specific effector mechanisms regulating insulin resistance and the distribution patterns of INSR during cell membrane activation remain unclear. Here, we investigated the changes in the distribution of INSR during activation using super-resolution imaging. By observing the connection between INSR activation and its distribution, we found that insulin resistance inhibits its receptor clustering. More importantly, we found that INSR has a highly co-localized relationship with the skeletal protein βII-spectrin. Specific knockout of βII-spectrin inhibited the interaction of INSR with GLUT4 and affected the normal metabolism of glucose. Our work elucidates the effects of insulin activation and insulin resistance on INSR distribution and reveals a potential relationship between INSR and cytoskeleton at the single molecule level, which promotes a deeper understanding of the roles associated with insulin signaling and insulin resistance.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1039/d2nr01051hDOI Listing
May 2022

The lysine deacetylase activity of HDAC1/2 is required to safeguard zygotic genome activation in mice and cattle.

Development 2022 May 16. Epub 2022 May 16.

Laboratory of Mammalian Molecular Embryology, College of Animal Sciences, and Assisted Reproduction Unit, Department of Obstetrics and Gynecology, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang 310058, China.

The genome is transcriptionally inert at fertilization and must be activated through a remarkable developmental process called zygotic genome activation (ZGA). Epigenetic reprogramming contributes significantly to the dynamic gene expression during ZGA, however the mechanism has yet to be resolved. Here, we find histone deacetylase 1 and 2 (HDAC1/2) can regulate ZGA through the lysine deacetylase activity. Notably, in mouse embryos, overexpression of HDAC1/2 dominant negative mutant leads to a developmental arrest at 2-cell stage. RNA-seq reveals that 64% of down-regulated genes are ZGA genes and 49% of up-regulated genes are developmental genes. Inhibition of the deacetylase activity of HDAC1/2 causes a failure of histone deacetylation at multiple sites including H4K5, H4K16, H3K14, H3K18, and H3K27. ChIP-seq analysis exhibits an increase and decrease of H3K27ac enrichment at promoters of up- and down-regulated genes, respectively. Moreover, HDAC1 mutants prohibited the removal of H3K4me3 via impeding KDM5s. Importantly, the developmental block can be greatly rescued through Kdm5b injection and expression of the majority of dysregulated genes partially corrected. Similar functional significance of HDAC1/2 is conserved in cattle embryos. Overall, we propose that HDAC1/2 is indispensable for ZGA via creating correct transcriptional repressive and active states in mouse and bovine embryos.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1242/dev.200854DOI Listing
May 2022

Intraoperative salvaging of failure to harvest the bi-paddle anterolateral thigh flap: a case series.

Ann Transl Med 2022 Apr;10(8):451

Department of Orthopedics, The 920th Hospital of Joint Logistics Support Force of Chinese PLA, Kunming, China.

Background: The size and versatility of anterolateral thigh (ALT) flap enables a bi-paddle flap to cover complex and extensive defects optimally. However, it is characterized by variations in the sources of blood vessels and in the number of perforators, which increases the chances of failure of harvesting a bi-paddle flap. We present our method to overcome such failure. This is the first study exploring the optimal salvaging algorithm to overcome harvesting failure with the bi-paddle ALT flap.

Methods: From January 2014 to December 2020, in 9 patients to be treated with bi-paddle ALT flap for soft-tissue defects (range, 48-288 cm), there was failure of flap harvest because of perforator variations. We redesigned and converted the flaps to other forms for harvest intraoperatively, based on the characteristics of the defect, and the number and sources of perforators.

Results: Salvage of flap harvest was successfully performed in all 9 cases. In 4 cases the flap with a single perforator was converted to widened-single-perforator flaps; in 2 cases, a single perforator was converted to a de-epithelialized flap; in 2 cases of 2 perforators from different main branches, conversion was to sequential chimeric flaps; in the remaining case of 2 perforators from the descending branch and transverse branch, conversion was to a combined transverse-and-descending branches flap. Venous compromise occurred in only 1 case, and the patient survived after revised surgery. Local infection in the receiving area occurred in 3 cases, and was cured by wound dressing. All flaps survived (follow-up 5-24 months).

Conclusions: Despite preoperative preparation, anatomic variations resulted in failure of bi-paddle ALT flap harvesting. As shown by our results, it is feasible to redesign and convert the bi-paddle flap to other forms based on the defect characteristics, and the number and sources of perforators.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.21037/atm-22-1118DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9096413PMC
April 2022

Long-Term Cardiac Disease- and Cancer-Associated Mortalities in Patients With Non-Metastatic Stomach Adenocarcinoma Receiving Resection and Chemotherapy: A Large Competing-Risk Population-Based Cohort Study.

World J Oncol 2022 Apr 12;13(2):69-83. Epub 2022 Apr 12.

Department of Oncology, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, China.

Background: The survival of patients with non-metastatic gastric adenocarcinoma (nmGaC), who are receiving more and more frequently chemotherapy, has improved throughout the last decades, while treatment-caused cardiotoxicity remains a major concern. This study aimed to investigate competing causes of mortality and prognostic factors within a large cohort of patients with resected nmGaC, and to describe the heart-specific mortalities of patients undergoing resection and chemotherapy and of all resected patients.

Methods: In this population-based cohort study, data on patients diagnosed with nmGaC from 2004 through 2016, managed with resection with or without chemotherapy, followed up until the end of 2016, and surviving ≥ 1 month were retrieved from the US Surveillance, Epidemiology, and End Results-18 Program. Cumulative mortality functions were calculated. Prognostic factors for heart- and cancer-specific mortalities were evaluated using both multivariable-adjusted Fine-Gray subdistribution and cause-specific hazard functions.

Results: Together 21,257 patients with resected nmGaC were eligible for analysis with an accumulated follow-up of 73,711 person-years, where 10,718 (50%) also underwent chemotherapy. Mortalities were overestimated when using the Kaplan-Meier method. Heart diseases were the most common non-cancer cause of mortality. Compared with all resected patients, heart-specific mortality of those also receiving chemotherapy was lower overall and especially at older ages. In the total group of patients, the 8-year cumulative mortalities from heart diseases were 4.4% and 2.0% in resected patients and those also receiving chemotherapy, respectively; in patients ≥ 80 years, the heart disease-specific mortalities were as high as 11.1% and 6.5%, respectively. In overall patients undergoing resection, older ages, black ethnicity, and location at gastric antrum/pylorus were associated with increased heart-specific mortality, while more recent period, female sex, Asian/Pacific Islanders, invasion of serosa, and more positive lymph nodes were associated with lower heart-specific mortality; among those further receiving chemotherapy, only the associations with period of diagnosis, age, and ethnicity were significant. Associations with older ages were stronger for heart-specific mortality than for cancer-associated mortality.

Conclusions: Among survivors with resected nmGaC receiving chemotherapy, heart-specific mortality, the most common one among non-cancer causes of mortality, is not higher compared to overall resected patients in this observational study, suggesting that chemotherapy may be relatively safely administered to selected patients under strict indications. Age and ethnicity were major factors associated with heart-specific mortality in both overall resected patients and those further receiving chemotherapy. Overall and stratified cause-specific cumulative incidences of mortality are provided, which can be more clinically useful than the Kaplan-Meier estimates. Our study provides clinically useful evidence for tailored patient management.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.14740/wjon1445DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9076150PMC
April 2022

TRIM44 promotes BRCA1 functions in HR repair to induce Cisplatin Chemoresistance in Lung Adenocarcinoma by Deubiquitinating FLNA.

Int J Biol Sci 2022 18;18(7):2962-2979. Epub 2022 Apr 18.

The First Department of Orthopedic Surgery, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, China.

Tripartite motif-containing 44 (TRIM44) has recently been implicated in various pathological processes in numerous cancers, including lung adenocarcinoma (LUAD); however, its functional roles in chemoresistance are poorly understood. Herein, TRIM44 knockdown sensitized LUAD cells to cisplatin and enhanced cisplatin-induced apoptosis. Microarray analysis indicated that the "" and the gene expression were positively regulated by TRIM44, which was further verified by immunofluorescence, qRT-PCR, and Western blotting. BRCA1 depletion effectively abolished TRIM44-modulated cisplatin resistance and regulation of homologous recombination (HR) repair. Interestingly, TRIM44 interacted with FLNA, an upstream regulator of BRCA1 as specified by V 11.5, and facilitated its stability and deubiquitination. FLNA was also found to be required for the functions of TRIM44 in drug resistance. Using animal models, overexpression of TRIM44 was shown to confer resistance to cisplatin in a BRCA1- and FLNA-dependent manner. TRIM44 expression levels in tissues from cisplatin-resistant LUAD patients were significantly higher than those in tissues from cisplatin-sensitive LUAD patients. Collectively, our study results demonstrate that the TRIM44/FLNA/BRCA1 axis is involved in cisplatin chemoresistance, providing potential therapeutic targets for LUAD patients with cisplatin resistance.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.7150/ijbs.71283DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9066100PMC
May 2022

Identification of Prognostic Biomarkers for Glioblastoma Based on Transcriptome and Proteome Association Analysis.

Technol Cancer Res Treat 2022 Jan-Dec;21:15330338211035270

Department of Neurosurgery, The First Affiliated Hospital of Harbin Medical University, Nangang, Harbin, Heilongjiang Province, China.

Objective: Glioblastoma multiforme (GBM) is the most malignant primary brain tumor in adults. This study aimed to identify significant prognostic biomarkers related to GBM.

Methods: We collected 3 GBM and 3 healthy human brain samples for transcriptome and proteomic sequencing analysis. Differentially expressed genes (DEGs) between GBM and control samples were identified using the edge R package in R. Functional enrichment analyses, prediction of long noncoding RNA target genes, and protein-protein interaction network analyses were performed. Subsequently, transcriptomic and proteomic association analyses, validation using The Cancer Genome Atlas (TCGA) database, and survival and prognostic analyses were conducted. Then the hub genes directly related to GBM were screened. Finally, the expression of key genes was verified by quantitative polymerase chain reaction (qPCR).

Results: Totally, 1140 transcripts and 503 proteins were significantly up- or down-regulated. A total of 25 genes were upregulated and 62 were downregulated at both the transcriptome and proteome levels. Results from TCGA database showed that 84 of these 87 genes matched with transcriptome sequencing results. A Cox regression analysis suggested that Fibronectin 1() was a prognostic risk factor. The qPCR results showed that was significantly upregulated in GBM samples.

Conclusions: may play a role in GBM progression through ECM-receptor interaction and PI3K-Akt signaling pathways. may be considered as a prognostic biomarkers related to GBM.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1177/15330338211035270DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9102128PMC
May 2022

Hybrid Machine Learning Approach for Evapotranspiration Estimation of Fruit Tree in Agricultural Cyber-Physical Systems.

IEEE Trans Cybern 2022 May 4;PP. Epub 2022 May 4.

The flourish of the Internet of Things (IoT) and data-driven techniques provide new ideas for enhancing agricultural production, where evapotranspiration estimation is a crucial issue in crop irrigation systems. However, tremendous and unsynchronized data from agricultural cyber-physical systems bring large computational costs as well as complicate performing conventional machine learning methods. To precisely estimate evapotranspiration with acceptable computational costs under the background of IoT, we combine time granulation computing techniques and gradient boosting decision tree (GBDT) with Bayesian optimization (BO) to propose a hybrid machine learning approach. In the combination, a fuzzy granulation method and a time calibration technique are introduced to break voluminous and unsynchronized data into small-scale and synchronized granules with high representativeness. Subsequently, GBDT is implemented to predict evapotranspiration, and BO is utilized to find the optimal hyperparameter values from the reduced granules. IoT data from Xi'an Fruit Technology Promotion Center in Shaanxi Province, China, verify that the proposed granular-GBDT-BO is effective for cherry tree evapotranspiration estimation with reduced computational time, and acceptable and robust predictive accuracy. Consequently, the precise estimation of crop evapotranspiration could provide operational guidance for plant irrigation, plant conservations, and pest control in the agricultural greenhouse.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1109/TCYB.2022.3164542DOI Listing
May 2022

Weill-Marchesani syndrome 4 caused by compound heterozygosity of a maternal submicroscopic deletion and a paternal nonsense variant in the gene: A case report.

Am J Ophthalmol Case Rep 2022 Jun 14;26:101541. Epub 2022 Apr 14.

Beijing Institute of Ophthalmology, Beijing Tongren Eye Center, Beijing Tongren Hospital, Capital Medical University, Beijing Ophthalmology & Visual Sciences Key Laboratory, Beijing, 100730, China.

Purpose: To retrospectively report a case of Weill-Marchesani syndrome 4 (WMS4) with compound heterozygous variants of gene.

Observations: The patient was a 7-year-old boy with progressively worsening eyesight and intermittent elevated intraocular pressure (IOP) for two years. His IOPs were temporarily controlled using anti-glaucoma drugs. At presentation he had a shallow anterior chamber, lens subluxation, spherophakia and extensive synechial angle closure with high myopia in both eyes. Ultrasound biomicroscopy (UBM) identified thickened zonule fibers and anteriorly rotated, flat and slender ciliary processes, both of which worsened and were accompanied by obvious iris bombe after miosis. Gene testing showed compound heterozygosity of a maternal submicroscopic deletion on chromosome 15q26.3 (0.774 Mb) affecting the sequences of , and as well as a paternal nonsense variant (c.1051_1053delAAGinsTAA, P.K351X) in the gene in the proband. The diagnosis of WMS4 was confirmed by genetic testing. Phacoemulsification (Phaco), intraocular lens (IOL) implantation, and irido-zonulo-hyaloid-vitrectomy (IZHV) combined with Ahmed Glaucoma Valve (AGV) implantation as a staged or one-stage surgery effectively lowered IOP, deepened ACD, improved visual acuity, and resolved the configuration of the ciliary processes in both eyes.

Conclusion And Importance: Recessive variants are associated with WMS4. We report here compound heterozygous variants in causing WMS4, and anatomically highlighted the possible pathophysiology for its clinical phenotype. A modified surgical approach with Phaco, IOL implantation, and IZHV combined with AGV implantation could be used to treat these complicated cases.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ajoc.2022.101541DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9046107PMC
June 2022

Pre-diagnosis Dietary One-Carbon Metabolism Micronutrients Consumption and Ovarian Cancer Survival: A Prospective Cohort Study.

Front Nutr 2022 15;9:873249. Epub 2022 Apr 15.

Department of Clinical Epidemiology, Shengjing Hospital of China Medical University, Shenyang, China.

Background And Aims: Epidemiological evidence on the relation between one-carbon metabolism (OCM) micronutrients intake and ovarian cancer (OC) survival are limited and conflicting. We evaluated the aforementioned associations in a prospective cohort-the Ovarian Cancer Follow-Up Study.

Methods: A total of 635 newly diagnosed OC patients aged 18-79 y were enrolled in the present study. Dietary intake related to one-carbon metabolism, including methionine, vitamins B2, B3, B6, B9, B12, choline, and betaine, was assessed using a validated 111-item food frequency questionnaire. Deaths were ascertained until March 31, 2021, medical records and active follow-up. Cox proportional hazards regression model was used to evaluate the hazard ratios (HRs) and 95% confidence intervals (CIs) for these aforementioned associations.

Results: During a median follow-up of 37.2 months (interquartile: 24.7-50.2 months), 114 deaths were identified. We observed an improved survival with the highest compared with the lowest tertile of dietary vitamin B6 (HR = 0.52, 95%CI: 0.32-0.84, P-trend <0.05) and choline intake (HR = 0.50, 95%CI: 0.30-0.83, P-trend <0.05). No significant associations with OC survival were observed for dietary vitamins B2, B3, B9, B12, methionine, and betaine intake. We also observed a curvilinear association between vitamin B6 intake and OC survival (P non-linear <0.05).

Conclusion: Our study suggests that pre-diagnosis higher intake of vitamin B6 and choline may improve OC survival. Further clarification of these associations is warranted.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fnut.2022.873249DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9053828PMC
April 2022

Construction of a Necroptosis-Related miRNA Signature for Predicting the Prognosis of Patients With Hepatocellular Carcinoma.

Front Genet 2022 12;13:825261. Epub 2022 Apr 12.

Liaoning University of Traditional Chinese Medicine, Shenyang, China.

Many miRNAs have been demonstrated to be associated with the prognosis of hepatocellular carcinoma (HCC). However, how to combine necroptosis-related miRNAs to achieve the best predictive effect in estimating HCC patient survival has not been explored. The mRNA and miRNA expression profile were downloaded from a public database (TCGA-LIHC cohort). Necroptosis-related genes were obtained from previous references, and necroptosis-related miRNAs were identified using Pearson analysis. Subsequently, differential expression miRNAs (DEms) were identified in HCC and paracancer normal samples based on necroptosis-related miRNA expression. The whole set with HCC was randomized into a training set and testing set (1:1). LASSO-Cox regression analysis was used to construct an miRNA signature. Multiple statistical methods were used to validate the clinical benefit of signature in HCC patients, including receiver operator characteristic (ROC) curves, Kaplan-Meier survival analyses, and decision curve analysis (DCA). The downstream target genes of miRNAs were obtained from different online tools, and the potential pathways involved in miRNAs were explored. Finally, we conducted RT-qPCR in SK-HEP-1, THLE-3, and HUH-7 cell lines for miRNAs involved in the signature. The results showed that a total of eight specific necroptosis-related miRNAs were screened between HCC and adjacent tissues in the training set. Subsequently, based on the aforementioned miRNAs, 5-miRNA signature (miR-139-5p, hsa-miR-326, miR-10b-5p, miR-500a-3p, and miR-592) was generated by LASSO-Cox regression analysis. Multivariate Cox regression analysis showed that the risk scores were independent prognostic indicators in each set. The area under curves (AUCs) of 1 year, 3 years, 5 years, and 7 years were high in each set (AUC >0.7). DCA analysis also revealed that the risk score had a potential benefit than other clinical characteristics. Meanwhile, survival analysis showed that the high-risk group showed low survival probabilities. Moreover, the results of enrichment analysis showed that specific miRNAs were mainly enriched in the cAMP signaling pathway and TNF signaling pathway. Finally, the results of RT-qPCR were consistent with the prediction results in public databases. Our study establishes a robust tool based on 5-necroptosis-related miRNAs for the prognostic management of HCC patients.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fgene.2022.825261DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9039163PMC
April 2022

Sirtuin 1 alleviates microglia-induced inflammation by modulating the PGC-1α/Nrf2 pathway after traumatic brain injury in male rats.

Brain Res Bull 2022 Apr 27;185:28-38. Epub 2022 Apr 27.

Department of Neurosurgery, Nanjing First Hospital, Nanjing Medical University, Nanjing 210006, Jiangsu Province, China. Electronic address:

Microglial activation and the subsequent inflammatory response play important roles in the central nervous system after traumatic brain injury (TBI). Activation of the PGC-1α pathway is responsible for microglial activation after TBI. Our previous study demonstrated that SIRT1 alleviates neuroinflammation-induced apoptosis after TBI, and activation of the PGC-1α/Nrf2 pathway extenuates TBI-induced neuronal apoptosis. However, no study has investigated whether SIRT1 can affect the PGC-1α/Nrf2 pathway to induce microglial excitation and the subsequent neuroinflammatory response. Microglial activation and the levels of pro-inflammatory factors, namely, tumor necrosis factor (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) were assessed to evaluate the neuroinflammatory response after TBI. To examine the effects of SIRT1, immunohistochemical staining and western blot analysis were used to observe the nuclear translocation and secretion of PGC-1α, as well as the activation of the PGC-1α/Nrf2 pathway. Treatment with the SIRT1 inhibitor sirtinol promoted microglial activation and pro-inflammatory factor expression (TNF-α, IL-6, and IL-1β) and inhibited PGC-1α and Nrf2 nuclear translocation and secretion after TBI, while treatment with the SIRT1 activator A3 had the opposite effects. The results of this study suggest that microglial activation, the subsequent neuroinflammatory response, and the PGC-1α/Nrf2 pathway play essential roles in secondary injury after TBI. These results indicate that SIRT1 protects neurons after TBI by inhibiting microglial activation and the subsequent inflammatory response, possibly by activating the PGC-1α/Nrf2 pathway.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.brainresbull.2022.04.012DOI Listing
April 2022

Companion-Probe & Race platform for interrogating nuclear protein and migration of living cells.

Biosens Bioelectron 2022 Aug 14;210:114281. Epub 2022 Apr 14.

Key Laboratory of Biomechanics and Mechanobiology,Ministry of Education,Beijing Advanced Innovation Center for Biomedical Engineering,School of Biological Science and Medical Engineering, Beihang University, Beijing, 100083, China; School of Biomedical Engineering, Research and Engineering Center of Biomedical Materials, Anhui Medical University, Hefei, 230032, China. Electronic address:

Probing nuclear protein expression while correlating cellular behavior is crucial for deciphering underlying causes of cellular disorders, such as tumor metastasis. Despite efforts to access nuclear proteins by trafficking the double barriers of cell membrane and nuclear membrane, they mostly fall short of the capacity for analyzing various proteins in different cells. Herein, we introduce a Companion-Probe & Race (CPR) platform that enables interrogating nuclear proteins in living cells, while guiding and tracking cellular behaviors (e.g., migration) in real time. The Companion-Probe consists of two polypeptide complexes that were structured with nuclear localization signal (NLS) for entering nucleus, recognition polypeptide for targeting different sites of nuclear proteins, and fragments of green fluorescent protein (GFP) that can recover a whole fluorescent GFP once the two polypeptide complexes combine with a same target protein. The two polypeptide complexes were expressed by two plasmids (named "probe plasmids") that were uniformly and efficiently delivered into cells by nano-electroporation (NEP), a high-performance delivery method for cell focal-poration and accelerated intracellular delivery. To track cell migration, multiple radial microchannels were designed with micro-landmarks on the platform to serve as addressable runways for cells. The proof-of-concept of CPR platform was validated with clinical primary cells that indicated the positive-correlation between nuclear protein murine double minute 2 (MDM2) expression level and cell migration velocity. This platform shows great promises to interrogate nuclear proteins in live cells, and to decode their roles in determining cellular behaviors on a chip.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bios.2022.114281DOI Listing
August 2022

A comparative study on perioperative outcomes between robotic versus laparoscopic D2 total gastrectomy.

Int J Surg 2022 Apr 26;102:106636. Epub 2022 Apr 26.

Department of General Surgery, The First Affiliated Hospital of Army Medical University, 30 Gaotanyan Street, Chongqing, 400038, China. Electronic address:

Objective: Robotic surgery has been increasingly used worldwide owing to its advanced features. However, the significant benefits of robotic total gastrectomy (RTG) over laparoscopic total gastrectomy (LTG) have yet to be demonstrated. We conducted a prospective cohort study to compare the safety and efficacy of robotic and laparoscopic total gastrectomy (LTG) with D2 lymphadenectomy for AGC.

Methods: Between March 26, 2018 and July 30, 2021, 155 patients between 18 and 80 years of age with locally advanced gastric cancer (cT2-4a, N0/+, M0) were enrolled. The perioperative outcomes within 30 days after surgery were compared between the RTG (n = 69) and LTG (n = 73) groups on a per-protocol (PP) basis. Postoperative complications were evaluated according to the Clavien-Dindo classification.

Results: The overall postoperative morbidity rate was 21.74% in the RTG group and 28.77% in the LTG group with no significant difference (P = 0.44), RTG was associated with a lower incidence of pneumonia (4.35% vs. 15.07%, P = 0.047). No mortality was observed in either group. There was no significant difference in the total operative time (284.48 vs. 271.73 min, P = 0.171), but RTG was associated with a lower estimated volume of blood loss (110 vs. 150 ml, P < 0.001) and more total retrieved lymph nodes (LNs) (41.36 vs 35.1, P = 0.019), more extraperigastric LNs (14.91 vs. 12.19, P = 0.024) and more LNs in the suprapancreatic areas (14.68 vs. 11.82, P = 0.017). The laboratory data (amylase, inflammatory, Albumin and T lymphocyte levels) of the RTG group were better than those of the LTG group.

Conclusion: According to the results of this prospective cohort study, for patients with locally advanced gastric cancer, Robotic surgery has advantages over laparoscopic surgery for radical total gastrectomy with D2 lymphadenectomy performed by well-trained doctors.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ijsu.2022.106636DOI Listing
April 2022

HepT1-derived murine models of high-risk hepatoblastoma display vascular invasion, metastasis, and circulating tumor cells.

Biol Open 2022 Apr 22. Epub 2022 Apr 22.

Divisions of Pediatric Surgery and Surgical Research, Michael E. DeBakey Department of Surgery, Pediatric Surgical Oncology Laboratory, Texas Children's Surgical Oncology Program, Texas Children's Liver Tumor Program, Dan L. Duncan Cancer Center, Baylor College of Medicine, Houston, TX 77030, USA.

Hepatoblastoma (HB) is the most common pediatric primary liver malignancy, and survival for high-risk disease approaches 50%. Mouse models of HB fail to recapitulate hallmarks of high-risk disease. The aim of this work was to generate murine models that show high-risk features including multifocal tumors, vascular invasion, metastasis, and circulating tumor cells (CTCs). HepT1 cells were injected into the livers or tail veins of mice, and tumor growth was monitored with magnetic resonance and bioluminescent imaging. Blood was analyzed with fluorescence activated cell sorting to identify CTCs. Intra- and extra-hepatic tumor samples were harvested for immunohistochemistry and RNA and DNA sequencing. Cell lines were grown from tumor samples and profiled with RNA sequencing. With intrahepatic injection of HepT1 cells, 100% of animals grew liver tumors and showed vascular invasion, metastasis, and CTCs. Mutation profiling revealed genetic alterations in seven cancer-related genes, while transcriptomic analyses showed changes in gene expression with cells that invade vessels. Tail vein injection of HepT1 cells resulted in multifocal, metastatic disease. These unique models will facilitate further meaningful studies of high-risk HB.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1242/bio.058973DOI Listing
April 2022

In situ injectable nano-complexed hydrogel based on chitosan/dextran for combining tumor therapy via hypoxia alleviation and TAMs polarity regulation.

Carbohydr Polym 2022 Jul 28;288:119418. Epub 2022 Mar 28.

College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China. Electronic address:

The tumor microenvironment (TME) is characterized by low pH, hypoxia, and infiltrated tumor-associated macrophages (TAMs). Therefore, regulation of TAMs polarization into anti-tumor M1 phenotype and meanwhile alleviation of the hypoxia in TME are expected to improve anti-tumor therapeutic efficacy. To this end, a novel in situ injectable nano-complexed hydrogel was developed in this study for combining tumor therapy. Thereunto, hyaluronic acid modified transfersomes loaded with chlorogenic acid functioned to reverse M2 type into M1 type via CD44 mediated internalization, the nanomedicine was entrapped in Schiff-based crosslinked injectable hydrogel (fabricated with carboxymethyl chitosan and oxidized dextran) whose linkage was labile to the acidic TME for controlled drug release. Moreover, catalase was integrated in the hydrogel enabling to convert hydrogen peroxide in TME into dissolved oxygen and alleviate tumor hypoxia. The multifunctional nano-complexed injectable hydrogel was verified to efficiently inhibit tumor growth through synergetic effects of hypoxia alleviation and TAMs polarity regulation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.carbpol.2022.119418DOI Listing
July 2022

Prevalence and Predictors of Chronic Pain with Two-Year Follow-Up After Knee Arthroplasty.

J Pain Res 2022 15;15:1091-1105. Epub 2022 Apr 15.

Department of Nursing, Shanghai Tenth People's Hospital, School of Medicine, Tongji University, Shanghai, 200072, People's Republic of China.

Background: Pain relief is the most important issue in the long-term outcome of arthroplasty surgery, with nearly one-third of patients still suffered persistent pain and caused dissatisfaction after the surgery.

Methods: A total of 713 patients underwent primary elective primary TKA and UKA were included consecutively between July 2018 and December 2019, using binary logistic method to analyze the data.

Results: The prevalence of CPSP at rest and on movement at 2-year was 12.1% and 37.7% respectively after primary knee arthroplasty and CPSP at rest factors included: age above 80 (odds ratio [OR]= 6.72, 95% confidence interval [CI] 1.58 to 28.56), BMI above 30 (2.339, 1.02 to 5.383), and moderate to severe pain variables: preoperative pain, (1.95, 1.11 to 3.41); APSP on movement, 4.9 (2.31-10.6); and follow-up contralateral knee pain-at-rest scores (12.6, 5.5 to 28.5). Factors associated with presence of CPSP on movement included: no smoking (2.59, 1.07 to 6.26); and moderate to severe pain variables: preoperative pain, (1.57, 1.073 to 2.30); APSP at rest, (1.85, 1.13 to 3.02); APSP on movement, 6.11 (3.82 to 9.78); and follow-up contralateral knee pain-on-movement scores, 3.22 (2.08 to 5.00). Factors to occurrence of moderate to severe CPSP on movement include: presence of COPD (12.20, 2.19 to 67.98); and moderate to severe pain variables: preoperative pain (2.36, 1.32 to 4.23); APSP on movement (4.68, 1.95 to 11.25); and follow-up contralateral knee pain-on-movement scores (2.71, 1.66 to 4.42).

Conclusion: Prevention strategies should be targeted to different types of pain, and the comorbidity of COPD undergoing knee arthroplasty should receive early identification and attention.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2147/JPR.S345496DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9017706PMC
April 2022

Gypenosides Prevent and Dissolve Cholesterol Gallstones by Modulating the Homeostasis of Cholesterol and Bile Acids.

Front Med (Lausanne) 2022 4;9:818144. Epub 2022 Apr 4.

Digestive Endoscopic Center, Shanghai Jiao Tong University Affiliated Sixth People's Hospital, Shanghai, China.

Gypenosides (GPs), obtained from (Thunb.) Makino, have been traditionally prescribed to treat metabolic disorders in Asians. This study assessed whether GPs could prevent lithogenic diet (LD)-induced cholesterol gallstone (CG) formation and enhance CG dissolution in mice. Gallstone-susceptible C57BL/6J mice were fed an LD or normal chow, with or without GPs. Bile acids (BAs) in gallbladder bile were analyzed by liquid chromatography-tandem mass spectrometry. Differentially expressed hepatic genes were identified by RNA sequencing, followed by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses. GPs were found to prevent LD-induced CG formation and to dissolve pre-existing LD-induced CGs. GPs reduced total cholesterol levels and increased BA levels in bile, as well as reducing the BA Hydrophobicity Index, ratio of 12α-hydroxylated (12α-OH) to non-12α-OH BAs, and Cholesterol Saturation Index in gallbladder bile. GO and KEGG pathway enrichment analyses indicated that GPs-induced genes were involved in BA biosynthesis and cholesterol metabolism. GPs increased the hepatic expression of genes encoding the cytochrome P450 (Cyp) enzymes Cyp7a1, Cyp7b1, and Cyp8b1, while decreasing the hepatic expression of genes encoding the adenosine triphosphate-binding cassette (Abc) transporters Abcg5 and Abcg8. GPs may be a promising strategy for preventing and dissolving CGs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fmed.2022.818144DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9013900PMC
April 2022

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

Plant Dis 2022 Apr 20. Epub 2022 Apr 20.

Henan Agricultural University, 70573, College of Plant Protection, Zhengzhou, Henan, China;

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-02-22-0275-PDNDOI Listing
April 2022

A novel bee-friendly peptidomimetic insecticide: Synthesis, aphicidal activity and 3D-QSAR study of insect kinin analogs at Phe modification.

Pest Manag Sci 2022 Apr 13. Epub 2022 Apr 13.

Innovation Center of Pesticide Research, Department of Applied Chemistry, College of Science, China Agricultural University, Beijing, 100193, PR China.

Background: As one of the most abundant and destructive pests in agriculture, aphids cause significant damage to crops due to their sap-taking and as virus vectors. Chemical insecticides are the most effective method to control aphids, but they bring insecticide resistance problems and harm nontarget organisms, especially bees, therefore the search for novel eco-friendly aphid control agents with low bee toxicity is urgent. Insect kinins are a class of small neuropeptides that control important functions in insects. In our previous study, we found insect kinin analog IV-3 has good aphicidal activity and the location of the aromatic ring on the side chain of Phe is the key to the formation of the β-turn resulting in the biological activity of insect kinin analogs. However, there are few studies on insect kinin Phe substitution and modification, and its structure-activity relationship is still unclear.

Results: In this project, 44 insect kinin analogs with the Phe modification, replacing it with different natural or unnatural amino acids, were designed and synthesized based on the lead IV-3 to explore the role of the Phe residues. Bioassays with soybean aphids of Aphis glycines indicated that nine analogs have better aphicidal activity than the lead IV-3. In particular, compound L exhibits excellent aphicidal activity (LC  = 0.0047 mmol L ) and has low toxicity to bees. Furthermore, a reliable three-dimensional quantitative structure-activity relationship (3D-QSAR) was established to produce a helpful clue that introducing hydrophobic groups away from the backbone chain is beneficial to improve aphicidal activity.

Conclusion: The residue Phe of insect kinin analogs is the key position and has a significant impact on the activity. L has a high toxicity for aphids, while a low toxicity to bees, and therefore can be considered as a lead compound to develop new biosafe aphid control agents. Finally, we provide a useful 3D-QSAR model as theoretical guidance for further structural optimization. © 2022 Society of Chemical Industry.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/ps.6920DOI Listing
April 2022

Chemical reprogramming of human somatic cells to pluripotent stem cells.

Nature 2022 05 13;605(7909):325-331. Epub 2022 Apr 13.

MOE Engineering Research Center of Regenerative Medicine, School of Basic Medical Sciences, State Key Laboratory of Natural and Biomimetic Drugs, Peking University Health Science Center and the MOE Key Laboratory of Cell Proliferation and Differentiation, College of Life Sciences, Peking-Tsinghua Center for Life Sciences, Peking University, Beijing, China.

Cellular reprogramming can manipulate the identity of cells to generate the desired cell types. The use of cell intrinsic components, including oocyte cytoplasm and transcription factors, can enforce somatic cell reprogramming to pluripotent stem cells. By contrast, chemical stimulation by exposure to small molecules offers an alternative approach that can manipulate cell fate in a simple and highly controllable manner. However, human somatic cells are refractory to chemical stimulation owing to their stable epigenome and reduced plasticity; it is therefore challenging to induce human pluripotent stem cells by chemical reprogramming. Here we demonstrate, by creating an intermediate plastic state, the chemical reprogramming of human somatic cells to human chemically induced pluripotent stem cells that exhibit key features of embryonic stem cells. The whole chemical reprogramming trajectory analysis delineated the induction of the intermediate plastic state at the early stage, during which chemical-induced dedifferentiation occurred, and this process was similar to the dedifferentiation process that occurs in axolotl limb regeneration. Moreover, we identified the JNK pathway as a major barrier to chemical reprogramming, the inhibition of which was indispensable for inducing cell plasticity and a regeneration-like program by suppressing pro-inflammatory pathways. Our chemical approach provides a platform for the generation and application of human pluripotent stem cells in biomedicine. This study lays foundations for developing regenerative therapeutic strategies that use well-defined chemicals to change cell fates in humans.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41586-022-04593-5DOI Listing
May 2022

Effect of different anesthetic dose of pentobarbital on respiratory activity in rabbits.

Comput Biol Med 2022 06 7;145:105501. Epub 2022 Apr 7.

Department of Pulmonary and Critical Care Medicine, Chinese PLA General Hospital, Beijing, China. Electronic address:

Anesthetics inhibit the respiratory muscles and even cause upper airway to collapse. Diaphragm electromyography (EMGdi) and airflow signals are usually extracted to assess the degree of respiration inhibition by anesthetics. However, the ECG interference in EMGdi affects the accuracy of its time domain and frequency domain information extraction. We studied the changes in EMGdi (left EMGdi and right EMGdi) and airflow characteristics under two pentobarbital anesthetic doses. First, we filtered out the ECG in EMGdi based on the combination of stationary wavelet transform and the positioning of ECG to obtain EMGdi without ECG interference (EMGdi). The effectiveness of filtering algorithm was verified by calculating the power spectrum before and after noise reduction. Second, root mean square (RMS), average rectified value (ARV), and fixed sample entropy (fSampEn) were used to quantify EMGdi (left EMGdi, left EMGdi and right EMGdi). Median frequency (MF) and centroid frequency (f) of EMGdi were calculated. Tidal volume, respiratory cycle duration and peak airflow were calculated from airflow. Finally, the average and standard deviation of these parameters for all rabbits (n = 10) were compared and analyzed under two anesthesia states. Our results indicate that anesthesia induced by an increase in pentobarbital dose leads to decrease in ventilation and EMGdi amplitude. There was no significant change in diaphragm power spectrum (MF and f) with the increase of anesthesia dose.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.compbiomed.2022.105501DOI Listing
June 2022

Ternary Complex Coacervate of PEG/TA/Gelatin as Reinforced Bioadhesive for Skin Wound Repair.

ACS Appl Mater Interfaces 2022 Apr 13;14(16):18097-18109. Epub 2022 Apr 13.

College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China.

Bioadhesives have attracted more attention in surgery due to their easy operability and abilities of promoting wound closure and tissue healing. However, it is still a great challenge to develop a robust and biocompatible bioadhesive through a facile preparation method. Herein, a ternary complex coacervate comprised of tannic acid (TA), polyethylene glycol (PEG), and gelatin (TPG) is proposed as a novel bioadhesive, which is fabricated by simple physical blending method. The adhesion capacity of TPG was reinforced through programming the cross-linking network of TPG matrix and tailoring the interfacial interactions between matrix and tissue. Curing parameters (pH, temperature, and period) and gelatin content in TPG have crucial impacts on the final comprehensive adhesion performance. The adhesion strength of the optimized formulation, fabricated with 10% (m/m) gelatin (TPG10), was over 3 folds of TPG0 (without gelatin inclusion) after 24 h curing at pH 6 and 37 °C. The mechanism of the reinforced comprehensive adhesion was also investigated, suggesting TA provided tough interfacial adhesion, covalent cross-link of TA-gelatin improved mechanical properties, and the hydrogen bonds mediated dynamic cross-link between TA and PEG enabled the bulk matrix to dissipate energy upon deformation. Furthermore, the additional antibacterial activity, biocompatibility, and suitable degradability endowed TPG10 with desirable wound closure and tissue repairing efficacy on rat skin wound model. Such low-cost, readily prepared, and function-efficient bioadhesive could provide a versatile platform for tissue repair and regeneration.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsami.2c00236DOI Listing
April 2022

Social facilitation effects in online coaction: the moderating role of social comparison direction.

Int J Occup Saf Ergon 2022 May 16:1-9. Epub 2022 May 16.

National Key Laboratory of Human Factor and Ergonomics, China National Institute of Standardization, People's Republic of China.

Online and face-to-face coactions are widely used work organization modes. This study aims to investigate the effect of social comparison direction on task performance when people coact online. A total of 40 individuals were recruited to participate in a 2 (coaction type: online and face to face) × 3 (social comparison direction: upward, downward and no comparison) × 2 (phase: pre-comparison and post-comparison) within-subject experiment. The participants performed visual search tasks while their response time and search accuracy rates were measured. Results showed that the participants were reported to perform faster when they coacted online than face to face. The upward comparison led to a stronger social facilitation effect than the downward and no comparison directions, either in online or face-to-face coaction. These findings provide practical implications in the design of coaction modes for groups and teams working remotely.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/10803548.2022.2065780DOI Listing
May 2022

Characterization and functional analysis of a c-type lysozyme gene from obscure puffer Takifugu obscurus.

Dev Comp Immunol 2022 Apr 9;133:104412. Epub 2022 Apr 9.

College of Oceanography, Hohai University, 1 Xikang Road, Nanjing, Jiangsu, 210098, China. Electronic address:

Lysozyme (Lyz) is an alkaline enzyme that hydrolyzes mucopolysaccharides in bacteria and is highly conserved vertebrates and invertebrates. In this study, a c-type lysozyme gene (named ToLyzC) from the obscure puffer Takifugu obscurus was cloned and characterized. The full-length cDNA of ToLyzC was 432 bp, encoding 143 amino acids, with a predicted molecular mass of 16.2 kDa and a theoretical pI of 8.86. The depicted protein sequence contained a LYZ1 domain from 16 to 142 amino acids, seven conserved cysteine residues. Phylogenetic analysis indicated that ToLyzC clustered with Lyzs from other teleost fishes. Quantitative real-time PCR analysis revealed that ToLyzC mRNA was mainly expressed in the liver. The transcript level of ToLyzC gene was significantly upregulated after Staphylococcus aureus and Vibrio harveyi challenge. The optimal pH and temperature of recombinant ToLyzC protein (rToLyzC) lytic activity was detected to be 7.5 and 35 °C, respectively. rToLyzC exhibited significant antibacterial and bacterial binding activities against S. aureus, Aeromonas hydrophila, V. harveyi, and Edwardsiella tarda at different time points. In addition, the morphological changes of V. harveyi cells treated with rToLyzC were observed under scanning electron microscope, which further confirmed the antibacterial and bacteriolytic activity of rToLyzC. Taken together, our current study indicated that ToLyzC is involved in the immune response to bacterial infection in obscure puffers.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.dci.2022.104412DOI Listing
April 2022

Bone Metastasis From Gastric Adenocarcinoma-What Are the Risk Factors and Associated Survival? A Large Comprehensive Population-Based Cohort Study.

Front Oncol 2022 25;12:743873. Epub 2022 Mar 25.

Department of Oncology, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China.

Background: While bone metastasis is not common in gastric adenocarcinoma (GaC), it can have important impacts on prognosis. This large cohort study aimed at exploring factors associated with bone metastasis in GaC and investigating the time-dependent cumulative mortalities and prognostic factors in GaC patients with bone metastasis at the population level.

Methods: Data on patients with GaC diagnosed in 2010-2016 were retrieved from a large population-based database. We explored factors associated with bone metastasis using the multivariable-adjusted logistic model. We then calculated the time-dependent cancer-specific mortalities in GaC patients with bone metastasis using the cumulative incidence function and compared mortalities across subgroups using Gray's test. We further assessed factors associated with mortality using the multivariable-adjusted Fine-Gray subdistribution hazard model.

Results: Together 11,072 eligible patients with metastatic GaC were enrolled, which comprised 1,511 (14%) people with bone metastasis and 9,561 (86%) with other metastasis, encompassing 6,999 person-years of follow-up. Bone metastasis was more frequently detected in 2014 or later, in younger patients, in patients with gastric cardia cancers, in people with signet-ring cell carcinoma, and in those with poorly differentiated/undifferentiated cancers; it was less commonly observed in black patients. Bone metastasis was associated with more frequent brain and lung metastases. The median survival of patients with bone metastasis was 4 months; the 6-month and 3-year cancer-specific cumulative mortalities were 56% and 85%, respectively. In patients receiving chemotherapy, American Indians/Alaskan Natives, patients with gastric antrum/pylorus cancers, and those with positive lymph nodes had higher mortality risks, while those undergoing resection had lower mortality hazards.

Conclusion: In GaC patients, bone metastasis was associated with various clinicopathologic factors including age, ethnicity, tumor location, histology, differentiation, and metastasis to other sites. Patients with bone metastasis had poor prognosis which was associated with ethnicity, tumor location, lymph node involvement, and treatment. Our findings provide important hints for tailed patient management and for further mechanistic investigations.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fonc.2022.743873DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8989732PMC
March 2022

Genome-Wide Identification of Apple Atypical bHLH Subfamily PRE Members and Functional Characterization of MdPRE4.3 in Response to Abiotic Stress.

Front Genet 2022 24;13:846559. Epub 2022 Mar 24.

State Key Laboratory of Crop Biology, Shandong Green Fertilizer Technology Innovation Center, Collaborative Innovation Center of Fruit and Vegetable Quality and Efficient Production, Shandong Agricultural University, Tai'an, China.

() genes encode atypical basic helix-loop-helix (bHLH) transcription factor family. Typical bHLH proteins contain a bifunctional structure with a basic region involved in DNA binding and an adjacent helix-loop-helix domain involved in protein-protein interaction. PRE members lack the basic region but retain the HLH domain, which interacts with other typical bHLH proteins to suppress or enhance their DNA-binding activity. PRE proteins are involved in phytohormone responses, light signal transduction, and fruit pigment accumulation. However, apple () PRE protein functions have not been studied. In this study, nine genes were identified from the apple GDDH13 v1.1 reference genome and were mapped to seven chromosomes. The -acting element analysis revealed that promoters possessed various elements related to hormones, light, and stress responses. Expression pattern analysis showed that genes have different tissue expression profiles. Hormonal and abiotic stress treatments can induce the expression of several MdPRE genes. Moreover, we provide molecular and genetic evidence showing that increases the apple's sensitivity to NaCl, abscisic acid (ABA), and indoleacetic acid (IAA) and improves tolerance to brassinosteroids (BR); however, it does not affect the apple's response to gibberellin (GA). Finally, the protein interaction network among the MdPRES proteins was predicted, which could help us elucidate the molecular and biological functions of atypical bHLH transcription factors in the apple.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fgene.2022.846559DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8987198PMC
March 2022
-->