Publications by authors named "Seyed Latif Mousavi Gargari"

63 Publications

Protective Immunity Against Enterotoxigenic Escherichia coli by Oral Vaccination of Engineered Lactococcus lactis.

Curr Microbiol 2021 Jul 15. Epub 2021 Jul 15.

Department of Biology, Behbahan Khatam Alanbia University of Technology, Behbahan, Iran.

Enterotoxigenic Escherichia coli (ETEC) is one of the leading causes of diarrhea in children globally, and thus suitable vaccines are desired. Antigen display on lactic acid bacteria is a reliable approach for efficient oral vaccination and preventing bowel diseases. To develop an oral vaccine against ETEC, the gene of the binding domain from heat-labile toxin (LTB), a key ETEC virulence factor, was codon-optimized and cloned into a construct containing a signal peptide and an anchor for display on L. lactis. Bioinformatics analysis showed a codon adaptation index of 0.95 for the codon-optimized gene. Cell surface expression of LTB was confirmed by transmission electron microscopy and blotting. White New Zealand rabbits were immunized per os (PO) with the recombinant L. lactis, and the antibody titers were assayed with ELISA. In vitro neutralization assay was performed using mouse adrenal tumor cells and rabbit ileal loop test was performed as the in vivo assay. ELISA results indicated that oral administration of the engineered L. lactis elicited a significant production of IgA in the intestine. In vitro neutralization assay showed that the effect of the toxin could be neutralized with 500 µg/ml of IgG isolated from the oral vaccine group. Furthermore, the dose of ETEC causing fluid accumulation in the ileal loop test showed a tenfold increase in rabbits immunized with either recombinant L. lactis or LTB protein compared to other groups. Our results imply that recombinant L. lactis could potentially be an effective live oral vaccine against ETEC toxicity.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00284-021-02601-xDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8280578PMC
July 2021

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens.

Sci Rep 2021 Jun 16;11(1):12639. Epub 2021 Jun 16.

Department of Biology, Faculty of Basic Sciences, Shahed University, Tehran, Iran.

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N)GGGAGACAAGAATAAGCA). The K of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41598-021-91826-8DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8209218PMC
June 2021

Anti-flagellin IgY antibodies protect against Pseudomonas aeruginosa infection in both acute pneumonia and burn wound murine models in a non-type-specific mode.

Mol Immunol 2021 Aug 12;136:118-127. Epub 2021 Jun 12.

Medicinal Plants Research Center, Shahed University, Tehran, Iran.

Pseudomonas aeruginosa (PA) is one of the most dominant causes of nosocomial infections in burn patients. Increasing emergence of antibiotic-resistant strains highlights the need for novel antimicrobial agents. Flagellin, the main component protein of flagellum, is determined as the major antigen interacting with anti-P. aeruginosa IgY antibodies. The current study was aimed to evaluate the antibacterial potency of IgY antibodies raised against recombinant type A, and B flagellins. The immunogenicity and specificity of IgY antibodies were confirmed through indirect ELISA and western blot analysis, respectively. Anti-flagellin IgYs reduced the motility, biofilm formation and invasion potency of both strains. The cell surface hydrophobicity (CSH) of bacteria was increased upon IgY treatment, and in vitro opsonophagocytosis assay confirmed the high protective potency of specific antibodies via polymorphonuclear leukocyte (PMN)-augmented bacterial cell killing. The protective efficacy of IgYs was also studied in both acute pneumonia and burn wound murine models. Anti-flagellin B-IgY induced 100 % and 40 % protection against laboratory, and hospital strains in burn wound model, respectively. Protection in acute pneumonia against all strains was 100 %. Anti-flagellin A-IgY failed to protect mice in burn wound model, but provided 100 % protection against all strains in acute pneumonia challenge. In vitro, ex vivo and in vivo experiments confirmed the dose-dependent and non-type specific essence of anti-flagellin IgY antibodies, providing the benefit of covering all strain types in a dose dependent manner. Our findings provide evidence that anti-flagellin IgY antibodies qualify as novel economical therapeutic option against PA infection.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.molimm.2021.06.002DOI Listing
August 2021

Correction to: Development of a simple, repeatable, and cost-effective extracellular matrix for long-term xeno-free and feeder-free self-renewal of human pluripotent stem cells.

Histochem Cell Biol 2021 May;155(5):617

Department of Stem Cells and Developmental Biology, Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran.

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00418-021-01963-4DOI Listing
May 2021

Identification and evaluation of novel vaccine candidates against Shigella flexneri through reverse vaccinology approach.

Appl Microbiol Biotechnol 2021 Feb 16;105(3):1159-1173. Epub 2021 Jan 16.

Faculty of Basic Sciences, Department of Cell Biology, Shahed University, Tehran, Iran.

Shigellosis is a significant type of diarrhea that causes 160,000 deaths annually in a global scale. The mortality occurs mainly in children less than 5 years of age. No licensed vaccine is available, and conventional efforts for developing an effective and safe vaccine against shigellosis have not been succeeded yet. The reverse vaccinology is a novel promising method that screens genome or proteome of an organism for finding new vaccine candidates. In this study, through reverse vaccinology approach, new vaccine candidates against Shigella flexneri were identified and experimentally evaluated. Proteomes of S. flexneri were obtained from UniProt, and then outer membrane and extracellular proteins were predicted and selected for the evaluation of transmembrane domains, protein conservation, host homology, antigenicity, and solubility. From 103 proteins, 7 high-scored proteins were introduced as novel vaccine candidates, and after B- and T-cell epitope prediction, the best protein was selected for experimental studies. Recombinant protein was expressed, purified, and injected to BALB/c mice. The adhesion inhibitory effect of sera was also studied. The immunized mice demonstrated full protection against the lethal dose challenge. The sera remarkably inhibited S. flexneri adhesion to Caco-2 epithelial cells. The results indicate that identified antigen can serve for vaccine development against shigellosis and support reverse vaccinology for discovering novel effective antigens. KEY POINTS: • Seven Shigella new antigens were identified by reverse vaccinology (RV) approach. • The best antigen experimented demonstrated full protection against lethal dose. • In vivo results verified RV analyses and suggest FimG as a new potent vaccine candidate.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00253-020-11054-4DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7811352PMC
February 2021

Expression of recombinant G-CSF receptor domains and their inhibitory role on G-CSF function.

Res Pharm Sci 2020 Aug 28;15(4):381-389. Epub 2020 Aug 28.

Department of Pharmaceutical Biotechnology and Pharmaceutical Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran, I.R. Iran.

Background And Purpose: Granulocyte colony-stimulating factor (G-CSF) is routinely used in combination with chemotherapy to battle neutropenia. However, studies suggest that this chemokine may increase the risk of metastasis and malignancy in many cancers. To counteract the adverse effects of G-CSF in cancer, antibodies have been used to block its action. However, antibodies are large and complex molecules which makes their production expensive. Thus in this study, we aim to construct different structure variants of the G-CSF receptor containing different domains and select the best variant that prevents the adverse actions of this chemokine. These novel structures are smaller than antibodies and easier to produce.

Experimental Approach: Different domains of the G-CSF receptor were designed and cloned into the pET28a expression vector. These recombinant receptor subunits were then expressed in and purified using standard affinity chromatography techniques. Interaction of recombinant receptor subunits with G-CSF was assessed using enzyme-linked immunosorbent assay and NFS60 cells.

Findings / Results: Two recombinant receptor subunits containing D1 + D2 + D3 domains and D2 domain showed the strongest inhibitory activity to G-CSF.

Conclusion And Implications: These novel recombinant receptor variants could be candidates for further studies in the development of novel therapeutics.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4103/1735-5362.293516DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7714017PMC
August 2020

Protective effects of egg yolk immunoglobulins (IgYs) developed against recombinant immunogens CtxB, OmpW and TcpA on infant mice infected with Vibrio cholerae.

Int Immunopharmacol 2020 Dec 13;89(Pt B):107054. Epub 2020 Oct 13.

Department of Biology, Shahed University, Tehran, Iran. Electronic address:

Vibrio cholerae causes cholera and other infections, especially in children under five years of age. Cholera toxin (CT), toxin-coregulated pilus (TCP) and outer membrane protein W (OmpW) are three major virulence factors of this bacterium. The emergence of antimicrobial-resistant (AMR) strains and the absence of a comprehensive and flawless vaccine, has prompted other treatments. There are several advantages of egg yolk antibodies (IgY) over other immunotherapy agents, such as economic feasibility, high yield simple production, and better immune responsiveness to mammalian antigens due to phylogenetic distance. Accordingly, in the present study, IgYs against recombinant proteins CtxB (responsible for the CT binding to eukaryotic cells), TcpA (enhances bacterial attachment to enterocytes) and OmpW were produced, in single, coupled or combined forms, to evaluate and compare their protectivity potency. Immunoreactivity of IgYs were examined through protein and whole cell ELISA, their specificity was confirmed by western blotting, and their neutralizing effects on CT was evaluated in Y1 cell culture. Produced IgYs were gavage administered to different groups of infant mice infected with V. cholerae. The results indicated that IgYs produced against CtxB had the highest titers, and were able to neutralize cytotoxicity effects in Y1 cell culture, while the highest protection in the mice challenge was obtained by IgY-TcpA. No considerable increase was observed in immunoreactivity or protectivity of antibodies produced against combined antigens. The produced IgYs showed a good antigen-specificity and protectivity which can be used in passive immunotherapy against cholera.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.intimp.2020.107054DOI Listing
December 2020

Protective Efficacy of the OprF/OprI/PcrV Recombinant Chimeric Protein Against in the Burned BALB/c Mouse Model.

Infect Drug Resist 2020 9;13:1651-1661. Epub 2020 Jun 9.

Department of Microbiology, Karaj Branch, Islamic Azad University, Karaj, Iran.

Background: infection is the major cause of death in burn patients. Thus, in this study, a chimeric vaccine harboring the OprF-OprI-PcrV was designed and expressed in . The immunogenicity of the recombinant chimer, OprI, OprF, and PcrV was studied in a burned mouse model.

Methodology: Recombinant proteins including the proposed chimer, OprF, OprI, and PcrV were expressed in the . Mice were immunized with the purified recombinant proteins, and the antibody titre was estimated in the sera obtained from immunized mice. Immunized and control mice were challenged with 2, 5, and 10xLD of the strains (PAO1, PAK, and R), and microbial counts were measured in the skin, liver, spleen, and kidney of the studied mice.

Results: Results showed that the antibody titre (total IgG) was significantly increased by injection of 10 μg of chimeric protein in the experimental groups compared to the control groups. The antibody survival titre was high until 235 days after administration of the second booster. The survival rate of the mice infected with 10xLD was significantly increased and the number of bacteria was reduced, especially in the internal organs (kidney, spleen, and liver) compared to the mice immunized with any of the OprF, OprI, and PcrV proteins alone.

Conclusion: The findings of our study revealed that the chimeric protein is a promising vaccine candidate for control of the infection.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2147/IDR.S244081DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7294051PMC
June 2020

Immunotherapy with IgY Antibodies toward Outer Membrane Protein F Protects Burned Mice against Infection.

J Immunol Res 2020 29;2020:7840631. Epub 2020 May 29.

Department of Biology, Faculty of Basic Science, Shahed University, Tehran, Iran.

Burn patients with multidrug-resistant infections commonly suffer from high morbidity and mortality, which present a major challenge to healthcare systems throughout the world. Outer membrane protein F (OprF), as a main outer membrane porin, is required for full virulence expression of . The aim of this study was to evaluate the protective efficacy of egg yolk-specific antibody (IgY) raised against recombinant OprF (r-OprF) protein in a murine burn model of infection. The hens were immunized with r-OprF, and anti-r-OprF IgY was purified using salt precipitation. Groups of mice were injected with different regimens of anti-OprF IgY or control IgY (C-IgY). Infections were caused by subcutaneous injection of strain PAO1 at the burn site. Mice were monitored for mortality for 5 days. The functional activity of anti-OprF IgY was determined by invasion assays. Immunotherapy with anti-OprF IgY resulted in a significant improvement in the survival of mice infected by from 25% to 87.5% compared with the C-IgY and PBS. The anti-OprF IgY decreased the invasion of PAO1 into the A549. Passive immunization with anti-OprF IgY led to an efficacious protection against burn infection in the burn model.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2020/7840631DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7275967PMC
May 2021

Identification of novel vaccine candidate against Salmonella enterica serovar Typhi by reverse vaccinology method and evaluation of its immunization.

Genomics 2020 09 19;112(5):3374-3381. Epub 2020 Jun 19.

Department of Biology, Faculty of Basic Sciences, Shahed University, Tehran, Iran. Electronic address:

Salmonella enterica serovar Typhi (S. Typhi) is an essential enteric fever causing bacterium worldwide. Due to the emergence of multidrug-resistant strains, urgently attention is needed to prevent the global spread of them. Vaccination is an alternative approach to control these kinds of infections. Currently available commercial vaccines have significant limitations such as non-recommendation for children below six years of age and poor long-term efficacy. Thus, the development of a new vaccine overcoming these limitations is immediately required. Reverse Vaccinology (RV) is one of the most robust approaches for direct screening of genome sequence assemblies to identify new protein-based vaccines. The present study aimed to identify potential vaccine candidates against S. Typhi by using the RV approach. Immunogenicity of the best candidate against S. Typhi was further investigated. The proteome of S. Typhi strain Ty2 was analyzed to identify the most immunogenic, conserved, and protective surface proteins. Among the predicted vaccine candidates, steD (fimbrial subunit) was the best for qualifying all the applied criteria. The synthetic steD gene was expressed in E.coli, and the mice were immunized with purified recombinant steD protein and then challenged with a lethal dose of S. Typhi. Immunized animals generated high protein-specific antibody titers and demonstrated 70% survival following lethal dose challenge with S. Typhi. Pretreatment of the S. Typhi cells with immunized mice antisera significantly decreased their adhesion to Caco-2 cells. Altogether, steD as a protective antigen could induce a robust and long term and protective immunity in immunized mice against S. Typhi challenge.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ygeno.2020.06.022DOI Listing
September 2020

Isolation and characterization of a novel nanobody for detection of GRP78 expressing cancer cells.

Biotechnol Appl Biochem 2021 Apr 19;68(2):239-246. Epub 2020 May 19.

Department of Biology, Faculty of Basic Sciences, Shahed University, Tehran, Iran.

Glucose-regulated protein 78 (GRP78) is an endoplasmic reticulum (ER) chaperone that has been shown that is overexpressed in cancer cells. Overexpression of GRP78 on cancer cells makes this molecule a suitable candidate for cancer detection and targeted therapy. VHH is the binding fragment of camelid heavy-chain antibodies also known as "nanobody." The aim of this study is to isolate and produce a new recombinant nanobody using phage display technique to detect cancer cells. Using the c-terminal domain of GRP78 (CGRP) as an antigen, four rounds of biopanning were performed, and high-affinity binders were selected by ELISA. Their affinity and functionality were characterized by surface plasmon resonance (SPR) cell ELISA and immunocytochemistry. A unique nanobody named V80 was purified. ELISA and SPR showed that this antibody had high specificity and affinity to the GRP78. Immunofluorescence analysis showed that V80 could specifically bind to the HepG2 and A549 cancer cell lines. This novel recombinant nanobody could bind to the cell surface of different cancer cells. After further evaluation, this nanobody can be used as a new tool for cancer detection and tumor therapy.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/bab.1916DOI Listing
April 2021

Anti-PcrV IgY antibodies protect against Pseudomonas aeruginosa infection in both acute pneumonia and burn wound models.

Mol Immunol 2019 12 18;116:98-105. Epub 2019 Oct 18.

Department of Biology, Faculty of Basic Science, Shahed University, Tehran, Iran. Electronic address:

Pseudomonas aeruginosa is a common nosocomial pathogen in burn patients, and rapidly acquires antibiotic resistance; thus, developing an effective therapeutic approach is the most promising strategy for combating infection. Type III secretion system (T3SS) translocates bacterial toxins into the cytosol of the targeted eukaryotic cells, which plays important roles in the virulence of P. aeruginosa infections in both acute pneumonia and burn wound models. The PcrV protein, a T3SS translocating protein, is required for T3SS function and is a well-validated target in animal models of immunoprophylactic strategies targeting P. aeruginosa. In the present study, we evaluated the protective efficacy of chicken egg yolk antibodies (IgY) raised against recombinant PcrV (r-PcrV) in both acute pneumonia and burn wound models. R-PcrV protein was generated by expressing the pcrV gene (cloned in pET-28a vector) in E. coli BL-21. Anti-PcrV IgY was obtained by immunization of hen. Anti-PcrV IgY induced greater protection in P. aeruginosamurine acute pneumonia and burn wound models than control IgY (C-IgY) and PBS groups. Anti-PcrV IgY improved opsonophagocytic killing and inhibition of bacterial invasion of host cells. Taken together, our data provide evidence that anti-PcrV IgY can be a promising therapeutic candidate for combating P. aeruginosa infections.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.molimm.2019.10.005DOI Listing
December 2019

Exploitation of two siderophore receptors, BauA and BfnH, for protection against Acinetobacter baumannii infection.

APMIS 2019 Dec 21;127(12):753-763. Epub 2019 Oct 21.

Department of Biology, Shahed University, Tehran, Iran.

Iron uptake system is expressed in early stages of Acinetobacter baumannii infections under iron-restricted conditions. This study is aimed at the evaluation of immuno-protectivity of BfnH in comparison with BauA in both mature and selected fragmental proteins. The study was designed in single and combined forms of antigens. BfnH is presented in 3472 strains of A. baumannii with more than 97% identity. The preliminary immune-informatics analysis of this protein indicated a region from the β-barrel domain including exposed loops 2-5, with antigenic score comparable to that of BfnH. There was a significant rise in the specific IgG response in all test groups. The bacterial challenge with a lethal dose of A. baumannii demonstrated partial protection of whole proteins which coincides with a significant reduction in the bacterial population colonized in the main organs and an increase in the survival level. Passive immunization of the mice brought about 50% survival in the mice groups immunized with BfnH and with a combination of BfnH and BauA. The protectivity of siderophore receptors suggests their potential immunogenic role that could be considered as a component of multivalent subunit vaccine candidates against A. baumannii.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/apm.12992DOI Listing
December 2019

Evaluation of Crimean-Congo Hemorrhagic Fever Orthonairovirus AviTagged Nucleoprotein for Potential Application in Diagnosis

Iran Biomed J 2019 11 20;23(6):379-87. Epub 2019 May 20.

Department of Biology, Faculty of Basic Sciences, Shahed University, Tehran, Iran.

Background: Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease, with a mortality rate of 30-50%. There is no approved vaccine or any specific antiviral treatment for CCHF; therefore, the rapid diagnosis seems to be crucial for both efficient supportive therapy and control of infection spread. In this study, the potency of recombinant nucleoprotein of virus expressed in prokaryotic system was investigated for diagnosis of the infection.

Methods: The DNA sequence of complete nucleoprotein ORF was codon optimized based on E. coli codon usage and synthesized commercially. The gene was subcloned in pCA4 vector and expressed in E. coli BL21 (DE3). Refolding and simultaneous purification of nucleoprotein were performed using protein folding liquid chromatography method. The recombinant nucleoprotein was analyzed by Western blotting, ELISA, immunofluorescence assay, and circular dichroism. Forty eight human samples, in three IgM positive and three negative control groups, were evaluated using recombinant nucleoprotein in a capture ELISA setting. Serum from healthy individuals, those suspected to viral hemorrhagic fevers, and positive samples of Chikungunya and Dengue were considered as negative controls.

Results: The existence and structure of recombinant nucleoprotein were verified and confirmed. Capture IgM ELISA detected all positive samples (sensitivity of 100%), but none of the 25 negative samples was detected as positive (specificity of 100%). The test also detected all the included genotypes of virus.

Discussion: Our recombinant nucleoprotein can be used in IgM capture ELISA for easy and efficient detection of CCHF in any lab in endemic regions.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6800536PMC
November 2019

Aptamer-Based Sandwich Assay for Measurement of Thymidine Kinase 1 in Serum of Cancerous Patients.

Biochemistry 2019 05 22;58(18):2373-2383. Epub 2019 Apr 22.

Nanobiotechnology Research Center , Baqiyatallah University of Medical Sciences , Tehran , Iran.

Thymidine kinase 1 (TK1) is traditionally a serum biomarker that is elevated in the early stages of malignancies. The diagnostic and prognostic role of TK1 for screening and monitoring human malignancies has recently been investigated. Anti-human TK1 aptamers were selected through 12 iterative rounds of systematic evolution of ligands by exponential enrichment from a DNA library. The aptamer pool of round 12 was amplified, and the polymerase chain reaction product was cloned on the TA vector. Of the 85 colonies obtained, 52 were identified as positive clones. These aptamers were screened for TK1 with surface plasmon resonance, where apta37 and apta69 showed the highest affinity for TK1. The TK1_apta37 and TK1_apta69 aptamers were used in a sandwich assay platform and successfully detected TK1 in the concentration range of 54-3500 pg mL. Clinical samples from 60 cancerous patients were also tested with this assay system and compared using the conventional antibody-based enzyme-linked immunosorbent assay kit. The aptamer sandwich assay demonstrated a dynamic range for TK1 at clinically relevant serum levels, covering subpicogram per milliliter concentrations. The new approach offers a simple and robust method for detecting serum biomarkers that have low and moderate abundance. The results of this study demonstrate the screening capability of the aptamer sandwich assay platform and its potential applicability to the point-of-care testing system.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acs.biochem.8b01284DOI Listing
May 2019

Designing and Expression of Recombinant Chimeric Protein Containing CtxB and OmpW from Vibrio Cholerae and Evaluation of Its Immunogenicity.

Iran J Immunol 2018 Sep;15(3):207-220

Department of Biology, Faculty of Basic Science, Shahed University, Tehran, Iran.

Background: Cholera disease caused by Vibrio cholerae remains a major cause of morbidity and mortality throughout the world. Various strategies with different proteins as immunogens have been tried for vaccine development, none of which have been sufficiently effective to preclude cholera. Chimeric proteins, with their ability to present multiple antigens at the same time, can play important roles in immunization.

Objective: To evaluate the immunogenicity of a chimeric construct, comprised of OmpW and CtxB as immunogenic proteins of Vibrio cholera, in BALB/c mice.

Methods: The construct was designed after bioinformatics assessments and then expressed in E.coli. Chimeric protein, OmpW, and CtxB were purified with Ni-NTA chromatography and confirmed by Western blotting. Mice were immunized with purified recombinant proteins. The antibody titers and specificity of the immune sera were then analyzed by ELISA and challenged on the pups of immunized mice with 1, 5 and 10 LD50. Mice ileal loop assay was also performed.

Results: Significant differences were observed in antibody titers in immunized mice compared to the control groups. Infant mouse challenge was performed so as to compare the protective efficacies of the selected immunogen regimens. Of the Pups from dams immunized with chimeric protein which received 1 LD50, 75% survived. Pups belonging to PBS-immunized dams, experienced 100% mortality. The serum raised toward immunogenic construct, inhibited cholera toxin activity in ileal loop test up to 68%.

Conclusion: Chimeric construct is able to induce the immune system and provide up to 75% inhibition of toxin activity against 1 LD50 of Vibrio cholerae.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.22034/IJI.2018.39390DOI Listing
September 2018

A Comparison Between Cell, Protein and Peptide-Based Approaches for Selection of Nanobodies Against CD44 from a Synthetic Library.

Protein Pept Lett 2018 ;25(6):580-588

Department of Human Anatomy and Cell Science, Rady Faculty of Health Sciences, Max Rady College of Medicine, University of Manitoba, Winnipeg, MB, Canada.

Background: The hyaluronic acid receptor CD44, is a cancer stem cell biomarker, playing important roles in cell adhesion, tumor progression and drug-resistance. Therefore, CD44 is a potential target for cancer treatment and its blockade could result in multi-factorial therapeutic effects.

Methods: Nanobodies against CD44 were isolated from a synthetic library with a diversity of 5×1011 CFU/ml using the phage display technique. Three approaches were used for isolation of nanobodies fragments including peptide-, protein- and cell-based panning.

Results: Nanobodies from cell-based panning displayed more specificity compared to protein or peptide-based panning. Our results show that cell-based panning is the most efficient method for isolation of a specific single domain antibody fragment to CD44 from a synthetic phage displayed library.

Conclusion: The isolated nanobodies could successfully recognize and bind cells that express the CD44 surface antigen.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2174/0929866525666180530122159DOI Listing
July 2019

Targeting Colorectal Cancer Cell Lines Using Nanobodies; AgSK1as a Potential Target.

Iran J Biotechnol 2017 19;15(2):78-86. Epub 2017 Aug 19.

Department of Biology, Faculty of Basic Science, Shahed University, Tehran, Iran.

Colorectal cancer is the third most common type of aggressive cancers. Chemotherapy, surgery, and radiotherapy are the common therapeutic options for treating this cancer. Due to the adverse side-effects of these methods, immunotherapy is considered as an appropriate alternative therapeutic option. Treatment through the application of monoclonal antibodies is considered as a novel alternative therapeutic method for cancers. The variable fragments of the antibodies' heavy chain or VHHs have a wide application in molecular biology and biotechnology. VHHs are compatible with the phage display technology which allows rapid and high throughput screening for antibodies isolation. We aimed to use naive VHH phage library to isolate a specific nanobody against colorectal tumor associated antigen; the AgSK1. In this research, naive VHH phage library was panned against two colorectal cell lines; Ls174T and HT29 expressing different levels of AgSK1 tumor associated marker. The high affinity binders were selected and subcloned for higher expression levels of the VHH. The affinity and specificity of the isolated VHH were tested using ELISA. The reactivity of the VHH toward cancer cells was analyzed by competitive ELISA applying sera isolated from colorectal cancer patients. Results show that the isolated VHH recognizes and binds to the colorectal cancer cells with a high affinity. Moreover, the isolated nanobody is able to compete with the antibodies in the patient sera for the binding to the cancer cells. Results suggest that this nanobody has a specific reaction toward colorectal cells and can be used for further investigation on the tumor associated antigens or production of mimotopes useful for immunotherapy.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.15171/ijb.1472DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5811057PMC
August 2017

An in silico structural and physicochemical characterization of TonB-dependent copper receptor in A. baumannii.

Microb Pathog 2018 May 7;118:18-31. Epub 2018 Mar 7.

Department of Biology, Shahed University, Tehran-Qom Express Way, Tehran, Iran.

Acinetobacter baumannii is an opportunistic multidrug resistant pathogen. TonB-dependent copper receptor is an outer membrane protein and has a role in binding of A. baumannii to host cell via attachment to fibronectin. Moreover, it is highly expressed in biofilm community. In this study the properties of copper receptor were analyzed in silico and its vaccine potential was investigated. TonB-dependent copper and iron receptor domains plus one plug domain at N-terminal were determined by domain analysis. Topology modeling showed 22 β-strands, 11 loops and 10 periplasmic turns. Interaction of this protein with TonB2 energy transducer was also indicated. Beside the antigenicity, this protein could take part in bacterial virulence. The more preferable 3D structure was selected amongst all 26 predicted structures, refined and used in prediction of ligand binding site and conformational epitope. The results of B and T-cell epitope mapping indicated 8 potential areas in the protein sequence and structure that seems to be able to stimulate both humoral and cellular immune responses. Based on the alignment result, this protein and all selected epitopes are extremely conserved among A. baumannii strains which can be tested as sub unit vaccine by in vivo studies.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.micpath.2018.03.009DOI Listing
May 2018

Immunogenicity of enterotoxigenic outer membrane vesicles encapsulated in chitosan nanoparticles.

Iran J Basic Med Sci 2018 Mar;21(3):284-291

Department of Biology, Faculty of Science, Shahed University, Tehran, Iran.

Objectives: Enterotoxigenic (ETEC) is an important cause of diarrheal disease in humans, particularly in children under 5 years and travelers in developing countries.To our knowledge, no vaccine is licensed yet to protect against ETEC infection. Like many Gram-negative pathogens, ETEC can secrete outer membrane vesicles (OMVs). These structures contain various immunogenic virulence proteins such as LT and therefore can be used as vaccine candidates. In this study we attempted to isolate the OMVs of ETEC cultivated at different temperatures and evaluate their immunogenicity and protective efficacy in a murine model of infection.

Materials And Methods: OMVs was purified from bacterial supernatant by ultracentrifugation. OMVs were encapsulated in chitosan nanoparticles prepared by ionic gelation method within a layer of Eudragit L100 for oral delivery. Female BALB/c mice of 9 weeks' old were immunized by parenteral injection and oral administration with free and encapsulated OMVs obtained from bacteria cultivated at 37°C and 42°C. The serum samples were collected and the antibody titers were measured by an enzyme-linked immunosorbent assay (ELISA).

Results: The protein concentrations of OMVs were 3.47 mg/ml and 2.46 mg/ml for bacteria grown at 37°C and 42°C respectively. OMVs loaded into nanoparticles (NP-OMVs) were homogeneous and spherical in shape, with a size of 532 nm. The encapsulation efficiency of NP was 90%. Mice immunized with OMVs, inhibited the ETEC colonization in their small intestine and induced production of antibodies against LT toxin.

Conclusion: The results obtained in this research place OMVs among promising candidates to be used for vaccination.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.22038/ijbms.2018.25886.6371DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5817172PMC
March 2018

The role of TonB-dependent copper receptor in virulence of Acinetobacter baumannii.

Infect Genet Evol 2018 06 21;60:181-190. Epub 2018 Mar 21.

Department of Biology, Shahed University, Tehran, Iran.

Acinetobacter baumannii is an opportunistic gram negative pathogen that can adhere to different surfaces and cause different nosocomial infections. To investigate the role of TonB-dependent copper receptor, an outer membrane protein, in virulence of A. baumannii, we deleted this receptor from A. baumannii chromosome. There was a significant decrease in biofilm formation by copper receptor deficient mutant strain. Similarly, the adherence to human epithelial cell and the hydrophobicity were declined. The survival rate of the mutant strain in human sera was reduced while no change was observed in motility of strains. In murine pneumonia model, the bacterial lethal dose 0 (LD), LD and LD were increased for mutant strain. Moreover, in vivo and in vitro experiments revealed changes in growth rate and dissemination of mutant strain; so that the bacterial load of the mutant was significantly reduced in the spleen and lung. The findings suggest a critical role for TonB-dependent copper receptor in virulence of A. baumannii.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.meegid.2018.03.001DOI Listing
June 2018

Synthetic peptides mimicking lipopolysaccharide as a potential vaccine candidates against serogroup O1.

Iran J Microbiol 2017 Aug;9(4):244-250

Department of Biology, Faculty of Basic Sciences, Shahed University, Tehran, Iran.

Background And Objectives: Cholera is a life-threatening diarrhea caused mainly by Gram-negative marine habitant serogroup O1. Cholera vaccination is limited mainly to developed countries, due to the cumbersome and expensive task of vaccine production. In the present work, the aim was to study the immunogenicity of the synthetic mimotopes through two different routes of injection and oral administration. Lipopolysaccharide (LPS) is one of the immunogenic components in Gram-negative bacteria, which cannot be used as a vaccine candidate, due to its high toxic effect.

Materials And Methods: Three phage-displayed selected peptides, with high affinity to anti-LPS VHH tested in our previous study, were chemically synthesized and used as a potential vaccine candidate. In order to enhance the antigenic properties and safe delivery, these peptides were conjugated to BSA as a carrier and encapsulated with PLGA. Peptides were injected intra-peritoneally or administered orally, alone or in combined form. Mice sera and feces were collected for assessment of humoral and mucosal antibody titers, respectively. ELISA plates were coated with mimotope conjugates and , and ETEC were used as target antigens. Antibody titer was measured by adding IgG and IgA as primary antibodies.

Results: Mice receiving three selected synthetic peptide conjugates (individually or in combination) showed higher antibody titer compared to control groups. The mice immunized with synthetic peptides were protected against more than 15 LD50 of

Conclusion: These peptides are mimicking LPS and can potentially act as vaccine candidates against
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5723977PMC
August 2017

Immunogenicity of Vibrio cholerae outer membrane vesicles secreted at various environmental conditions.

Vaccine 2018 01 27;36(2):322-330. Epub 2017 Nov 27.

Department of Biology, Shahed University, Tehran, Iran.

Cholera is caused by toxigenic Vibrio cholerae. It is a significant health problem and an important cause of mortality of children in developing countries. Annually, about 5-7 million people are being infected worldwide, leading to death of 100,000 to 120,000. Immunization using the currently available cholera vaccines has been recommended by World Health Organization (WHO) in areas where cholera is endemic or at risk of outbreaks. Gram-negative bacteria secrete outer membrane vesicles (OMVs) that play important roles in virulence and host-pathogen interaction. The content of protein and lipid in OMVs are affected by purification methods and bacterial growth condition. OMVs released from V. cholerae are an appropriate candidate for vaccine development. The protection conferred by a new vaccine candidate prepared using different methods and in two different growth conditions with nanoparticles in an experimental model of cholera in mice was investigated. OMVs were encapsulated in chitosan-tripolyphosphate (TPP) nanoparticles prepared by an ionic gelation method and coated with Eudragit as an enteric polymer. OMVs loaded into nanoparticles (NP-OMVs) were homogeneous and spherical in shape, with a size of 417nm. BALB/c mice (male, 20-24g) were immunized via intraperitoneal (10µg) or oral route (50µg) with free or encapsulated OMVs. Seventy-eight days after first administration, serum of mice was infected with infection dose of V. cholerae (≥10 CFU). The new vaccine was able to protect fully against infection when it was administered via mucosa. By intraperitoneal route, the unpolymerized OMVs increased the protection against these bacteria.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.vaccine.2017.09.004DOI Listing
January 2018

Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX

Iran Biomed J 2017 09 1;22(3):193-201. Epub 2018 May 1.

Max Planck Institute for Polymer Research, Mainz, Germany.

Background: Artificial oligonucleotides like DNA or RNA aptamers can be used as biodiagnostic alternatives for antibodies to detect pathogens. Comparing to antibodies, artificial oligonucleotides are produced easily at lower costs and are more stable. Neisseria meningitidis, the causative agent of meningitis, is responsible for about 1% of infections in an epidemic period. Specific DNA aptamers that bind to N. meningitidis serogroup B were identified by whole-cell Systemic Evolution of Ligands by EXponential Enrichment (SELEX).

Methods: The SELEX begins with a library of labeled ssDNA molecules. After six rounds of selection and two rounds of counter-selection, 60 clones were obtained, of which the binding efficiency of 21 aptamers to the aforementioned bacterium was tested by flow cytometry.

Results: The aptamers K3 and K4 showed the highest affinity to N. meningitidis serogroup B and no affinity to N. meningitidis serogroups Y, A, and C, or to other meningitis causing bacteria. The dissociation constant (Kd value) for K3 and K4 were calculated as 28.3±8.9 pM and 39.1±8.6 pM, respectively. K3 aptamer with the lowest Kd was chosen as the main aptamer. K3 could detect N. meningitidis in patients’ cerebrospinal fluid (CSF) samples and in CSF from healthy volunteers inoculated with N. meningitidis serogroup B (ATCC 13090) at 200 and 100 CFU ml-1, respectively.

Conclusion: The findings suggest the application of the developed aptamer in specific detection of N. meningitidis serogroup B amongst a group of meningitis causing bacteria.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5889504PMC
http://dx.doi.org/10.22034/ibj.22.3.193DOI Listing
September 2017

Identification and in vitro characterization of novel nanobodies against human granulocyte colony-stimulating factor receptor to provide inhibition of G-CSF function.

Biomed Pharmacother 2017 Sep 21;93:245-254. Epub 2017 Jun 21.

Department of Pharmaceutical Biotechnology and Pharmaceutical Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran, Iran. Electronic address:

It has been shown that Granulocyte colony-stimulating factor (G-CSF) has a higher expression in malignant tumors, and anti-G-CSF therapy considerably decreases tumor growth, tumor vascularization and metastasis. Thus, blocking the signaling pathway of G-CSF could be beneficial in cancer therapy. This study is aimed at designing and producing a monoclonal nanobody that could act as an antagonist of G-CSF receptor. Nanobodies are the antigen binding fragments of camelid single-chain antibodies, also known as VHH. These fragments have exceptional properties which makes them ideal for tumor imaging and therapeutic applications. We have used our previously built nanobody phage libraries to isolate specific nanobodies to the G-CSF receptor. After a series of cross-reactivity and affinity experiments, two unique nanobodies were selected for functional analysis. Proliferation assay, real-time PCR and immunofluorescence assays were used to characterize these nanobodies. Finally, VHH26 nanobody that was able to specifically bind G-CSF receptor (G-CSF-R) on the surface of NFS60 cells and efficiently block G-CSF-R downstream signaling pathway in a dose-dependent manner was selected. This nanobody could be further developed into a valuable tool in tumor therapy and it forms a basis for additional studies in preclinical animal models.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.biopha.2017.06.025DOI Listing
September 2017

Doxorubicin Loaded DNA Aptamer Linked Myristilated Chitosan Nanogel for Targeted Drug Delivery to Prostate Cancer.

Iran J Pharm Res 2017 ;16(1):35-49

Department of Biology, Science and research branch, Islamic Azad University, Tehran, Iran.

Recently, specific attention has been paid to aptamers, short DNA or RNA, as a tool for cancer diagnosis and therapy. In the present study MCS nanogels were prepared by Myristate: Chitosan at 1:9 ratio and were characterized by several techniques. A selected ssDNA aptamer (Apt) capable of detecting LNCaP cells was linked to Myristilated Chitosan nanogels (Apt-MCS) by glutaraldehyde and loaded with Doxorubicin (DOX) to be used in targeted drug delivery against the Prostate cancer cells. LNCaP and PC-3 cells were treated with Apt-MCS-DOX complex and the binding efficiency was estimated by flow cytometry. The binding affinity of the selected aptamers was above 70% compared to the initial library. The loading capacity of the nanogel was as high as 97% and up to 40% of DOX were released from MCS within 15 days. Cytotoxicity of nanodrug on LNCaP cells was determined by MTT assay. Apt-MCS-DOX was specifically binded to LNCaP cells whereas it didn't show any specificity to PC-3 cells as a negative control. Both MCS-DOX and Apt-MCS-DOX showed a lethal effect on LNCaP cells. Our results can lead to an aptamer based simple and applicable technique for early diagnosis and treatment of cancerous cells.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5423232PMC
January 2017

Efficient production of nanobodies against urease activity ofHelicobacter pylori in Pichia pastoris.

Turk J Med Sci 2017 Apr 18;47(2):695-701. Epub 2017 Apr 18.

Department of Biological Sciences, Faculty of Science, Imam Hossein University, Tehran, Iran.

Background/aim: Helicobacter pylori is a major health problem. One of the therapeutic approaches is administration of antibody against H. pylori. The methylotrophic Pichia pastoris is a suitable host for expression of recombinant antibody fragments. The aims of this study were the expression and the evaluation of camelid nanobody in the yeast Pichia pastoris.

Materials And Methods: The camelid-derived heavy-chain antibody (nanobody) against the UreC subunit of urease from H. pylori was subcloned in the pPink-HC shuttle vector and transferred into Escherichia coli TOP10. After digestion and purification, the shuttle vector was transformed in the PichiaPink expression system. The expression was evaluated in an in vitro system.

Results: The yield of the nanobody expressed in P. pastoris was estimated to be 5 mg/L as compared to 2 mg/L expressed by E. coli. The nanobody was purified and binding affinity to the UreC antigen was evaluated using ELISA. Neutralization abilities of the two nanobodies expressed in yeast and E. coli were compared. The yeast-expressed nanobody specifically detected recombinant UreC and inhibited urease activity with high efficiency.

Conclusion: The results suggest attribution of the enhanced quality and quantity of the nanobody produced in P. pastoris to better posttranslational modification and folding in the yeast cell.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3906/sag-1509-121DOI Listing
April 2017

Filamentous hemagglutinin adhesin FhaB limits biofilm formation.

Front Biosci (Elite Ed) 2017 03 1;9:266-275. Epub 2017 Mar 1.

Department of Biology, Shahed University, Opposite Imam Khomeini's Shrine, Tehran-Qom Express Way, Tehran, Iran, 3Molecular Microbiology Research Center, Shahed University, Tehran, Iran.

Increased resistance and survival, as well as immune evasion, play a significant role in the pathogenicity of . Here, we report on the adhesion of the bacterium to epithelial cells and formation of biofilm on abiotic surfaces. We identificed autotransporter (AT) genes that encode homologues (Fha-like) of the two-partner secretion system (TPS) in (ATCC19606) which we designate as FhaB (exoprotein) and FhaC (transporter) and demonstrate that these novel genes, are under the control of distinct regulatable promoters within either the same (FhaBC) or two distinct (FhaB and FhaC) cells. The expression of this gene in outer membrane protein (OM) showed them to be deficient in the adherence to A546 cells. FhaB is involved in hydrophobicity of ATCC19606 while FhaBC is associated with biofilm formation. The vaccinogenic potential of FHA-like proteins offers use of these targets as novel therapeutic strategies to limit associated morbidity and mortality.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2741/e801DOI Listing
March 2017

Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3.

Can J Microbiol 2017 Feb 14;63(2):160-168. Epub 2016 Oct 14.

b GENEXIR Biopharma, a knowledge-based company at Pasteur Institute of Iran Health Technology Park, Tehran, Iran.

Group A streptococcus (GAS) is an important Gram-positive pathogen that causes various human diseases ranging from peripheral lesions to invasive infections. The M protein is one of the main virulence factors present on the cell surface and is associated with invasive GAS infections. Compared with other M types, serotype M3 has a predominant role in lethal infections and demonstrates epidemic behaviors, including streptococcal toxic shock syndrome, bacteremia, and necrotizing fasciitis. Traditional methods for M typing are time-consuming, tedious, contradictory, and generally restricted to reference laboratories. Therefore, development of a new M-typing technique is needed. Aptamers with the ability to detect their target with a high degree of accuracy and specificity can be ideal candidates for specific M-typing of Streptococcus pyogenes. In this study DNA aptamers with a high binding affinity towards S. pyogenes serotype M3 were selected through 12 iterative rounds of the Systematic Evolution of Ligands by EXponential (SELEX) enrichment procedure using live cells as a target. We monitored the progress of the SELEX procedure by flow cytometry analysis. Of several aptamer sequences analyzed, 12L18A showed the highest binding efficiency towards S. pyogenes type M3, with an apparent dissociation constant (K) of 7.47 ± 1.72 pmol/L being the lowest. Therefore the isolated aptamer can be used in any tool, such as a biosensor, for the detection of S. pyogenes and can be used in the development of a novel M-typing system.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1139/cjm-2016-0495DOI Listing
February 2017

Development of lipopolysaccharide-mimicking peptides and their immunoprotectivity against Vibrio cholerae serogroup O1.

J Pept Sci 2016 Nov 21;22(11-12):682-688. Epub 2016 Oct 21.

Department of Biology, Shahed University, Tehran, Iran.

Vibrio cholerae serogroup O1 is the main causative agent of cholera diseases defined by life threatening rice watery diarrhea. Cholera routine vaccination has failed in controlling epidemics in developing countries because of their hard and expensive production. In this study, our aim was to investigate phage displayed mimotopes that could mimic V. cholerae lipopolysaccharide (LPS). Although LPS of Vibrio, as an endotoxin, can stimulate the immune system, thereby making it a suitable candidate for cholera vaccine, its toxicity remains as a main problem. Phage particles displaying 12 amino acid peptides were selected from phage library mimicking the antigenic epitopes of LPS from vibrio. The screening was carried out using single-domain antibody fragment VHH against LPS as target through three rounds of selection. Three clones with highest affinity to VHH were selected. To find out a new and efficient vaccine against cholera, these three phage particles containing high-affinity peptides were administered to mice to investigate the active and passive immunity. Out of 20 particles, three showed the highest affinity toward VHH. ELISA was carried out with immunized mice sera using LPS and three selected phages particles individually. ETEC, Shigella sonnei, and clinical isolates were used as bacterial targets. These three selected phages (individually or in combination) could stimulate mice immune system producing active and passive immunity. The mice immunized with phage particles could protect about 14 LD50 of V. cholerae. In conclusion, these peptides are mimicking LPS and can potentially act as vaccine candidates against V. cholerae. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/psc.2930DOI Listing
November 2016