Publications by authors named "Seong K Kim"

33 Publications

GC-like Graphene-Coated Quartz Crystal Microbalance Sensor with Microcolumns.

ACS Appl Mater Interfaces 2021 Jan 13;13(3):4703-4710. Epub 2021 Jan 13.

Thin Film Materials Research Center, Korea Research Institute of Chemical Technology (KRICT), Daejeon 305-600, Republic of Korea.

Many research groups have been interested in the quartz crystal microbalance (QCM)-based gas sensors due to their superb sensitivity originated from direct mass sensing at the ng level. Despite such high sensitivities observed from QCM sensors, their ability to identify gas compounds still needs to be enhanced. Herein, we report a highly facile method that utilizes microcolumns integrated on a QCM gas-responsive system with enhanced chemical selectivity for sensing and ability to identify volatile organic compound single gases. Graphene oxide (GO) flakes are coated on the QCM electrode to substantially increase the adsorption of gas molecules, and periodic polydimethylsiloxane microcolumns with micrometer-scale width and height were installed on the GO-coated QCM electrode. The observed frequency shifts upon sensing of various single gas molecules (such as ethanol, acetone, hexane, etc.) can be analyzed accurately using a simple exponential model. The QCM sensor system with and without the microcolumn both exhibited high detection response values above 50 ng/cm for sensing of the gases. Notably, the QCM sensor equipped with the microcolumn features gas identification ability, which is observed as distinct diverging behavior of time constants upon detection of different gases caused by the difference in diffusional transfer of molecules through the microcolumns. For example, the difference in the calculated time constant between ethanol and acetone increased from 22.6 to 92.1 s after installation of the microcolumn. This approach provides an easy and efficient method for identification of single gases, and it may be applied in various advanced sensor systems to enhance their gas selectivity.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsami.0c19010DOI Listing
January 2021

Correction for Shakya et al., "Interferon Gamma Inhibits Varicella-Zoster Virus Replication in a Cell Line-Dependent Manner".

J Virol 2020 Mar 17;94(7). Epub 2020 Mar 17.

Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, Shreveport, Louisiana, USA

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1128/JVI.02138-19DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7081888PMC
March 2020

Proton Conducting Perhydropolysilazane-Derived Gate Dielectric for Solution-Processed Metal Oxide-Based Thin-Film Transistors.

ACS Appl Mater Interfaces 2020 Apr 18;12(13):15396-15405. Epub 2020 Mar 18.

Division of Advanced Materials, Korea Research Institute of Chemical Technology, 141 Gajeong-ro, Yuseong-gu, Daejeon 34114, Republic of Korea.

Perhydropolysilazane (PHPS), an inorganic polymer composed of Si-N and Si-H, has attracted much attention as a precursor for gate dielectrics of thin-film transistors (TFTs) due to its facile processing even at a relatively low temperature. However, an in-depth understanding of the tunable dielectric behavior of PHPS-derived dielectrics and their effects on TFT device performance is still lacking. In this study, the PHPS-derived dielectric films formed at different annealing temperatures have been used as the gate dielectric layer for solution-processed indium zinc oxide (IZO) TFTs. Notably, the IZO TFTs fabricated on PHPS annealed at 350 °C exhibit mobility as high as 118 cm V s, which is about 50 times the IZO TFTs made on typical SiO dielectrics. The outstanding electrical performance is possible because of the exceptional capacitance of PHPS-derived dielectric caused by the limited hydrolysis reaction of PHPS at a low processing temperature (<400 °C). According to our analysis, the exceptional dielectric behavior is originated from the electric double layer formed by mobile of protons in the low temperature-annealed PHPS dielectrics. Furthermore, proton conduction through the PHPS dielectric occurs through a three-dimensional pathway by a hopping mechanism, which allows uniform polarization of the dielectric even at room temperature, leading to amplified performance of the IZO TFTs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsami.0c01274DOI Listing
April 2020

Recyclable High-Performance Polymer Electrolyte Based on a Modified Methyl Cellulose-Lithium Trifluoromethanesulfonate Salt Composite for Sustainable Energy Systems.

ChemSusChem 2020 Jan 13;13(2):376-384. Epub 2019 Dec 13.

Thin Film Materials Research Center, Korea Research Institute of Chemical Technology, Yuseong Post Office Box 107, Daejeon, 34114, Korea.

Although energy-storage devices based on Li ions are considered as the most prominent candidates for immediate application in the near future, concerns with regard to their stability, safety, and environmental impact still remain. As a solution, the development of all-solid-state energy-storage devices with enhanced stability is proposed. A new eco-friendly polymer electrolyte has been synthesized by incorporating lithium trifluoromethanesulfonate into chemically modified methyl cellulose (LiTFS-LiSMC). The transparent and flexible electrolyte exhibits a good conductivity of near 1 mS cm . An all-solid-state supercapacitor fabricated from 20 wt % LiTFS-LiSMC shows comparable specific capacitances to a standard liquid-electrolyte supercapacitor and an excellent stability even after 20 000 charge-discharge cycles. The electrolyte is also compatible with patterned carbon, which enables the simple fabrication of micro-supercapacitors. In addition, the LiTFS-LiSMC electrolyte can be recycled and reused more than 20 times with negligible change in its performance. Thus, it is a promising material for sustainable energy-storage devices.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/cssc.201902756DOI Listing
January 2020

Intranasal treatment with CpG-B oligodeoxynucleotides protects CBA mice from lethal equine herpesvirus 1 challenge by an innate immune response.

Antiviral Res 2019 09 25;169:104546. Epub 2019 Jun 25.

Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA, 71130-3932, USA.

Equine herpesvirus 1 (EHV-1) is the causative agent of a number of equine disease manifestations, including severe disease of the central nervous system, respiratory infections, and abortion storms. Our results showed that intranasal treatment with CpG-B oligodeoxynucleotides (ODN 1826) protected CBA mice from pathogenic EHV-1 RacL11 challenge. The IFN-γ gene and seven interferon-stimulated genes (ISGs) were upregulated 39.4- to 260.3-fold at 8 h postchallenge in the lungs of RacL11-challenged mice that had been treated with CpG-B ODN. Interestingly, IFN-γ gene expression was upregulated by 26-fold upon RacL11 challenge in CpG-B ODN-treated mice lungs as compared to that of CpG-A ODN (ODN 1585)-treated mice lungs; however, the seven ISGs were upregulated by 2.4-5.0-fold, suggesting that IFN-γ is a major factor in the protection of CBA mice from the lethal challenge. Pre-treatment with IFN-γ significantly reduced EHV-1 yield in murine alveolar macrophage MH-S cells, but not in mouse lung epithelial MLE12 cells. These results suggest that CpG-B ODN may be used as a prophylactic agent in horses and provide a basis for more effective treatment of EHV-1 infection.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.antiviral.2019.104546DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6699901PMC
September 2019

Interferon Gamma Inhibits Varicella-Zoster Virus Replication in a Cell Line-Dependent Manner.

J Virol 2019 06 29;93(12). Epub 2019 May 29.

Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, Shreveport, Louisiana, USA

The major immediate early 62 (IE62) protein of varicella-zoster virus (VZV) is delivered to newly infected cell nuclei, where it initiates VZV replication by transactivating viral immediate early (IE), early (E), and late (L) genes. Interferon gamma (IFN-γ) is a potent cytokine produced following primary VZV infection. Furthermore, VZV reactivation correlates with a decline in IFN-γ-producing immune cells. Our results showed that treatment with 20 ng/ml of IFN-γ completely reduced intracellular VZV yield in A549 lung epithelial cells, MRC-5 lung fibroblasts, and ARPE-19 retinal epithelial cells at 4 days post-VZV infection. However, IFN-γ reduced virus yield only 2-fold in MeWo melanoma cells compared to that of untreated cells. IFN-β significantly inhibited VZV replication in both ARPE-19 and MeWo cells. In luciferase assays with VZV open reading frame 61 (ORF61) promoter reporter plasmid, IFN-γ abrogated the transactivation activity of IE62 by 95%, 97%, and 89% in A549, ARPE-19, and MRC-5 cells, respectively. However, IFN-γ abrogated IE62's transactivation activity by 16% in MeWo cells, indicating that IFN-γ inhibits VZV replication as well as IE62-mediated transactivation in a cell line-dependent manner. The expression of VZV IE62 and ORF63 suppressed by IFN-γ was restored by JAK1 inhibitor treatment, indicating that the inhibition of VZV replication is mediated by JAK/STAT1 signaling. In the presence of IFN-γ, knockdown of interferon response factor 1 (IRF1) increased VZV replication. Ectopic expression of IRF1 reduced VZV yields 4,000-fold in MRC-5 and ARPE-19 cells but 3-fold in MeWo cells. These results suggest that IFN-γ blocks VZV replication by inhibiting IE62 function in a cell line-dependent manner. Our results showed that IFN-γ significantly inhibited VZV replication in a cell line-dependent manner. IFN-γ inhibited VZV gene expression after the immediate early stage of infection and abrogated IE62-mediated transactivation. These results suggest that IFN-γ blocks VZV replication by inhibiting IE62 function in a cell line-dependent manner. Understanding the mechanisms by which IFN-γ plays a role in VZV gene programming may be important in determining the tissue restriction of VZV.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1128/JVI.00257-19DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6613748PMC
June 2019

Comparative Genomic Sequencing and Pathogenic Properties of Equine Herpesvirus 1 KyA and RacL11.

Front Vet Sci 2017 11;4:211. Epub 2017 Dec 11.

Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA, United States.

Equine herpesvirus 1 (EHV-1) is a major pathogen affecting equines worldwide. The virus causes respiratory disease, abortion, and, in some cases, neurological disease. EHV-1 Kentucky A (KyA) is attenuated in the mouse and equine, whereas wild-type pathogenic strain RacL11 induces severe inflammatory infiltration of the lung, causing infected mice to succumb. The complete DNA sequencing of the KyA genome revealed that genes UL17 (ORF17), US6 (ORF73; gI), US7 (ORF74; gE), and US8 (ORF75; 10 K) are deleted as compared to the RacL11 and Ab4 genomes. In-frame deletions in the US1 (ORF68), US4 (ORF71; gp2), and UL63 (ORF63; EICP0) genes and point mutations in 14 different open reading frames (ORFs) were detected in the KyA genome. Interestingly, UL1 (ORF1) and UL2 (ORF2) were deleted in both KyA and RacL11. Our previous studies showed that EHV-1 glycoproteins gI, gE, and full-length gp2 contribute to the pathogenesis of the RacL11 strain. The confirmation of these gene deletions in KyA suggests their contribution to the attenuation of this virus. The growth kinetics results revealed that KyA replicates to high titers in cell culture as compared to RacL11 and Ab4, indicating that the above genomic deletions and mutations in KyA do not have an inhibitory effect on KyA replication in cells of mouse, rabbit, equine, or human origin. Studies of EHV-1 pathogenesis in CBA mice showed that KyA is attenuated whereas mice infected with RacL11 succumbed by 3-6 days post-infection, which is consistent with our previous results.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fvets.2017.00211DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5732242PMC
December 2017

AC-Impedance Spectroscopic Analysis on the Charge Transport in CVD-Grown Graphene Devices with Chemically Modified Substrates.

ACS Appl Mater Interfaces 2016 Oct 5;8(41):27421-27425. Epub 2016 Oct 5.

Thin Film Materials Research Center, Korea Research Institute of Chemical Technology (KRICT) , Yuseong, Daejeon 305-600, Republic of Korea.

A comprehensive study for the effect of interfacial buffer layers on the electrical transport behavior in CVD-grown graphene based devices has been performed by ac-impedance spectroscopy (IS) analysis. We examine the effects of the trap charges at graphene/SiO interface on the total capacitance by introducing self-assembled monolayers (SAMs). Furthermore, the charge transports in the polycrystalline graphene are characterized through the temperature-dependent IS measurement, which can be explained by the potential barrier model. The frequency-dependent conduction reveals that the conductivity of graphene is related with the mobility, which is limited by the scattering caused by charged adsorbates on SiO surface.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsami.6b03705DOI Listing
October 2016

Immunization with Attenuated Equine Herpesvirus 1 Strain KyA Induces Innate Immune Responses That Protect Mice from Lethal Challenge.

J Virol 2016 09 26;90(18):8090-104. Epub 2016 Aug 26.

Department of Microbiology and Immunology and Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, Louisiana, USA.

Unlabelled: Equine herpesvirus 1 (EHV-1) is a major pathogen affecting equines worldwide. The virus causes respiratory disease, abortion, and, in some cases, neurological disease. EHV-1 strain KyA is attenuated in the mouse and equine, whereas wild-type strain RacL11 induces severe inflammation of the lung, causing infected mice to succumb at 4 to 6 days postinfection. Our previous results showed that KyA immunization protected CBA mice from pathogenic RacL11 challenge at 2 and 4 weeks postimmunization and that KyA infection elicited protective humoral and cell-mediated immune responses. To investigate the protective mechanisms of innate immune responses to KyA, KyA-immunized mice were challenged with RacL11 at various times postvaccination. KyA immunization protected mice from RacL11 challenge at 1 to 7 days postimmunization. Immunized mice lost less than 10% of their body weight and rapidly regained weight. Virus titers in the lungs of KyA-immunized mice were 1,000-fold lower at 2 days post-RacL11 challenge than virus titers in the lungs of nonimmunized mice, indicating accelerated virus clearance. Affymetrix microarray analysis revealed that gamma interferon (IFN-γ) and 16 antiviral interferon-stimulated genes (ISGs) were upregulated 3.1- to 48.2-fold at 8 h postchallenge in the lungs of RacL11-challenged mice that had been immunized with KyA. Murine IFN-γ inhibited EHV-1 infection of murine alveolar macrophages and protected mice against lethal EHV-1 challenge, suggesting that IFN-γ expression is important in mediating the protection elicited by KyA immunization. These results suggest that EHV-1 KyA may be used as a live attenuated EHV-1 vaccine as well as a prophylactic agent in horses.

Importance: Viral infection of cells initiates a signal cascade of events that ultimately attempts to limit viral replication and prevent infection through the expression of host antiviral proteins. In this study, we show that EHV-1 KyA immunization effectively protected CBA mice from pathogenic RacL11 challenge at 1 to 7 days postvaccination and increased the expression of IFN-γ and 16 antiviral interferon-stimulated genes (ISGs). The administration of IFN-γ blocked EHV-1 replication in murine alveolar macrophages and mouse lungs and protected mice from lethal challenge. To our knowledge, this is the first report of an attenuated EHV-1 vaccine that protects the animal at 1 to 7 days postimmunization by innate immune responses. Our findings suggested that IFN-γ serves as a novel prophylactic agent and may offer new strategies for the development of anti-EHV-1 agents in the equine.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1128/JVI.00986-16DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5008086PMC
September 2016

On determining the height of the potential barrier at grain boundaries in ion-conducting oxides.

Phys Chem Chem Phys 2016 Jan;18(4):3023-31

Department of Materials and Interfaces, Weizmann Institute of Science, Rehovot 76100, Israel.

The validity and limitations of two quantitative approaches for estimating the height of the potential barrier at grain boundaries, Ψgb, in polycrystalline ionic conductors are examined both theoretically and experimentally. The linear diffusion model recently proposed by Kim and Lubomirsky determines Ψgb from the value of the power exponent of the current (Igb)-voltage (Ugb) relationship at the grain boundary, dln(Igb)/dln(Ugb), while the conventional approach calculates Ψgb from the ratio of the grain boundary resistivity to the grain core resistivity. The results of our theoretical analysis demonstrate that both approaches should yield consistent values for Ψgb if the ionic current through the grain boundary is limited exclusively by space charge. While the value of Ψgb obtained by the power law procedure is relatively insensitive to other causes of current obstruction, e.g. current constriction and/or local structural disorder, the resistivity ratio method, if not explicitly corrected for these additional limitations, results in a considerable overestimate of the grain boundary potential barrier. Hence, it is possible to distinguish between grain boundary resistance due to the presence of space charge and that due to additional sources by comparing the values of Ψgb determined using each of the two methods. Our theoretical analysis is confirmed experimentally with 3 mol% Gd-doped ceria with and without an additional source of current constriction across the grain boundary.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1039/c5cp06387fDOI Listing
January 2016

Carbon dioxide is tightly bound in the [Co(Pyridine)(CO2)](-) anionic complex.

J Chem Phys 2015 Nov;143(18):184315

Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21218, USA.

The [Co(Pyridine)(CO2)](-) anionic complex was studied through the combination of photoelectron spectroscopy and density functional theory calculations. This complex was envisioned as a primitive model system for studying CO2 binding to negatively charged sites in metal organic frameworks. The vertical detachment energy (VDE) measured via the photoelectron spectrum is 2.7 eV. Our calculations imply a structure for [Co(Pyridine)(CO2)](-) in which a central cobalt atom is bound to pyridine and CO2 moieties on either sides. This structure was validated by acceptable agreement between the calculated and measured VDE values. Based on our calculations, we found CO2 to be bound within the anionic complex by 1.4 eV.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1063/1.4935573DOI Listing
November 2015

Photoelectron spectroscopic and computational study of (M-CO2)(-) anions, M = Cu, Ag, Au.

J Chem Phys 2015 Nov;143(17):174305

Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21218, USA.

In a combined photoelectron spectroscopic and computational study of (M-CO2)(-), M = Au, Ag, Cu, anionic complexes, we show that (Au-CO2)(-) forms both the chemisorbed and physisorbed isomers, AuCO2(-) and Au(-)(CO2), respectively; that (Ag-CO2)(-) forms only the physisorbed isomer, Ag(-)(CO2); and that (Cu-CO2)(-) forms only the chemisorbed isomer, CuCO2(-). The two chemisorbed complexes, AuCO2(-) and CuCO2(-), are covalently bound, formate-like anions, in which their CO2 moieties are significantly reduced. These two species are examples of electron-induced CO2 activation. The two physisorbed complexes, Au(-)(CO2) and Ag(-)(CO2), are electrostatically and thus weakly bound.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1063/1.4935061DOI Listing
November 2015

Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

Virus Res 2016 Jan 2;211:222-32. Epub 2015 Nov 2.

Department of Microbiology and Immunology, and Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932, United States.

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS).
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.virusres.2015.10.026DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4692279PMC
January 2016

Functional Characterization of the Serine-Rich Tract of Varicella-Zoster Virus IE62.

J Virol 2016 01 4;90(2):959-71. Epub 2015 Nov 4.

Department of Microbiology and Immunology, and Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, Louisiana, USA.

Unlabelled: The immediate early 62 protein (IE62) of varicella-zoster virus (VZV), a major viral trans-activator, initiates the virus life cycle and is a key component of pathogenesis. The IE62 possesses several domains essential for trans-activation, including an acidic trans-activation domain (TAD), a serine-rich tract (SRT), and binding domains for USF, TFIIB, and TATA box binding protein (TBP). Transient-transfection assays showed that the VZV IE62 lacking the SRT trans-activated the early VZV ORF61 promoter at only 16% of the level of the full-length IE62. When the SRT of IE62 was replaced with the SRT of equine herpesvirus 1 (EHV-1) IEP, its trans-activation activity was completely restored. Herpes simplex virus 1 (HSV-1) ICP4 that lacks a TAD very weakly (1.5-fold) trans-activated the ORF61 promoter. An IE62 TAD-ICP4 chimeric protein exhibited trans-activation ability (10.2-fold), indicating that the IE62 TAD functions with the SRT of HSV-1 ICP4 to trans-activate viral promoters. When the serine and acidic residues of the SRT were replaced with Ala, Leu, and Gly, trans-activation activities of the modified IE62 proteins IE62-SRTΔSe and IE62-SRTΔAc were reduced to 46% and 29% of wild-type activity, respectively. Bimolecular complementation assays showed that the TAD of IE62, EHV-1 IEP, and HSV-1 VP16 interacted with Mediator 25 in human melanoma MeWo cells. The SRT of IE62 interacted with the nucleolar-ribosomal protein EAP, which resulted in the formation of globular structures within the nucleus. These results suggest that the SRT plays an important role in VZV viral gene expression and replication.

Importance: The immediate early 62 protein (IE62) of varicella-zoster virus (VZV) is a major viral trans-activator and is essential for viral growth. Our data show that the serine-rich tract (SRT) of VZV IE62, which is well conserved within the alphaherpesviruses, is needed for trans-activation mediated by the acidic trans-activation domain (TAD). The TADs of IE62, EHV-1 IEP, and HSV-1 VP16 interacted with cellular Mediator 25 in bimolecular complementation assays. The interaction of the IE62 SRT with nucleolar-ribosomal protein EAP resulted in the formation of globular structures within the nucleus. Understanding the mechanisms by which the TAD and SRT of IE62 contribute to the function of this essential regulatory protein is important in understanding the gene program of this human pathogen.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1128/JVI.02096-15DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4702665PMC
January 2016

Electrical Double Layer Capacitance in a Graphene-embedded Al2O3 Gate Dielectric.

Sci Rep 2015 Nov 4;5:16001. Epub 2015 Nov 4.

Thin Film Materials Research Center, Korea Research Institute of Chemical Technology (KRICT), Yuseong P. O. Box 107, Daejeon 305-600, Republic of Korea.

Graphene heterostructures are of considerable interest as a new class of electronic devices with exceptional performance in a broad range of applications has been realized. Here, we propose a graphene-embedded Al2O3 gate dielectric with a relatively high dielectric constant of 15.5, which is about 2 times that of Al2O3, having a low leakage current with insertion of tri-layer graphene. In this system, the enhanced capacitance of the hybrid structure can be understood by the formation of a space charge layer at the graphene/Al2O3 interface. The electrical properties of the interface can be further explained by the electrical double layer (EDL) model dominated by the diffuse layer.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/srep16001DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4632157PMC
November 2015

Direct Determination of Field Emission across the Heterojunctions in a ZnO/Graphene Thin-Film Barristor.

ACS Appl Mater Interfaces 2015 Aug 13;7(33):18300-5. Epub 2015 Aug 13.

Department of Chemical Engineering and Materials Science, University of California , Davis, California 95616-5294, United States.

Graphene barristors are a novel type of electronic switching device with excellent performance, which surpass the low on-off ratios that limit the operation of conventional graphene transistors. In barristors, a gate bias is used to vary graphene's Fermi level, which in turn controls the height and resistance of a Schottky barrier at a graphene/semiconductor heterojunction. Here we demonstrate that the switching characteristic of a thin-film ZnO/graphene device with simple geometry results from tunneling current across the Schottky barriers formed at the ZnO/graphene heterojunctions. Direct characterization of the current-voltage-temperature relationship of the heterojunctions by ac-impedance spectroscopy reveals that this relationship is controlled predominantly by field emission, unlike most graphene barristors in which thermionic emission is observed. This governing mechanism makes the device unique among graphene barristors, while also having the advantages of simple fabrication and outstanding performance.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsami.5b03380DOI Listing
August 2015

CO2 binding in the (quinoline-CO2)(-) anionic complex.

J Chem Phys 2015 Jun;142(23):234307

Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21218, USA.

We have studied the (quinoline-CO2)(-) anionic complex by a combination of mass spectrometry, anion photoelectron spectroscopy, and density functional theory calculations. The (quinoline-CO2)(-) anionic complex has much in common with previously studied (N-heterocycle-CO2)(-) anionic complexes both in terms of geometric structure and covalent bonding character. Unlike the previously studied N-heterocycles, however, quinoline has a positive electron affinity, and this provided a pathway for determining the binding energy of CO2 in the (quinoline-CO2)(-) anionic complex. From the theoretical calculations, we found CO2 to be bound within the (quinoline-CO2)(-) anionic complex by 0.6 eV. We also showed that the excess electron is delocalized over the entire molecular framework. It is likely that the CO2 binding energies and excess electron delocalization profiles of the previously studied (N-heterocycle-CO2)(-) anionic complexes are quite similar to that of the (quinoline-CO2)(-) anionic complex. This class of complexes may have a role to play in CO2 activation and/or sequestration.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1063/1.4922652DOI Listing
June 2015

A linear diffusion model for ion current across blocking grain boundaries in oxygen-ion and proton conductors.

Phys Chem Chem Phys 2014 Jul;16(28):14961-8

Department of Chemical Engineering and Materials Science, University of California, Davis, CA 95616, USA.

We demonstrate the applicability of the linear diffusion model recently proposed for the current-voltage, Igb-Ugb, characteristics of blocking grain boundaries in solid electrolytes to various oxygen-ion and proton conductors: the model precisely reproduces the Igb-Ugb characteristics of La-, Sm-, Gd-, and Y-doped ceria as well as Y-doped barium zirconate to provide accurate explanations to the "power law" behavior of the Igb-Ugb relationship, i.e. Igb ∝ Ugb(n), experimentally observed. The model also predicts that the grain-boundary potential, Ψgb, in doped ceria weakly depends on temperature, if the trapped charge remains constant, and that the value of Ψgb can be determined from the value of the power n. Furthermore, the model provides a plausible explanation for the increase in the Ψgb with temperature observed for the proton conductor in which the concentration of the charge carrier decreases with temperature. Hence, it is evident that the linear diffusion model is robust and applicable to grain boundaries in a large variety of practically important solid electrolytes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1039/c4cp01254bDOI Listing
July 2014

The EHV-1 UL4 protein that tempers viral gene expression interacts with cellular transcription factors.

Virology 2014 Jan 21;449:25-34. Epub 2013 Nov 21.

Center for Molecular and Tumor Virology, Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, Shreveport, LA 71130-3932, USA. Electronic address:

The UL4 gene is conserved within the genome of defective interfering particles of equine herpesvirus type 1 (EHV-1) that mediate persistent infection. Here, we show that the UL4 protein inhibits EHV-1 reporter gene expression by decreasing the level of transcribed mRNA. The UL4 protein did not bind any gene class of EHV-1 promoters in electromobility or chromatin immunoprecipitation assays, but directly interacted with the TATA box-binding protein (TBP) and the carboxy-terminal domain of RNA polymerase II both in vitro (GST-pulldown assays) and in infected cells (coimmunoprecipitation analyses). Microarray analyses of the expression of the 78 EHV-1 genes revealed that viral late genes important for virion assembly displayed enhanced expression in cells infected with UL4-null virus as compared to wild-type or UL4-restored EHV-1. Quantitative PCR analyses showed that viral DNA replication was not retarded in cells infected with the UL4-null virus as compared to wild-type EHV-1.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.virol.2013.11.005DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6699183PMC
January 2014

How to interpret current-voltage relationships of blocking grain boundaries in oxygen ionic conductors.

Phys Chem Chem Phys 2013 Jun 2;15(22):8716-21. Epub 2013 May 2.

Department of Chemical Engineering and Materials Science, University of California, Davis, CA 95616, USA.

A new model based on a linear diffusion equation is proposed to explain the current-voltage characteristics of blocking grain boundaries in Y-doped CeO2 in particular. One can also expect that the model can be applicable to the ionic conductors with blocking grain boundaries, in general. The model considers an infinitely long chain of identical grains separated by grain boundaries, which are treated as regions in which depletion layers of mobile ions are formed due to trapping of immobile charges that do not depend on the applied voltage as well as temperature. The model assumes that (1) the grain boundaries do not represent physical blocking layers, which implies that if there is a second phase at the grain boundaries, then it is too thin to impede ion diffusion and (2) the ions follow Boltzmann distribution throughout the materials. Despite its simplicity, the model successfully reproduces the "power law": current proportional to voltage power n and illustrated with the experimental example of Y-doped ceria. The model also correctly predicts that the product nT, where T is the temperature in K, is constant and is proportional to the grain boundary potential as long as the charge at the grain boundaries remains trapped. The latter allows its direct determination from the current-voltage characteristics and promises considerable simplification in the analysis of the electrical characteristics of the grain boundaries with respect to the models currently in use.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1039/c3cp00145hDOI Listing
June 2013

Development of a bacterial artificial chromosome (BAC) recombineering procedure using galK-untranslated region (UTR) for the mutation of diploid genes.

J Virol Methods 2012 Jun 8;182(1-2):18-26. Epub 2012 Mar 8.

Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932, United States.

Bacterial artificial chromosome (BAC) recombineering using galK selection allows DNA cloned in Escherichia coli to be modified without introducing an unwanted selectable marker at the modification site. Genomes of some herpesviruses have a pair of inverted repeat sequences that makes it very difficult to introduce mutations into diploid (duplicate) genes using the galK selection method. To mutate diploid genes, we developed a galK-UTR BAC recombineering procedure that blocks one copy of the target diploid gene by insertion of a galK untranslated region (UTR), which enables the simple mutation of the other copy. The blocked copy can then be replaced with an UTR-specific primer pair. The IR2 gene of equine herpesvirus 1 (EHV-1) maps within both the internal (IR) and terminal repeat (TR) of the genomic short region and is expressed at low levels because its promoter is TATA-less. Both IR2 promoters in EHV-1 BAC were replaced with a mutant IR2 promoter containing three Sp1-binding motifs and a consensus TATA box by galK-UTR BAC recombineering. The expression level of the IR2 protein controlled by the modified promoter increased approximately 4-fold as compared to that of wild-type EHV-1. The galK-UTR method will provide a useful tool in studies of herpesviruses.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jviromet.2012.02.010DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3388943PMC
June 2012

Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication.

Virology 2011 Sep 26;417(2):430-42. Epub 2011 Jul 26.

Department of Microbiology and Immunology, and Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, Louisiana LA 71130-3932, USA.

The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% of control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.virol.2011.06.023DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3388945PMC
September 2011

Biological and genotypic properties of defective interfering particles of equine herpesvirus 1 that mediate persistent infection.

Virology 2008 Nov 20;381(1):98-105. Epub 2008 Sep 20.

Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, LSU Health Sciences Center, 1501 Kings Hwy, Shreveport, LA 71130-3932, USA.

Infection with equine herpesvirus 1 (EHV-1) preparations enriched for defective interfering particles (DIP) leads to a state of persistent infection in which infected cells become lysis resistant and release both infectious (standard) virus and DIP. EHV-1 DIP are unique in that the recombination events that generate DIP genomes produce new open reading frames (ORFs; Hyb1.0 and Hyb2.0) consisting of 5' sequences of varying lengths of the early regulatory gene IR4 fused to 3' sequences of varying lengths of the UL5 regulatory gene. Only two additional ORFs (UL3 and UL4) are conserved. Because persistently infected cells release a heterogeneous mixture of DIP, characterization of the elements responsible for this altered state of infection has proved difficult. Here we describe a method for studying persistent infection using recombinant DIP (rDIP). Infection with rDIP resulted in the production of recombinant DIP that replicated faithfully to, at least, five passages and mediated a rapid progression to persistent infection as measured by: 1) production of cells resistant to lysis by the standard virus; and 2) infected cells that released both standard virus and DIP. High concentrations of rDIP also resulted in interference with the standard virus replication, another hallmark of persistent infection. rDIP deleted of UL3, UL4, and either Hyb gene, the only functional genes conserved in the DIP genome, replicated but exhibited markedly reduced ability to interfere with standard virus replication. Restoring only the Hyb genes (either Hyb1.0 or Hyb2.0), the IR4 gene, or specific portions of the IR4 gene restored interference. These data suggest that residues 144 to 196 of the IR4 protein within the HYB proteins are important for DIP interference and that persistent infection results from recombination events that produce DIP genomes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.virol.2008.08.024DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2636567PMC
November 2008

The equine herpesvirus-1 IR3 gene that lies antisense to the sole immediate-early (IE) gene is trans-activated by the IE protein, and is poorly expressed to a protein.

Virology 2007 Jun 15;363(1):15-25. Epub 2007 Feb 15.

Center for Molecular and Tumor Virology, Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, PO Box 33932, Shreveport, LA 71130-3932, USA.

The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5'untranslated region (UTR), a 285 base pair open reading frame (ORF), and a poly adenylation (A) signal [Holden, V.R., Harty, R.N., Yalamanchili, R.R., O'Callaghan, D.J., 1992. The IR3 gene of equine herpesvirus type 1: a unique gene regulated by sequences within the intron of the immediate-early gene. DNA Seq. 3, 143-152]. Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.virol.2007.01.024DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1939811PMC
June 2007

The unique IR2 protein of equine herpesvirus 1 negatively regulates viral gene expression.

J Virol 2006 May;80(10):5041-9

Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932, USA.

The IR2 protein (IR2P) is a truncated form of the immediate-early protein (IEP) lacking the essential acidic transcriptional activation domain (TAD) and serine-rich tract and yet retaining binding domains for DNA and TFIIB and nuclear localization signal (NLS). Analysis of the IR2 promoter indicated that the IR2 promoter was upregulated by the EICP0P. The IR2P was first detected in the nucleus at 5 h postinfection in equine herpesvirus 1 (EHV-1)-infected HeLa and equine NBL6 cells. Transient-transfection assays revealed that (i) the IR2P by itself downregulated EHV-1 early promoters (EICP0, TK, EICP22, and EICP27) in a dose-dependent manner; (ii) the IR2P abrogated the IEP and the EICP27P (UL5) mediated transactivation of viral promoters in a dose-dependent manner; and (iii) the IR2P, like the IEP itself, also downregulated the IE promoter, indicating that the IEP TAD is not necessary to downregulate the IE promoter. In vitro interaction assays revealed that the IR2P interacts with TATA box-binding protein (TBP). The essential domain(s) of the IR2P that mediate negative regulation were mapped to amino acid residues 1 to 706, indicating that the DNA-binding domain and the NLS of the IR2P may be important for the downregulation. In transient-transfection and virus growth assays, the IR2P reduced EHV-1 production by 23-fold compared to virus titers achieved in cells transfected with the empty vector. Overall, these studies suggest that the IR2P downregulates viral gene expression by acting as a dominant-negative protein that blocks IEP-binding to viral promoters and/or squelching the limited supplies of TFIIB and TBP.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1128/JVI.80.10.5041-5049.2006DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1472049PMC
May 2006

Initial characterization of 17 viruses harboring mutant forms of the immediate-early gene of equine herpesvirus 1.

Virus Genes 2005 Oct;31(2):229-39

Department of Microbiology and Immunology, and Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, 1501 Kings Highway, Shreveport, Louisiana 71130, USA.

The sole immediate-early (IE) gene of equine herpesvirus 1 (EHV-1) encodes a major regulatory protein of 1487 amino acids (aa) capable of modulating gene expression from both early and late promoters and also of trans-repressing its own promoter. Using a specially designed recombination system and a library of IE linker-insertion, deletion, point, and nonsense mutant constructs that encode forms of the IE protein (IEP) harboring mutations within all five regions, 17 mutant viruses were generated and characterized. Ribonuclease protection analyses revealed that all 17 mutants synthesize the IE mRNA in RK-13 cells, whereas those that failed to replicate on non-complementing RK-13 cells displayed a defect in the transcription of either an important early gene (EICP0) and/or an essential late gene (glycoprotein D). Western blot analyses showed that the IEP was synthesized and detectable in cells infected with each mutant virus, including those mutants that failed to replicate on non-complementing RK-13 cells. Eleven of the 17 mutants were capable of growth on non-complementing RK-13 cells, whereas mutant viruses with deletions within the serine-rich tract (SRT), nucleus localization signal (NLS), or DNA-binding domain (DBD) were capable of growth only on the IEP-producing cell line (IE13.1). Lastly, temperature shift experiments revealed that mutant viruses containing deletions within the C-terminus (KyAn1029 and KyAn1411) or within the SRT (KyADeltaSRT2) of the IEP exhibited a temperature-sensitive phenotype in that these viruses, in contrast to the parent KyA, failed to replicate at 39 degrees C. Overall, these results indicate that the C-terminus of the IEP is not essential for IEP function in cell culture, but this region contains elements that enhance the function(s) of the IEP. The initial characterization of these 17 EHV-1 mutants has shown that sequences totaling at least 43% of the IEP are not essential for virus replication in cell culture.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s11262-005-1801-2DOI Listing
October 2005

Evidence that Na+-pumping occurs through the D-channel in Vitreoscilla cytochrome bo.

Biochem Biophys Res Commun 2005 Jul;332(2):332-8

Biology Division, Department of Biological, Chemical, and Physical Sciences, Illinois Institute of Technology, Chicago, IL 60616, USA.

The operon (cyo) encoding the Na(+)-pumping respiratory terminal oxidase (cytochrome bo) of the bacterium Vitreoscilla was transformed into Escherichia coli GV100, a deletion mutant of cytochrome bo. This was done for the wild type operon and five mutants in three conserved Cyo subunit I amino acids known to be crucial for H(+) transport in the E. coli enzyme, one near the nuclear center, one in the K-channel, and one in the D-channel. CO-binding, NADH and ubiquinol oxidase, and Na(+)-pumping activities were all substantially inhibited by each mutation. The wild type Vitreoscilla cytochrome bo can pump Na(+) against a concentration gradient, resulting in a transmembrane concentration differential of 2-3 orders of magnitude. It is proposed that Vitreoscilla cytochrome bo pumps four Na(+) through the D-channel to the exterior and transports four H(+) through the K-channel for the reduction of each O(2).
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bbrc.2005.04.133DOI Listing
July 2005

The EICP27 protein of equine herpesvirus 1 is recruited to viral promoters by its interaction with the immediate-early protein.

Virology 2005 Mar;333(1):74-87

Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, 1501 Kings Highway, Shreveport, LA 71130-3932, USA.

The equine herpesvirus 1 (EHV-1) EICP27 protein cooperates with either the immediate-early (IE) or the EICP0 protein to synergistically trans-activate viral promoters. GST-pulldown and co-immunoprecipitation assays revealed that the EICP27 protein's cooperation with the IE or the EICP0 protein involves its physical interaction with these viral proteins. In the case of the IE-EICP27 protein interaction, IE residues 424 to 826 and EICP27 residues 41 to 206 harbor the interactive domains. Electrophoretic mobility shift assays (EMSA) suggested that the EICP27 protein is not a sequence-specific DNA-binding protein as it fails to directly bind to the IE promoter, the early EICP27, EICP0, and TK promoters, or the late gD and IR5 promoters. However, EMSA studies also showed that the interaction of the IE and EICP27 proteins results in the recruitment of the EICP27 protein to representative early promoters. These results support our hypothesis that the EICP27 protein participates in the trans-activation of EHV-1 promoters, and suggest its presence within RNA polymerase II preinitiation complexes that assemble at viral promoters.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.virol.2004.12.014DOI Listing
March 2005

A negative regulatory element (base pairs -204 to -177) of the EICP0 promoter of equine herpesvirus 1 abolishes the EICP0 protein's trans-activation of its own promoter.

J Virol 2004 Nov;78(21):11696-706

Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, P.O. Box 33932, Shreveport, LA 71130-3932, USA.

The early EICP0 protein is a powerful trans-activator that activates all classes of equine herpesvirus 1 (EHV-1) promoters but, unexpectedly, trans-activates its own promoter very weakly. Transient transfection assays that employed constructs harboring deletions within the EICP0 promoter indicated that EICP0 cis-acting sequences within bp -224 to -158 relative to the first ATG abolished the EICP0 protein's trans-activation of its own promoter. When inserted into the promoters of other EHV-1 genes, this sequence also downregulated activation of the immediate-early IE(-169/+73), early thymidine kinase TK(-215/+97), and late glycoprotein K gK(-83/+14) promoters, indicating that the cis-acting sequence (-224 to -158) downregulated expression of representative promoters of all classes of EHV-1 genes and contains a negative regulatory element (NRE). To define the cis-acting element(s), three synthetic oligonucleotides (Na [bp -224 to -195], Nb [bp -204 to -177], and Nc [bp -185 to -156]) were synthesized and cloned upstream of the EICP0(-157/-21) promoter. Of the three synthetic sequences, only the Nb oligonucleotide caused the downregulation of the EICP0 promoter. The NRE was identified as a 28-bp element to lie at -204 to -177 that encompassed the sequence of ([-204]AGATACAGATGTTCGATAAATTGGAACC[-177]). Gel shift assays performed with mouse L-M, rabbit RK-13, and human HeLa cell nuclear extracts and gamma-(32)P-labeled wild-type and mutant NREs demonstrated that a ubiquitous nuclear protein(s) (NRE-binding protein, NREBP) binds specifically to a sequence (bp -193 to -183) in the NRE. The NREBP is also present in the nucleus of EHV-1-infected cells; however, the amount of NREBP in EHV-1-infected L-M cells that bound to the Nb oligonucleotide was reduced compared to that in uninfected L-M cells. Transient transfection assays showed that deletions or mutations within the NREBP-binding site abolished the NRE activity of the EICP0 promoter. These results suggested that the NREBP may mediate the NRE activity of the EICP0 promoter and may function in the coordinate expression of EHV-1 genes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1128/JVI.78.21.11696-11706.2004DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC523287PMC
November 2004

The equine herpesvirus 1 EICP27 protein enhances gene expression via an interaction with TATA box-binding protein.

Virology 2004 Jul;324(2):311-26

Center for Molecular and Tumor Virology and Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, Shreveport, LA 71130-3932, USA.

The mechanism(s) by which the early EICP27 gene product cooperates with other equine herpesvirus 1 (EHV-1) regulatory proteins to achieve maximal promoter activity remains unknown. Transient transfection assays revealed that deletion of residues 93-140 of the 470-aa EICP27 protein substantially diminished its activation of the immediate-early (IE) promoter, whereas deletion of residues 140-470 that contain a zinc-finger motif abolished this activity. Fluorescence microscopy of cells expressing the full-length EICP27 protein or portions of this protein revealed that an arginine-rich sequence spanning residues 178-185 mediates nuclear entry. Experiments employing the mammalian Gal4 two-plasmid system revealed that the EICP27 protein does not possess an independent trans-activation domain (TAD). Protein-protein interaction assays using purified proteins revealed that residues 124-220 of the EICP27 protein mediate its direct interaction with TATA box-binding protein (TBP). Partial deletion of this TBP-binding domain attenuated the ability of the EICP27 protein to stimulate the IE and early EICP0 promoters by 68% and 71%, respectively, indicating the importance of this protein-protein interaction.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.virol.2004.03.040DOI Listing
July 2004