Samantha Maurotti - University Magna Grecia - dr

Samantha Maurotti

University Magna Grecia

dr

catanzaro, calabria | Italy

Main Specialties: Biology, Biotechnology, Endocrinology Diabetes & Metabolism, Foot & Ankle Orthopaedics

Samantha Maurotti - University Magna Grecia - dr

Samantha Maurotti

Introduction

Primary Affiliation: University Magna Grecia - catanzaro, calabria , Italy

Specialties:

Research Interests:


View Samantha Maurotti’s Resume / CV

Publications

8Publications

69Reads

30Profile Views

4PubMed Central Citations

Lycopene and bone: an in vitro investigation and a pilot prospective clinical study.

J Transl Med 2020 Jan 29;18(1):43. Epub 2020 Jan 29.

Department of Clinical and Experimental Medicine, Nutrition Unit, University Magna Grecia, 88100, Catanzaro, Italy.

View Article

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12967-020-02238-7DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6990577PMC
January 2020
3.930 Impact Factor

Bergamot Polyphenol Fraction Exerts Effects on Bone Biology by Activating ERK 1/2 and Wnt/β-Catenin Pathway and Regulating Bone Biomarkers in Bone Cell Cultures.

Nutrients 2018 Sep 14;10(9). Epub 2018 Sep 14.

Department of Clinical and Experimental Medicine, Nutrition Unit, University Magna Grecia, 88100 Catanzaro, Italy.

View Article

Download full-text PDF

Source
http://dx.doi.org/10.3390/nu10091305DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6163325PMC
September 2018
3 Reads
3.150 Impact Factor

Molecular analysis of three known and one novel LPL variants in patients with type I hyperlipoproteinemia

Nutr Metab Cardiovasc Dis. 2018 Feb;28(2):158-164

Nutr Metab Cardiovasc Dis.

IntroductionType I hyperlipoproteinemia, also known as familial chylomicronemia syndrome (FCS) or familial lipoprotein lipase (LPL) deficiency, is a rare recessive disorder characterized by a severe reduction in the catabolism of triglyceride-rich lipoproteins. This reduction results in a massive accumulation of plasma chylomicrons leading to hypertriglyceridemia [1] with triglyceride levels typically >17 mmol/L [2, 3, 4]. Clinical signs and symptoms, often appearing in neonatal period/early infancy, include failure to thrive, eruptive xanthomas, hepatomegaly, lipaemia retinalis, severe and recurrent abdominal pains. Of these, acute pancreatitis is the most serious clinical manifestation [5, 6, 7, 8]. The prevalence of familial LPL deficiency is estimated to be 1 to 2 per million in the general population [4, 9] although it is higher in isolated ethnic groups [10, 11]. Loss of function variants in 5 genes (LPL, APOC2, APOA5, LMF1 and GPIHBP1) [12, 13, 14, 15, 16, 17] cause type I hyperlipoproteinemia with LPL variants accounting for the majority of all reported variants.The LPL gene encodes for a secreted protein of 448 amino acids with a 27-amino-acid signal peptide [18]. LPL is an enzyme with triglyceride lipase activity and it is involved in the partitioning of lipids contained in triglyceride-rich lipoprotein particles [19]. LPL is primarily synthesized in the parenchymal cells of the heart, skeletal muscle and adipose tissues, and then transported to the luminal surface of vascular endothelial cells [18]. After cell secretion the formation of dimers is a key step for the LPL activity [20].More than 200 pathogenic variants in the LPL gene have been identified [21, 22, 23]. These affect LPL activity by interfering with secretion, heparin binding or enzymatic activity [23, 24].The clinical management of these patients is very burdensome and consists of a very low fat diet which usually has poor compliance. New drugs are under investigation for these patients.In the present study, we have identified and characterized one novel variant and characterized three previously reported LPL variants in three patients with severe hypertriglyceridemia, consanguinity and recurrent pancreatitis. We showed, by in vitro experiments, that all the examined variants are loss of function variants characterized by a prominent reduction in protein secretion.Jump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesMethodsJump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesHypertriglyceridemic patientsThree patients from the Lipid Clinic at Sahlgrenska University Hospital in Gothenburg (Sweden) were selected between June 2015 and April 2017. The selection criteria were: diagnosis of severe hypertriglyceridemia (>10 mmol/L for at least three times), recurrent pancreatitis episodes, consanguinity and the absence of secondary risk factors for hypertriglyceridemia such as alcohol abuse, type 2 diabetes mellitus and metabolic syndrome. Each individual gave informed consent to DNA extraction, analysis and publication.Jump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesAnalysis of the LPL geneDNA of patients was extracted from EDTA-containing blood or saliva using DNeasy Blood kit (Qiagen, Hilden, Germany) and Puregene Buccal Cell Core kit (Qiagen) respectively, according to the manufacturer's instructions.DNA sequencing of the exons with flanking intron sequences of the LPL gene was performed. The primers and conditions for thermal cycling are available upon request.The PCR products were purified using ExoSAP-IT (USB Corporation, Cleveland, OH) according to the manufacturer's instructions. Version 3.1 of the BigDye terminator cycle-sequencing kit (Applied Biosystems, Foster City, CA) was used for the sequencing reactions according to the manufacturer's instructions. The sequencing products were run on a Genetic Analyzer 3730 (Applied Biosystems) and analyzed using Secscape version 2.5 software (Applied Biosystems). The sequence annotation for the full length LPL protein includes the 27 residue signal peptide.Jump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesSite-direct mutagenesis and transient transfection of HEK 293T/17 cellsHuman wild type LPL cDNA was synthesized and cloned in pcDNA3.1 containing a V5 epitope tag at the C-terminus by GeneArt Gene Synthesis (Thermo Fisher Scientific, Rockford, IL, USA) as previously described [25]. LPL variants were generated by site-directed mutagenesis introducing a single base-pair change in the wild type LPL gene sequence. To obtain the LPL W113R amino acidic substitution, a single base-pair change from thymine to cytosine at nucleotide 337 was introduced by using the following primers: primer forward TGTGGTGGACCGGCTGTCACG, primer reverse CGTGACAGCCGGTCCACCACA.To obtain the LPL G215E amino acidic substitution (from guanine to adenine at nucleotide 644) we used the following primers: primer forward TTCACCAGAGAGTCCCCTGGT, primer reverse ACCAGGGGACTCTCTGGTGAA.For the LPL S220R substitution (from adenine to cytosine at nucleotide 658) the following primers were used: primer forward CCCTGGTCGACGCATTGGAAT, primer reverse ATTCCAATGCGTCGACCAGGG.To obtain the LPL V227F substitution (from guanine to thymine at nucleotide 679) the following primers were used: primer forward CCAGAAACCATTTGGGCATGT, primer reverse ACATGCCCAAATGGTTTCTGG. All the primers were purchased from Sigma–Aldrich (St. Louis, Missouri). The protocol used for mutagenesis is available upon request.The presence of the LPL variants and the fidelity of each construct were confirmed by DNA sequencing (Eurofins Genomics, Germany).Human embryonic kidney 293T/17 (HEK 293T/17) cells were purchased from American Tissue Culture Collection (Manassas, VA) and cultured in Dulbecco's Modified Eagle's Medium (high glucose from Lonza) containing 10% Fetal Bovine Serum (FBS), 5% penicillin-streptomycin and 2 mM l-glutamine.HEK 293T/17 cells were transiently transfected with plasmids containing the human wild type LPL cDNA or carrying the other variants (3 μg/mL) using TurboFect transfection reagent (Thermo Fisher Scientific), according to the manufacturer's instructions.48 h after transfection, cells and media were collected. Cells were lysed using mammalian protein extraction reagent (M-PER, Thermo Fisher Scientific) containing complete protease inhibitor cocktail (Sigma–Aldrich). Media were concentrated 10 times by centrifuging using VIVASPIN tubes (Sartorius Stedim Biotech, Göttingen, Germany). Cell lysates and media were used to analyze protein synthesis and secretion by western blot. Media fractions were additionally used to measure LPL activity.Jump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesCycloheximide chase assayHEK 293T/17 cells were seeded in six well plates and transiently transfected with plasmids containing the human wild type LPL cDNA or carrying the other variants (3 μg/mL). Then, cells were treated with cycloheximide (200 μg/mL) for 2, 4, 8, and 12 h. Cells and media were collected and subjected to western blot analysis. The intensity of the western blotting bands was measured by Image Lab Software (Bio-Rad) and expressed as arbitrary unit (AU).Jump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesImmunoblottingHEK 293T/17 lysates and media fractions concentrated 10 times were mixed with Laemmli buffer containing 2-mercaptoethanol and boiled at 95 °C for 5 min. Proteins were size-separated by SDS-PAGE (10% acrylamide gel) and transferred onto nitrocellulose membranes (0.4 A, 1 h). Membranes were incubated for 1 h with primary antibodies, washed 2 times for 10 min with 0.2% tris-buffered saline (TBST) containing 0.2% tween, incubated 1 h with HRP-conjugated secondary antibodies, then washed 3 times for 10 min with 0.2% TBST. Membranes were incubated for 5 min with chemiluminescent HRP substrate (Millipore Corporation, Billerica, MA). Bands were visualized by Chemidoc XRS System (Biorad, Hercules, CA) and quantified using Image Lab Software (Biorad).The following antibodies were used: mouse anti-V5 (Invitrogen, P/N46-0705), rabbit anti-Calnexin (Sigma–Aldrich, C4731), mouse anti-Albumin (Sigma–Aldrich, A6684).Jump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesLipoprotein lipase activityLPL activity was measured in media fractions of HEK 293T/17 cells transiently transfected and overexpressing wild type LPL or mutant LPL as previously described [25, 26].Briefly, 50 μL of each concentrated medium fraction was incubated for 40 min at 37 °C with a mixture containing phosphatidylcholine (Sigma–Aldrich), cold triolein, radiolabeled [9,10-3H(N)]-triolein (Perkin Elmer, Waltman, MA), heat-inactivated fetal bovine serum (FBS) and bovine serum albumin. The reaction was blocked and lipids were extracted by the addition of methanol/chloroform/heptane (10:9:7). Samples were centrifuged at 3000 g for 15 min and the upper aqueous phase of each sample was saved. The amount of free [3H]-oleic acid in the upper phase was measured by scintillation counting. Mouse post-heparin plasma was used as positive control.Jump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesResultsJump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesClinical features of the patientsA total of three individuals underwent genetic screening for the presence of variants in the LPL gene. The clinical characteristics of the study participants are shown in Table 1. Briefly, they were adults (mean age 49) with a mean BMI of 22.8 and a mean fasting triglyceride level of 26 mmol/L.Table 1Clinical, anthropometric and lipoprotein profile of the individuals screened for LPL variants.VariablePatient 1Patient 2Patient 3Age (years)496929Gender (male/female)FMMBMI (Kg/m2)21.427.819.2Alcohol intake (yes/no)NONONODiabetes (yes/no)NOYESaYESaTriglycerides (mmol/L)39.7 ± 13.619.6 ± 9.418.7 ± 3.2Pancreatitis (yes/no)YESYESYESNumber of pancreatitis>3>3>3Cholesterol (mmol/L)8.78.55.1HDL-cholesterol (mmol/L)0.40.30.4LDL-cholesterol (mmol/L)0.64<0.1View Table in HTMLAbbreviations: BMI, body mass index; HDL, high-density lipoprotein; LDL, low-density lipoprotein.aPatient 2 and 3 had diabetes mellitus due to a reduction in the insulin secretion due to multiple pancreatitis. Triglycerides are shown as mean ± SD of 3 measurements.Jump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesGenetic screeningThe LPL gene was successfully sequenced in all the study participants. Patient 1 was compound heterozygous for three different variants: 1) c.337T > C in exon 3, resulting in a tryptophan to arginine substitution at position 113 of the LPL protein (W113R); 2) c.644G > A in exon 5, resulting in a glycine to glutamic acid substitution at position 215 (G215E); 3) c.1211T > G in exon 8, resulting in a methionine to arginine substitution at position 404 (M404R) (Fig. 1A). The first two variants (W113R and G215E) are well known causes of lipoprotein lipase deficiency [23, 27]; the third variant (M404R) has already been described by our group [25].Figure 1LPL gene sequencing of three individuals affected by hypertriglyceridemia. (A) DNA sequence of patient 1 shows mutated nucleotides c.337 T > C (right panel), c.644 G > A (central panel), c.1211 T > G (left panel). (B) DNA sequence of patient 2 shows mutated nucleotide c.658 A > C. (C) DNA sequence of patient 3 and 4 (brothers) shows mutated nucleotide c.679 G > T. Nucleotide changes are indicated by the arrow.View Large Image | View Hi-Res Image | Download PowerPoint SlidePatient 2 was heterozygous for the nucleotide change c.658A > C in exon 5 (Fig. 1B), resulting in a serine to arginine substitution at position 220 (S220R). This variant has been described by Mailly et al. [1]. No other variants in candidate genes (APOC2, APOA5, GPIHBP1 and LMF1) were found.Patient 3 was homozygous for the nucleotide change c.679G > T in exon 5 in the LPL gene (Fig. 1C), resulting in a valine to phenylalanine substitution at position 227 (V227F). His brother was homozygous for the same variant.Jump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activityResults  Clinical features of the patients  Genetic screening  LPL synthesis and secretion in HEK 293T/17 cells  LPL enzymatic assayDiscussionFinancial supportAuthor contributionsConflicts of interestReferencesLPL synthesis and secretion in HEK 293T/17 cellsTo examine the effect of the variants in the LPL gene at a protein level, the wild type LPL cDNA was cloned into pcDNA3.1 expression vector and then all the mutants were obtained by mutagenesis in situ. A V5 tag at the C-terminus of each construct was added to ensure specificity. HEK 293T/17 cells were transiently transfected with the individual constructs and, after 48 h, cells were harvested and media were collected and concentrated 10 times.HEK 293T/17 cells transfected with the mutant plasmids produced less LPL protein than cells transfected with the wild type LPL plasmid (Fig. 2A). Specifically, cells transfected with the W113R and G215E variants showed a reduction in protein synthesis of approximately 50%, whilst the protein synthesis was reduced by 35–40% in cells transfected with the S220R or V227F variant (Fig. 2A).Figure 2HEK 293T/17 cells transiently transfected show a reduction of the production and secretion of LPL variants. (A) Western blotting analysis of cell lysates (N = 6) shows a reduction in the production of LPL-V5 tagged protein of almost 50% in W113R and G215E LPL variants and of 35–40% in the S220R or V227F variants; calnexin was used as loading control. (B) Western blotting analysis of cell media (N = 5) shows a strong reduction in the secretion of LPL-V5 tagged protein of each LPL variant; albumin was used as loading control. WT: wild type; Cnx: calnexin; Alb: albumin. **P ≤ 0.01.View Large Image | View Hi-Res Image | Download PowerPoint SlideFurthermore, the amounts of secreted LPL in media of cells transfected with the mutant plasmids were 80% reduced compared to cells transfected with the wild type LPL plasmid (Fig. 2B). These data show that variants in the LPLgene reduce the production and secretion of LPL protein.Next, HEK 293T/17 cells expressing the human wild type LPL or the other mutants were treated with cycloheximide to block protein synthesis (Fig. 3A). The degradation rate was not different between LPL wild type and the other mutants (Fig. 3B), suggesting that the variants do not affect protein degradation.Figure 3Degradation of LPL wild type and variant proteins after blocking protein synthesis with cycloheximide.(A) Western blotting analysis of cells transiently transfected with LPL wild type or mutant proteins and subsequently treated with cycloheximide (200 μg/mL) for the indicated time points. (B) Densitometry of western blotting bands (mean of three independent experiments) using Image Lab Software (Bio-Rad).View Large Image | View Hi-Res Image | Download PowerPoint SlideJump to SectionIntroductionMethods  Hypertriglyceridemic patients  Analysis of the LPL gene  Site-direct mutagenesis and transient transfection of HEK 293T/17 cells  Cycloheximide chase assay  Immunoblotting  Lipoprotein lipase activity

View Article
February 2018

Impact Factor 3.340

Impaired Fat Oxidation and Reduced Resting Energy Expenditure after a Fat Load in Individuals with Liver Steatosis

J Nutr Food Sci 2018, 8:1 DOI: 10.4172/2155-9600.1000665

Journal of Nutrition & Food Sciences

Impaired Fat Oxidation and Reduced Resting Energy Expenditure after a Fat Load in Individuals with Liver SteatosisMaurotti S1, Mazza E1, De Bonis D2, Provenzano F2, Russo C1, Ferro Y11Department of Medical and Surgical Science, Nutrition Unit, University Magna Grecia, Catanzaro, Italy2Department of Clinical and Experimental Medicine, Nutrition Unit, University Magna Grecia, Catanzaro, Italy*Corresponding author: Samantha Maurotti, Department of Medical and Surgical Science, Nutrition Unit, University Magna Grecia, Catanzaro, Viale S Venuta 88100Catanzaro, Italy, Tel: +39-961-369-5172; Fax: +39-961-369-7223; E-mail: samabiotec@yahoo.itReceived date: October 15, 2017; Accepted date: January 13, 2018; Published date: January 31, 2018Copyright: © 2018 Maurotti S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.AbstractTo date, the factors involved in the progression from simple liver steatosis to liver fibrosis have not been clarified. The postprandial phase after a high fat meal is pro-inflammatory and chronic low-grade inflammation is associated with the development of non-alcoholic fatty liver disease. The purpose of this study was to evaluate the effect of an oral fat load on fat oxidation in individuals with vs. without liver steatosis. Twelve adults without liver steatosis and seventeen with liver steatosis underwent an oral tolerance tests with 190 grams of a fresh cream (343 kcal/100 g, calories from fats 84%). Respiratory quotient and resting energy expenditure were evaluated using indirect calorimetry at 0, 90 and 120 minutes after load ingestion. In the subjects without liver steatosis, the fat load induced a reduction in the respiratory quotient (basal value=0.88 ± 0.07 vs. 90 min value=0.85 ± 0.06, p=0.020; and basal value=0.88 ± 0.07 120 min value=0.84 ± 0.06, p=0.001) with no change in resting energy expenditure. The liver steatosis led to a delayed switch to fat oxidation after the fat load (90 min value 0.88 ± 0.07 vs. 120 min value = 0.85 ± 0.06; p=0.032) with a significant reduction of the resting energy expenditure after 120 min (p=0.011). An impaired fat oxidation, suggesting a reduced metabolic flexibility, and reduced resting energy expenditure is demonstrated after a fat load in individuals with liver steatosis. These mechanisms may be involved in the progression from liver steatosis to fibrosis.

View Article
January 2018
52 Reads

Individuals with Metabolically Healthy Overweight/Obesity Have Higher Fat Utilization than Metabolically Unhealthy Individuals.

Nutrients 2016 Jan 4;8(1). Epub 2016 Jan 4.

Department of Medical and Surgical Science, University Magna Grecia, Catanzaro 88100, Italy.

View Article

Download full-text PDF

Source
http://dx.doi.org/10.3390/nu8010002DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4728616PMC
January 2016
28 Reads
4 Citations
3.150 Impact Factor

Top co-authors

Tiziana Montalcini
Tiziana Montalcini

University Magna Grecia

6
Stefano Romeo
Stefano Romeo

University of Gothenburg

6
Arturo Pujia
Arturo Pujia

Clinical Nutrition Unit

5
Cristina Russo
Cristina Russo

University of Catania

5
Carmine Gazzaruso
Carmine Gazzaruso

University of Pavia

3
Roberta Pujia
Roberta Pujia

University Magna Grecia

3
Yvelise Ferro
Yvelise Ferro

Clinical Nutrition Unit

3
Elisa Mazza
Elisa Mazza

University Magna Grecia

3
Sandro Giannini
Sandro Giannini

Rizzoli Orthopaedic Institute

3
Vincenzo Mollace
Vincenzo Mollace

University of Catanzaro Magna Graecia

2