Publications by authors named "Ramesh Chandra"

288 Publications

Comparative evaluation of removal of smear layer using newer rotary endodontic files: A scanning electron microscope study.

J Conserv Dent 2021 Nov-Dec;24(6):616-621. Epub 2022 Apr 1.

Department of Conservative Dentistry and Endodontics, Career Post Graduate Institute of Dental Sciences, Vibhuti Khand, Gomti Nagar, Lucknow, Uttar Pradesh, India.

Aim: The aim of this study is to evaluate the smear layer removal efficacy of newer rotary files using scanning electron microscopic analysis at the coronal, middle, and apical third of the root canal.

Materials And Methods: In this study, sixty permanent human single-rooted teeth with complete, mature root apices without any anatomic variation having straight patent root canal extracted for periodontal cause were included. The samples were cleaned to remove debris, calculus and rinsed with sodium hypochlorite to remove organic tissue and then stored in distilled water. All the samples were decoronated with the help of carborundum disc at root length of 12 mm to obtain segments similar in length. After this, all the samples were randomly divided into four groups -Protaper universal, Protaper Gold, EDM, and Revo-S. After cleaning and shaping, samples in each group were finally flushed with normal saline. Samples were then dried. Grooves were made into the root in the buccal and lingual portion of the root using a diamond bur and the samples were split longitudinally into two halves using stainless steel chisel and mallet. Preparation for scanning electron microscope was done and phototmicrographs at ×3000 were taken.

Result: Chi square test and Kruskal-Wallis test was used for statistical analysis. Result of this study showed that Revo -S was found to be best amongst the groups and EDM was the poorest.

Conclusions: Based on the present study, Revo-S files showed the best smear layer removal in the coronal, middle, and apical 1/3 of the root canal when compared to other groups. Within the parameters of the study, Revo -S was found to be best amongst the groups and EDM was the poorest. The quality of various files according to ranks of smear layer removal was found to be: Group IV > Group II > Group I > Group III.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4103/jcd.jcd_92_21DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9089771PMC
April 2022

Visible-Light-Prompted Synthesis and Binding Studies of 5,6-Dihydroimidazo[2,1-]thiazoles with BSA and DNA Using Biophysical and Computational Methods.

J Org Chem 2022 03 2;87(6):3952-3966. Epub 2022 Mar 2.

Department of Chemistry, University of Delhi, New Delhi 110007, India.

Fused heterocyclic systems containing a bridgehead nitrogen atom have emerged as imperative pharmacophores in the design and development of new drugs. Among these heterocyclic moieties, the imidazothiazole scaffold has long been used in medicinal chemistry for the treatment of various diseases. In this study, we have established a simplistic and environmentally safe regioselective protocol for the synthesis of 5,6-dihydroimidazo[2,1-]thiazole derivatives from easily available reactants. The reaction proceeds through formation of the α-bromodiketones ensuing trap with imidazolidine-2-thione to provide these versatile bicyclic heterocycles in excellent yields. The synthesized compounds were screened through the molecular docking approach for the most stable complex formation with bovine serum albumin (BSA) and calf thymus deoxyribonucleic acid (ctDNA). The selected compound was further studied using binding studies, which revealed moderate interactions with BSA and ctDNA. The binding studies were performed using biophysical approaches including UV-visible spectroscopy, steady-state fluorescence, circular dichroism (CD), and viscosity parameters.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acs.joc.1c02471DOI Listing
March 2022

Fabrication of a sensing platform for identification of tumor necrosis factor-alpha: a biomarker for neonatal sepsis.

3 Biotech 2022 Jan 5;12(1):37. Epub 2022 Jan 5.

Amity Institute of Nanotechnology (AINT), Amity University Uttar Pradesh (AUUP), Sector-125, Noida, 201313 India.

Neonatal sepsis is a prime cause of neonatal deaths across the globe. Presently, various medical tests and biodevices are available in neonatal care. These diagnosis platforms possess several limitations such as being highly expensive, time-consuming, or requiring skilled professionals for operation. These limitations can be overcome through biosensor development. This work discusses the assembling of an electrochemical sensing platform that is designed to detect the level of tumor necrosis factor-alpha (TNF-α). The sensing platform was moderated with nanomaterials molybdenum disulfide nanosheets (MoSNSs) and silicon dioxide-modified iron oxide nanoparticles ([email protected]). The integration of nanomaterials helps in accomplishing the improved characteristics of the biosensor in terms of conductivity, selectivity, and sensitivity. Further, the molecularly imprinted polymer (MIP) approach was incorporated for sensing the presence of TNF-α on the surface of the working electrode. The electrochemical response of the electrode was recorded at different conditions. A broad concentration range was selected to optimize the biosensor from 0.01 pM to 100 nM. The sensitivity of the biosensor was higher and it exhibits a lower detection limit (0.01 pM).
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s13205-021-03083-1DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8733138PMC
January 2022

Molecular imprinting based electrochemical biosensor for identification of serum amyloid A (SAA), a neonatal sepsis biomarker.

Int J Biol Macromol 2022 Jan 14;195:589-597. Epub 2021 Dec 14.

Amity Institute of Nanotechnology (AINT), Amity University Uttar Pradesh (AUUP), Sector -125, Noida-201313, Uttar Pradesh, India. Electronic address:

Neonatal septicemia is a bacterial infection in newborns. It is caused by bacteria including Escherichia coli and Group B Streptococcus (GBS). Neonatal septicemia is divided into early-onset and late-onset sepsis. The diagnosis of neonatal septicemia is a challenging task because of the presence of nonspecific symptoms. Biomarkers such as C-reactive protein (CRP), procalcitonin (PCT), and serum amyloid A (SAA) can help in the detection of sepsis at early stages. The level of biomarkers is elevated once sepsis occurs in the body. This study presents the development of an electrochemical biosensor based on nanomaterials integrated molecularly imprinted polymer technique. To obtain the synergistic effect and high conductivity, multi-walled carbon nanotubes (MWCNTs), manganese oxide nanospheres (MnONSs), and cobalt oxide nanoparticles (CoONPs) were coated over the screen-printed electrode (SPE). A further modification was done by polymerizing molecularly imprinted polymer (MIP) specifically synthesized for SAA onto modified SPE. The performance of the designed platform was evaluated through electrochemical techniques. The operating range of the developed sensor was found to be 0.01 pM to 1 μM and 0.01 pM as the lower detection limit.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ijbiomac.2021.12.045DOI Listing
January 2022

Mitochondria-Related Nuclear Gene Expression in the Nucleus Accumbens and Blood Mitochondrial Copy Number After Developmental Fentanyl Exposure in Adolescent Male and Female C57BL/6 Mice.

Front Psychiatry 2021 18;12:737389. Epub 2021 Nov 18.

Department of Anatomy and Neurobiology, University of Maryland School of Medicine, Baltimore, MD, United States.

The potency of the synthetic opioid fentanyl and its increased clinical availability has led to the rapid escalation of use in the general population, increased recreational exposure, and subsequently opioid-related overdoses. The wide-spread use of fentanyl has, consequently, increased the incidence of exposure to the drug, but the long-term effects of this type of developmental exposure are not yet understood. Opioid use has also been linked to reduced mitochondrial copy number in blood in clinical populations, but the link between this peripheral biomarker and genetic or functional changes in reward-related brain circuitry is still unclear. Additionally, mitochondrial-related gene expression in reward-related brain regions has not been examined in the context of fentanyl exposure, despite the growing literature demonstrating drugs of abuse impact mitochondrial function, which subsequently impacts neuronal signaling. The current study uses exposure to fentanyl via dam access to fentanyl drinking water during gestation and lactation as a model for developmental drug exposure. This perinatal drug-exposure is sufficient to impact mitochondrial copy number in circulating blood leukocytes, as well as mitochondrial-related gene expression in the nucleus accumbens (NAc), a reward-related brain structure, in a sex-dependent manner in adolescent offspring. Specific NAc gene expression is correlated with both blood mitochondrial copy number and with anxiety related behaviors dependent on developmental exposure to fentanyl and sex. These data indicate that developmental fentanyl exposure impacts mitochondrial function in both the brain and body in ways that can impact neuronal signaling and may prime the brain for altered reward-related behavior in adolescence and later into adulthood.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fpsyt.2021.737389DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8637046PMC
November 2021

Visible-light driven regioselective synthesis, characterization and binding studies of 2-aroyl-3-methyl-6,7-dihydro-5H-thiazolo[3,2-a]pyrimidines with DNA and BSA using biophysical and computational techniques.

Sci Rep 2021 11 11;11(1):22135. Epub 2021 Nov 11.

Department of Chemistry, University of Delhi, New Delhi, 110007, India.

In recent times, fused azaheterocycles emerged as impressive therapeutic agents. Binding studies of such azaheterocycles with biomolecules is an important subject for pharmaceutical and biochemical studies aiming at the design and development of new drugs. Fused heterocyclic scaffolds, such as thiazolopyrmidines have long been used in the pharmaceutical industry for the treatment of various diseases. In this study, we have accomplished a regioselective synthesis of 2-aroyl-3-methyl-6,7-dihydro-5H-thiazolo[3,2-a]pyrimidines by the reaction of tetrahydropyrimidine-2(H)-thione with α-bromo-1,3-diketones, generated in situ from 1,3-diketones and NBS, using visible light as an inexpensive, green and renewable energy source under mild reaction conditions with wide-ranging substrate scope. The regioisomer was characterized unambiguously by 2D-NMR [H-C] HMBC and [H-C] HMQC spectroscopy. In silico toxicity data analysis showed the low toxicity risks of the synthesized compounds. Computational molecular docking studies were carried out to examine the interaction of thiazolo[3,2-a]pyrimidines with calf-thymus DNA (ct-DNA) and Bovine Serum Albumin (BSA). Moreover, different spectroscopic approaches viz. steady-state fluorescence, competitive displacement assay, UV-visible and circular dichroism (CD) along with viscosity measurements were employed to investigate the binding mechanisms of thiazolo[3,2-a]pyrimidines with DNA and BSA. The results thus obtained revealed that thiazolo[3,2-a]pyrimidines offer groove bindings with DNA and showed moderate bindings with BSA.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41598-021-01037-4DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8586366PMC
November 2021

Repeated cocaine administration upregulates CB receptor expression in striatal medium-spiny neurons that express dopamine D receptors in mice.

Acta Pharmacol Sin 2022 Apr 27;43(4):876-888. Epub 2021 Jul 27.

Intramural Research Program, National Institute on Drug Abuse, Baltimore, MD, USA.

Cannabinoid CB receptors (CBR) are importantly involved in drug reward and addiction. However, the cellular mechanisms underlying CBR action remain unclear. We have previously reported that cocaine self-administration upregulates CBR expression in midbrain dopamine (DA) neurons. In the present study, we investigated whether cocaine or heroin also alters CBR expression in striatal medium-spiny neurons that express dopamine D or D receptors (D-MSNs, D-MSNs) and microglia. Due to the concern of CBR antibody specificity, we developed three mouse CB-specific probes to detect CBR mRNA using quantitative RT-PCR and RNAscope in situ hybridization (ISH) assays. We found that a single injection of cocaine failed to alter, while repeated cocaine injections or self-administration dose-dependently upregulated CBR gene expression in both brain (cortex and striatum) and periphery (spleen). In contrast, repeated administration of heroin produced a dose-dependent reduction in striatal CB mRNA expression. RNAscope ISH assays detected CBR mRNA in striatal D- and D-MSNs, not in microglia. We then used transgenic CX3CR1 microglia reporter mice and D- or D-Cre-RiboTag mice to purify striatal microglia or ribosome-associated mRNAs from CX3CR1, D-MSNs, or D-MSNs, respectively. We found that CBR upregulation occurred mainly in D-MSNs, not in D-MSNs or microglia, in the nucleus accumbens rather than the dorsal striatum. These findings indicate that repeated cocaine exposure may upregulate CBR expression in both brain and spleen, with regional and cell type-specific profiles. In the striatum, CBR upregulation occurs mainly in D-MSNs in the nucleus accumbens. Given the important role of D-MSNs in brain reward function, the present findings provide new insight into mechanisms by which brain CBRs modulate cocaine action.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41401-021-00712-6DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8975868PMC
April 2022

Mitochondrial and Organellar Crosstalk in Parkinson's Disease.

ASN Neuro 2021 Jan-Dec;13:17590914211028364

College of Pharmacy and Nutrition, 7235University of Saskatchewan, Saskatoon, SK- S7N 5A2, Canada.

Mitochondrial dysfunction is a well-established pathological event in Parkinson's disease (PD). Proteins misfolding and its impaired cellular clearance due to altered autophagy/mitophagy/pexophagy contribute to PD progression. It has been shown that mitochondria have contact sites with endoplasmic reticulum (ER), peroxisomes and lysosomes that are involved in regulating various physiological processes. In pathological conditions, the crosstalk at the contact sites initiates alterations in intracellular vesicular transport, calcium homeostasis and causes activation of proteases, protein misfolding and impairment of autophagy. Apart from the well-reported molecular changes like mitochondrial dysfunction, impaired autophagy/mitophagy and oxidative stress in PD, here we have summarized the recent scientific reports to provide the mechanistic insights on the altered communications between ER, peroxisomes, and lysosomes at mitochondrial contact sites. Furthermore, the manuscript elaborates on the contributions of mitochondrial contact sites and organelles dysfunction to the pathogenesis of PD and suggests potential therapeutic targets.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1177/17590914211028364DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8317254PMC
January 2022

Cocaine-induced neuron subtype mitochondrial dynamics through Egr3 transcriptional regulation.

Mol Brain 2021 06 29;14(1):101. Epub 2021 Jun 29.

Department of Anatomy and Neurobiology, University of Maryland School of Medicine, HSF II Rm S265, 20 Penn Street, Baltimore, MD, 21201, USA.

Mitochondrial function is required for brain energy homeostasis and neuroadaptation. Recent studies demonstrate that cocaine affects mitochondrial dynamics and morphological characteristics within the nucleus accumbens (NAc). Further, mitochondria are differentially regulated by cocaine in dopamine receptor-1 containing medium spiny neurons (D1-MSNs) vs dopamine receptor-2 (D2)-MSNs. However, there is little understanding into cocaine-induced transcriptional mechanisms and their role in regulating mitochondrial processes. Here, we demonstrate that cocaine enhances binding of the transcription factor, early growth response factor 3 (Egr3), to nuclear genes involved in mitochondrial function and dynamics. Moreover, cocaine exposure regulates mRNA of these mitochondria-associated nuclear genes in both contingent or noncontingent cocaine administration and in both rodent models and human postmortem tissue. Interestingly, several mitochondrial nuclear genes showed distinct profiles of expression in D1-MSNs vs D2-MSNs, with cocaine exposure generally increasing mitochondrial-associated nuclear gene expression in D1-MSNs vs suppression in D2-MSNs. Further, blunting Egr3 expression in D1-MSNs blocks cocaine-enhancement of the mitochondrial-associated transcriptional coactivator, peroxisome proliferator-activated receptor gamma coactivator (PGC1α), and the mitochondrial fission molecule, dynamin related protein 1 (Drp1). Finally, reduction of D1-MSN Egr3 expression attenuates cocaine-induced enhancement of small-sized mitochondria, causally demonstrating that Egr3 regulates mitochondrial morphological adaptations. Collectively, these studies demonstrate cocaine exposure impacts mitochondrial dynamics and morphology by Egr3 transcriptional regulation of mitochondria-related nuclear gene transcripts; indicating roles for these molecular mechanisms in neuronal function and plasticity occurring with cocaine exposure.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s13041-021-00800-yDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8240292PMC
June 2021

The Immunopathobiology of SARS-CoV-2 Infection.

FEMS Microbiol Rev 2021 11;45(6)

Department of Pharmacology and Experimental Neuroscience, College of Medicine, University of Nebraska Medical Center, NE 68198, USA.

Infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) can lead to coronavirus disease 2019 (COVID-19). Virus-specific immunity controls infection, transmission and disease severity. With respect to disease severity, a spectrum of clinical outcomes occur associated with age, genetics, comorbidities and immune responses in an infected person. Dysfunctions in innate and adaptive immunity commonly follow viral infection. These are heralded by altered innate mononuclear phagocyte differentiation, activation, intracellular killing and adaptive memory, effector, and regulatory T cell responses. All of such affect viral clearance and the progression of end-organ disease. Failures to produce effective controlled antiviral immunity leads to life-threatening end-organ disease that is typified by the acute respiratory distress syndrome. The most effective means to contain SARS-CoV-2 infection is by vaccination. While an arsenal of immunomodulators were developed for control of viral infection and subsequent COVID-19 disease, further research is required to enable therapeutic implementation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/femsre/fuab035DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8632753PMC
November 2021

Regulatory safety pharmacology and toxicity assessments of a standardized stem extract of Cassia occidentalis Linn. in rodents.

Regul Toxicol Pharmacol 2021 Jul 19;123:104960. Epub 2021 May 19.

Pharmaceutics & Pharmacokinetics, CSIR-CDRI, Lucknow, 226 031, India. Electronic address:

Cassia occidentalis Linn (CO) is an annual/perennial plant having traditional uses in the treatments of ringworm, gastrointestinal ailments and piles, bone fracture, and wound healing. Previously, we confirmed the medicinal use of the stem extract (ethanolic) of CO (henceforth CSE) in fracture healing at 250 mg/kg dose in rats and described an osteogenic mode of action of four phytochemicals present in CSE. Here we studied CSE's preclinical safety and toxicity. CSE prepared as per regulations of Current Good Manufacturing Practice for human pharmaceuticals/phytopharmaceuticals and all studies were performed in rodents in a GLP-accredited facility. In acute dose toxicity as per New Drug and Clinical Trial Rules, 2019 (prior name schedule Y), in rats and mice and ten-day dose range-finding study in rats, CSE showed no mortality and no gross abnormality at 2500 mg/kg dose. Safety Pharmacology showed no adverse effect on central nervous system, cardiovascular system, and respiratory system at 2500 mg/kg dose. CSE was not mutagenic in the Ames test and did not cause clastogenicity assessed by in vivo bone marrow genotoxicity assay. By a sub chronic (90 days) repeated dose (as per OECD, 408 guideline) study in rats, the no-observed-adverse-effect-level was found to be 2500 mg/kg assessed by clinico-biochemistry and all organs histopathology. We conclude that CSE is safe up to 10X the dose required for its osteogenic effect.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.yrtph.2021.104960DOI Listing
July 2021

AlO/CuI/PANI nanocomposite catalyzed green synthesis of biologically active 2-substituted benzimidazole derivatives.

Dalton Trans 2021 Jun;50(22):7750-7758

Drug Discovery & Development Laboratory, Department of Chemistry, University of Delhi, Delhi-110007, India.

This work is generally focused on the synthesis of an efficient, reusable and novel heterogeneous Al2O3/CuI/PANI nanocatalyst, which has been well synthesized by a simple self-assembly approach where aniline is oxidized into PANI and aniline in the presence of KI also acts as a reductant. The nanocatalyst was well characterized by XRD, FTIR, SEM, EDX, TEM, BET and XPS techniques. In this study, the fabricated material was employed for the catalytic one-pot synthesis of 2-substituted benzimidazoles via condensation between o-phenylenediamine and aldehydes in ethanol as a green solvent. The present method is facile and offers several advantages such as high % yield, less reaction time, and no use of additive/bases. Also, the catalyst showed better values of green metrics including low E-factor: 0.17, high reaction mass efficiency: 85.34%, high carbon efficiency: 94%, and high process mass intensity: 1.17.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1039/d1dt00806dDOI Listing
June 2021

Cytotoxic T-lymphocyte elicited vaccine against SARS-CoV-2 employing immunoinformatics framework.

Sci Rep 2021 04 7;11(1):7653. Epub 2021 Apr 7.

Department of Biotechnology, Jawahar Lal Nehru University, Delhi, 110067, India.

Development of effective counteragents against the novel coronavirus disease (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) strains, requires clear insights and information for understanding the immune responses associated with it. This global pandemic has pushed the healthcare system and restricted the movement of people and succumbing of the available therapeutics utterly warrants the development of a potential vaccine to contest the deadly situation. In the present study, highly efficacious, immunodominant cytotoxic T-lymphocyte (CTL) epitopes were predicted by advanced immunoinformatics assays using the spike glycoprotein of SARS-CoV2, generating a robust and specific immune response with convincing immunological parameters (Antigenicity, TAP affinity, MHC binder) engendering an efficient viral vaccine. The molecular docking studies show strong binding of the CTL construct with MHC-1 and host membrane specific TLR2 receptors. The molecular dynamics simulation in an explicit system confirmed the stable and robust binding of CTL epitope with TLR2. Steep magnitude RMSD variation and compelling residual fluctuations existed in terminal residues and various loops of the β linker segments of TLR2-epitope (residues 105-156 and 239-254) to about 0.4 nm. The reduced R value (3.3 nm) and stagnant SASA analysis (275 nm/S/N after 8 ns and 5 ns) for protein surface and its orientation in the exposed and buried regions suggests more compactness due to the strong binding interaction of the epitope. The CTL vaccine candidate establishes a high capability to elicit the critical immune regulators, like T-cells and memory cells as proven by the in silico immunization assays and can be further corroborated through in vitro and in vivo assays.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41598-021-86986-6DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8027208PMC
April 2021

A review targeting the infection by CHIKV using computational and experimental approaches.

J Biomol Struct Dyn 2021 Mar 30:1-15. Epub 2021 Mar 30.

Department of Chemistry, Atma Ram Sanatan Dharma College, University of Delhi, New Delhi, India.

The rise of normal body temperature of 98.6 °F beyond 100.4 °F in humans indicates fever due to some illness or infection. Viral infections caused by different viruses are one of the major causes of fever. One of such viruses is, Chikungunya virus (CHIKV) is known to cause Chikungunya fever (CHIKF) which is transmitted to humans through the mosquitoes, which actually become the primary source of transmission of the virus. The genomic structure of the CHIKV consists of the two open reading frames (ORFs). The first one is a 5' end ORF and it encodes the nonstructural protein (nsP1-nsP4). The second is a 3' end ORF and it encodes the structural proteins, which is consisted of capsid, envelope (E), accessory peptides, E3 and 6 K. Till date, there is no effective vaccine or medicine available for early detection of the CHIKV infection and appropriate diagnosis to cure the patients from the infection. NSP3 of CHIKV is the prime target of the researchers as it is responsible for the catalytic activity. This review has updates of literature on CHIKV; pathogenesis of CHIKV; inhibition of CHIKV using theoretical and experimental approaches.Communicated by Ramaswamy H. Sarma.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/07391102.2021.1904004DOI Listing
March 2021

Guar gum based nanocomposites: Role in water purification through efficient removal of dyes and metal ions.

Carbohydr Polym 2021 Jun 23;261:117851. Epub 2021 Feb 23.

Department of Chemistry, Acharya Narendra Dev College (University of Delhi), Govindpuri, Kalkaji, New Delhi, 110019, India. Electronic address:

Researchers nowadays are relentlessly on a race exploring sustainable materials and techniques for the sequestration of toxic dyes and metal ions from water bodies. Biopolymers such as guar gum, owing to its high abundance, low cost and non-toxicity, are potential candidates in this field. Plenty of hydroxyl groups in the polymer backbone enable guar gum to be functionalised or grafted in a versatile manner proving itself as an excellent starting substance for fabricating upgraded materials meant for diverse applications. This review offers a comprehensive coverage of the role of guar gum-based nanocomposites in removal of dyes and heavy metal ions from waste water through adsorption and photo-catalytic degradation. Isotherm and kinetics models, fabrication routes, characterisation techniques, swelling properties and reusability as well as adsorption and degradation mechanisms are outlined. A detailed analysis with convincing results suggests a good future perspective of implementation of these materials in real-time wastewater treatment technology.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.carbpol.2021.117851DOI Listing
June 2021

Targeting unfolded protein response: a new horizon for disease control.

Expert Rev Mol Med 2021 03 4;23:e1. Epub 2021 Mar 4.

Department of Biomedical Science, Acharya Narendra Dev College, University of Delhi, Kalkaji, New Delhi-110019, India.

Unfolded protein response (UPR) is an evolutionarily conserved pathway triggered during perturbation of endoplasmic reticulum (ER) homeostasis in response to the accumulation of unfolded/misfolded proteins under various stress conditions like viral infection, diseased states etc. It is an adaptive signalling cascade with the main purpose of relieving the stress from the ER, which may otherwise lead to the initiation of cell death via apoptosis. ER stress if prolonged, contribute to the aetiology of various diseases like cancer, type II diabetes, neurodegenerative diseases, viral infections etc. Understanding the role of UPR in disease progression will help design pharmacological drugs targeting the sensors of signalling cascade acting as potential therapeutic agents against various diseases. The current review aims at highlighting the relevance of different pathways of UPR in disease progression and control, including the available pharmaceutical interventions responsible for ameliorating diseased state via modulating UPR pathways.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1017/erm.2021.2DOI Listing
March 2021

Comparative analysis of platelet-rich fibrin, platelet-rich fibrin with hydroxyapatite and platelet-rich fibrin with alendronate in bone regeneration: A cone-beam computed tomography analysis.

J Conserv Dent 2020 Jul-Aug;23(4):348-353. Epub 2021 Jan 16.

Department of Radiodiagnosis, King George Medical University, Lucknow, Uttar Pradesh, India.

Aim: This clinical study was designed to evaluate the volumetric healing of periapical (PA) bone defect after PA surgery, using platelet-rich fibrin (PRF), and its combination with hydroxyapatite and alendronate.

Subjects And Methods: Twenty male patients of age between 25 and 35 years, having PA pathology (>5 mm on intraoral periapical radiograph (IOPA)) with intraoral sinus opening, were included in this study. Cone-beam computed tomography (CBCT) imaging of all patients was done. Root canal treatment with PA surgery was done. Patients were divided into four groups (5 in each group), on the basis of material placed in PA bone defect. After 1 year, CBCT imaging was done. Linear measurement of maximal dimensions in all three orthogonal planes was done in both pre- and post-CBCT image. These measurements were used to estimate the volume of the lesion healed after 1 year of surgery.

Statistical Analysis: Analysis of variance and Tukey's test were used for statistical analysis.

Results: Change in volume were significantly different between Group 1 vs Group 3; Group 2 vs Group 3 and Group 3 vs Group 4. The Group Order for change in volume 1 year post surgery Group 3> Group 4 ≈ Group 2> Group 1.

Conclusions: PA bone healing after surgery is enhanced by placing combination of bone regenerative materials. PRF with hydroxyapatite provides best healing outcomes in comparison to PRF with alendronate or PRF alone.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4103/JCD.JCD_228_20DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7883795PMC
January 2021

Treatment of deep-seated palatal vascular malformations by bleomycin sclerotherapy.

J Plast Reconstr Aesthet Surg 2021 Sep 10;74(9):2272-2278. Epub 2021 Jan 10.

Department of Radiodiagnosis, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow, India 226014. Electronic address:

Background: Vascular malformations of the head and neck are common. The management of these lesions is complex and challenging due to the high complication rate and recurrence following treatment. Palatal vascular malformations (PVMs) are infrequent and present as slow growing lesions in the palate with recurrent bleeding and pain. These lesions are best managed by sclerotherapy due to their posterior location and risk of bleeding if surgery is attempted. Many sclerosants have been used for treating PVMs but the use of intralesional bleomycin for these lesions has not been reported at length. This paper describes the use of intralesional bleomycin injections for the treatment of deep-seated palatal vascular malformations.

Methods: Intralesional bleomycin injections were given directly into the lesion with the patients under short general anaesthesia. The total dose of bleomycin ranged between 8 and 15 IU, which depends upon the body weight and was repeated every four weeks till the resolution of lesion was observed.

Results: All the lesions in 12 patients regressed significantly with serial bleomycin injections. Clinically, the involved palatal mucosa became normal and magnetic resonance imaging demonstrated the significant regression of the lesion in all the cases. No complications were encountered with the use of intralesional bleomycin.

Conclusions: Intralesional bleomycin injections have proved to be an emerging modality in the management of remotely situated palatal vascular malformations. Their rapid regressive effect on the lesion coupled with a high safety margin makes bleomycin sclerotherapy the first choice of treatment for palatal vascular malformations.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bjps.2020.12.089DOI Listing
September 2021

Nanostructured graphitic carbon nitride based ultrasensing electrochemical biosensor for food toxin detection.

Bioelectrochemistry 2021 Jun 12;139:107738. Epub 2021 Jan 12.

Department of Chemistry, University of Delhi, Delhi 110007, India. Electronic address:

We report results of the studies related to the fabrication of thionine functionalized graphitic carbon nitride nanosheets based ultrasensing platform for food toxin (Aflatoxin B1, AfB) detection. The synthesis of graphitic carbon nitride nanosheets (g-CN) was carried out by polycondensation of melamine followed by chemical exfoliation. Further, thionine was used for the functionalization of g-CN (Thn/g-CN) and deposited electrophoretically onto the indium tin oxide (ITO) coated glass electrode. The fabricated Thn/g-CN/ITO electrode was covalently immobilized by EDC-NHS chemistry with anti-aflatoxin B1 (anti-AfB) followed by blocking of non-specific sites using BSA molecules. For structural, morphological, functional and electrochemical properties analysis of synthesized nanomaterials and fabricated electrodes X-ray diffraction, scanning electron microscopy, transmission electron microscopy, Fourier transform infrared spectroscopy, atomic force microscopy and cyclic voltammetry techniques were used. The electrochemical response studies of the fabricated biosensing platform (BSA/anti-AfB/Thn/g-CN/ITO) were carried out towards detection of AfB antigen using cyclic voltammetry technique. The obtained electrochemical results indicate that the fabricated biosensing electrode having ability to detect AfB with lower limit of detection of 0.328 fg mL, linear detection range in between 1 fg mL to 1 ng mL, sensitivity of 4.85 μA log [ng mL] cm with stability upto 7 weeks.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bioelechem.2021.107738DOI Listing
June 2021

Vaccine Formulation and Optimization for Human Herpes Virus-5 through an Immunoinformatics Framework.

ACS Pharmacol Transl Sci 2020 Dec 19;3(6):1318-1329. Epub 2020 Oct 19.

Department of Chemistry, University of Delhi, Delhi 110007, India.

In the current situation, the importance of vaccines for viral diseases has become the need of the hour. The scientific community in the field of virology has taken it upon themselves to develop vaccines for viral infections before an epidemic or pandemic situation arises. Human herpes virus-5 is an emerging situation that has alarming cases with major health concerns, including congenital impairments and infections leading to cancer states. Vaccination is the route most likely to succeed in the battleground with viral infections and consequences. Hence in the present manuscript, we have formulated the multiepitope subunit vaccine and optimized it with the advanced computational immunological framework. As a result, we report the subunit vaccine for HHV-5, comprised of promiscuous cytotoxic T-lymphocytes epitopes, helper T-lymphocytes, and B-cell epitopes engineered with putative adjuvants to ensure the strong immune response. The formulated subunit vaccine depicted high antigenicity and immunogenicity along with sustainable physicochemical characteristics. Molecular dynamics simulation analyses revealed the strong binding of the vaccine with MHC receptors (MHC-1 and MHC-2) and the virus progression specific membrane receptor TLR2 for a 100 ns MD simulation run. The interacting trajectory analysis of the vaccine showed stable binding with minimal deviations through RMSD, RMSF, and secondary structure confinement plot analyses for a long span of 100 ns. Interestingly, the vaccine showed robust immune response statistics for a prolonged time with evoking T-cell and B-cell populations with other vital players of the immune system, through the machine learning-based immune simulation approach. This study paved the way to a multiepitope vaccine for HHV-5 employing the immunoinformatics networks.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsptsci.0c00139DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7737318PMC
December 2020

Optimization of culture parameters for α-glucosidase production from suspension culture of moss Hyophilla nymaniana (Fleish.) Menzel.

J Genet Eng Biotechnol 2020 Dec 14;18(1):82. Epub 2020 Dec 14.

Department of Bio-Engineering Birla Institute of Technology Mesra, Ranchi, Jharkhand, 835215, India.

Background: Bryophytes, comprising of the second largest group in the plant kingdom, has attracted a great deal of attention in recent years due to its immense potential to produce biopharmaceuticals. But studies conducted to better understand their chemical composition are limited and scattered. In the present investigation, sequential optimization strategy, based on statistical experimental designs, was employed to enhance the production of α-glucosidase enzyme from moss Hyophilla nymaniana (Fleish.) Menzel by using Taguchi methodology. L16 orthogonal array and five physical parameters including sugar, temperature, pH, rpm, nitrogen source were considered as key parameters for enzyme production. The optimal level of each parameter for maximum glucosidase production by the moss was determined. Analysis of variance (ANOVA) was performed to evaluate statistically significant process factors.

Results: Based on statistical analysis (ANOVA), the optimal combinations of the major constituents of media for maximal α-glucosidase production were evaluated as follows: dextrose 2% contributed maximum on α-glucosidase production followed by ammonium nitrate 1.5%, temperature 24 °C, pH 5.6, and RPM 120. Predicted results showed an enhanced glucosidase (53%) than the basal production medium.

Conclusion: The present study highlighted that Taguchi design of experiments approach is better than the conventional optimization technique to determine the optimum level of each of the significant parameters that brings maximum enzyme production.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s43141-020-00098-8DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7736394PMC
December 2020

A comprehensive review on potential therapeutics interventions for COVID-19.

Eur J Pharmacol 2021 Jan 20;890:173741. Epub 2020 Nov 20.

Drug Discovery & Development Laboratory, Department of Chemistry, University of Delhi, Delhi, 110007, India; Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, Delhi, 110007, India. Electronic address:

COVID-19 is an infectious respiratory disease caused by SARS-CoV-2, a new beta coronavirus that emerged in Wuhan, China. Being primarily a respiratory disease, it is highly transmissible through both direct and indirect contacts. It displays a range of symptoms in different individuals and thus has been grouped into mild, moderate, and severe diseases. The virus utilizes spike proteins present on its surface to recognize ACE-2 receptors present on the host cells to enter the cell cytoplasm and replicate. The viral invasion of cells induces damage response, pyroptosis, infiltration of immune cells, expression of pro-inflammatory cytokines (cytokine storm), and activation of the adaptive immune system. Depending on viral load and host factors like age and underlying medical conditions, the immune responses mounted against SARS-CoV-2 may cause acute respiratory distress syndrome (ARDS), multiple organ failure, and death. In this review, we specify and justify both viral and host therapeutic targets that can be modulated to relieve the symptoms and treat the disease. Furthermore, we discuss vaccine development in the time of pandemic and the most promising vaccine candidates by far, according to WHO database. Finally, we discuss the conventional re-purposed drugs and potential alternative treatments as adjuvants.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ejphar.2020.173741DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7677683PMC
January 2021

Cytotoxic T-lymphocyte elicited therapeutic vaccine candidate targeting cancer against MAGE-A11 carcinogenic protein.

Biosci Rep 2020 12;40(12)

Department of Chemistry, University of Delhi, Delhi 110007, India.

Immunotherapy is a breakthrough approach for cancer treatment and prevention. By exploiting the fact that cancer cells have overexpression of tumor antigens responsible for its growth and progression, which can be identified and removed by boosting the immune system. In silico techniques have provided efficient ways for developing preventive measures to ward off cancer. Herein, we have designed a potent cytotoxic T-lymphocyte epitope to elicit a desirable immune response against carcinogenic melanoma-associated antigen-A11. Potent epitope was predicted using reliable algorithms and characterized by advanced computational avenue CABS molecular dynamics simulation, for full flexible binding with HLA-A*0201 and androgen receptor to large-scale rearrangements of the complex system. Results showed the potent immunogenic construct (KIIDLVHLL), from top epitopes using five algorithms. Molecular docking analyses showed the strong binding of epitope with HLA-A*0201 and androgen receptor with docking score of -780.6 and -641.06 kcal/mol, respectively. Molecular dynamics simulation analysis revealed strong binding of lead epitope with androgen receptor by involvement of 127 elements through atomic-model study. Full flexibility study showed stable binding of epitope with an average root mean square deviation (RMSD) 2.21 Å and maximum RMSD value of 6.48 Å in optimal cluster density area. The epitope also showed remarkable results with radius of gyration 23.0777 Å, world population coverage of 39.08% by immune epitope database, and transporter associated with antigen processing (TAP) affinity IC50 value of 2039.65 nm. Moreover, in silico cloning approach confirmed the expression and translation capacity of the construct within a suitable expression vector. The present study paves way for a potential immunogenic construct for prevention of cancer.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1042/BSR20202349DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7711063PMC
December 2020

Neuroinflammation Mechanisms and Phytotherapeutic Intervention: A Systematic Review.

ACS Chem Neurosci 2020 11 4;11(22):3707-3731. Epub 2020 Nov 4.

Drug Discovery and Development Laboratory, Department of Chemistry, University of Delhi, New Delhi-110007, India.

Neuroinflammation is indicated in the pathogenesis of several acute and chronic neurological disorders. Acute lesions in the brain parenchyma induce intense and highly complex neuroinflammatory reactions with similar mechanisms among various disease prototypes. Microglial cells in the CNS sense tissue damage and initiate inflammatory responses. The cellular and humoral constituents of the neuroinflammatory reaction to brain injury contribute significantly to secondary brain damage and neurodegeneration. Inflammatory cascades such as proinflammatory cytokines from invading leukocytes and direct cell-mediated cytotoxicity between lymphocytes and neurons are known to cause "collateral damage" in models of acute brain injury. In addition to degeneration and neuronal cell loss, there are secondary inflammatory mechanisms that modulate neuronal activity and affect neuroinflammation which can even be detected at the behavioral level. Hence, several of health conditions result from these pathogenetic conditions which are underlined by progressive neuronal function loss due to chronic inflammation and oxidative stress. In the first part of this Review, we discuss critical neuroinflammatory mediators and their pathways in detail. In the second part, we review the phytochemicals which are considered as potential therapeutic molecules for treating neurodegenerative diseases with an inflammatory component.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acschemneuro.0c00427DOI Listing
November 2020

DFT and docking studies of designed conjugates of noscapines & repurposing drugs: promising inhibitors of main protease of SARS-CoV-2 and falcipan-2.

J Biomol Struct Dyn 2022 04 3;40(6):2600-2620. Epub 2020 Nov 3.

Department of Zoology, Deen Dayal Upadhyaya College, University of Delhi, Delhi, India.

First case of the present epidemic, coronavirus disease (COVID-19) is reported in the Wuhan, a city of the China and all the countries throughout the world are being affected. COVID-19 is named by World Health Organization and it stands for coronavirus disease-19. As on 27 October, 2020, 73,776,588 people around the world are infected. It is also known as SARS-CoV-2 infection. Till date, there is no promising drug or vaccine available in market to cure from this lethal infection. As the literature reported that noscapine a promising candidate to cure from malaria as well reported to be cough suppressant and anti-cancerous. In our previous work, a derivative of noscapine has shown potential behavior against the main protease of novel coronavirus or SARS-CoV-2. Based on the previous study, hybrid molecules based on noscapine and repurposing (antiviral) drugs were designed to target the main protease of novel coronavirus and falcipan-2 using molecular docking. It is proposed that the designed hydrids or conjugates may have promising antiviral property i.e. against the main protease of novel coronavirus and falcipan-2. The designed molecules were thoroughly studied by DFT and different thermodynamic parameters were determined. Further, infrared and Raman spectra of the designed hybrid molecules were determined and studied. Communicated by Ramaswamy H. Sarma.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/07391102.2020.1841030DOI Listing
April 2022

Design and optimization of a subunit vaccine targeting COVID-19 molecular shreds using an immunoinformatics framework.

RSC Adv 2020 Sep 30;10(59):35856-35872. Epub 2020 Sep 30.

Department of Chemistry, University of Delhi Delhi 110007 India

COVID-19 has been declared as a global health emergency and exposed the world to a deadly virus, which has dramatically changed the lives of humans for an unknown period of time. In the battleground with the virus, we have employed an immunoinformatics framework to design a robust vaccine as an insurance plan for the future. The pathogenic sequence with cryptic epitope taken from patients in Wuhan, China, was harnessed to design a promiscuous cytotoxic T-lymphocyte, helper T-lymphocyte, and B-cell epitope based subunit vaccine, engineered with adjuvants and conformational linkers. The reported vaccine has high antigenicity and immunogenicity profiles with potential TAP affinity, which ensures elevated antigen processing capability. It has strong binding with major histocompatibility complex (MHC) receptors (MHC-1 and MHC-2) and virus-specific membrane receptor TLR-2, with scores of -1010.7, -1035.7, and -1076.3 kcal mol, respectively. Molecular dynamics simulation analysis was used to assess the stable binding with TLR-2 with minimal atomic motions through a deformation plot, covariance matrix, and elastic network. Importantly, an immunization assay showed the reliable elicitation of key players in terms of immune cells together with memory cells to evoke adaptive immune responses upon administration of the construct. In view of favorable outcomes, we also propose a plausible vaccine mechanism to elicit an immune response to fight coronavirus.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1039/d0ra06849gDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9056885PMC
September 2020

Fabrication of a Gold-Supported NiAlTi-Layered Double Hydroxide Nanocatalyst for Organic Transformations.

ACS Omega 2020 Sep 14;5(37):23967-23974. Epub 2020 Sep 14.

Drug Discovery & Development Laboratory, Department of Chemistry, University of Delhi, Delhi 110007, India.

This work is mainly focused on the synthesis of an efficient and reusable heterogeneous Au/NiAlTi layered double hydroxide (LDH) nanocatalyst and its applications in the preparation of biologically important xanthene, 1,4-dihydropyridine, polyhydroquinoline, and 4-pyran derivatives. NiAlTi LDH was designed hydrothermally and then gold was supported over the surface of LDH by using ion-exchange and NaBH reduction methods. The synthesized nanocatalyst was physicochemically characterized by X-ray diffractrometry, Fourier-transform infrared spectroscopy, thermogravimetric analysis, scanning electron microscopy, and transmission electron microscopy (TEM). The TEM images confirmed the support of gold nanoparticles over the surface of LDH with a size distribution of 7-9 nm. The well-characterized nanocatalyst was tested for the synthesis of biologically important xanthene, 1,4-dihydropyridine, polyhydroquinoline, and 4-pyran derivatives. The advantages obtained were excellent yields in a lesser reaction time. Stability and reusability were also accessed; the catalyst was stable even after five cycles. High catalytic efficiency, easy fabrication, and recycling ability of Au/NiAlTi LDH make it a potential catalyst for the synthesis of xanthene, 1,4-dihydropyridine, polyhydroquinoline, and 4-pyran derivatives.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsomega.0c03250DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7513357PMC
September 2020

High bio-recognizing aptamer designing and optimization against human herpes virus-5.

Eur J Pharm Sci 2021 Jan 25;156:105572. Epub 2020 Sep 25.

Drug Discovery & Development Laboratory, Department of Chemistry, University of Delhi, Delhi 110007, India; Dr. B. R. Ambedkar Centre for Biomedical Research University of Delhi, Delhi 110007, India. Electronic address:

While the world is tackling one of the direst health emergencies, it has come to light that in the fight against viruses, preparedness is everything. A disease with the initial symptoms of the common flu has the capacity to disrupt the life of 7.8 billion people and thus no infection and especially no virus can be ignored. Hence, we have designed the high bio-recognizing DNA aptamer for diagnosis and therapeutics role against glycoprotein-B (gB) of Human Herpes Virus-5 (HHV-5). HHV-5 is linked with epidemiological and asymptomatic diseases leading to high mortality. Herein, we report potent aptamer (5'CTCGCTTACCCCTGGGTGTGCGGG3') which has high specificity to gB with energy score -523.28 kJ/mol, more than reference aptamer L19 (-363.50 kJ/mol). The stable binding of aptamer with gB was confirmed with atomic fluctuations 0.1 to 1.8 Å through anisotropic network analysis. Aptamer formed stem-loop conformation (-1.0 kcal/mol) by stochastic simulation and found stable with physicochemical properties. Importantly, aptamer was found biologically significant with consisting of putative transcription factors in its vicinity (SP1, GATA1, AP2, NF1) and also possesses homology with exonic sequence of SGSH gene which indicated regulatory role in blockade of viruses. Inaddition, we also proposed plausible mechanism of action of aptamer as antiviral therapeutics.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ejps.2020.105572DOI Listing
January 2021

Disease surveillance during a large religious mass gathering in India: The Prayagraj Kumbh 2019 experience.

Int J Infect Dis 2020 Dec 24;101:167-173. Epub 2020 Sep 24.

World Health Organization India Office, Delhi, India. Electronic address:

Background: Mass gathering (MG) events are associated with public health risks. During the period January 14 to March 4, 2019, Kumbh Mela in Prayagraj, India was attended by an estimated 120 million visitors. An onsite disease surveillance was established to identify and respond to disease outbreaks.

Methods: A health coordination committee was established for planning. Disease surveillance was prioritized and risk assessment was done to identify diseases/conditions based on epidemic potential, severity of illness, and reporting requirement under the International Health Regulations (IHR) of 2005. A daily indicator and event-based disease surveillance was planned. The indicator-based surveillance (IBS) manually and electronically recorded data from patient hospital visits and collected MG area water testing data to assess trends. The event-based surveillance (EBS) helped identify outbreak signals based on pre-identified event triggers from the media, private health facilities, and the food safety department. Epidemic intelligence was used to analyse the data and events to detect signals, verify alerts, and initiate the response.

Results: At Kumbh Mela, disease surveillance was established for 22 acute diseases/syndromes. Sixty-five health facilities reported 156 154 illnesses (21% of a total 738 526 hospital encounters). Among the reported illnesses, 95% (n = 148 834) were communicable diseases such as acute respiratory illness (n = 52 504, 5%), acute fever (n = 41 957, 28%), and skin infections (n = 27 094, 18%). The remaining 5% (n = 7300) were non-communicable diseases (injuries n = 6601, 90%; hypothermia n = 224, 3%; burns n = 210, 3%). Water samples tested inadequate for residual chlorine in 20% of samples (102/521). The incident command centre generated 12 early warning signals from IBS and EBS: acute diarrheal disease (n = 8, 66%), vector-borne disease (n = 2, 16%), vaccine-preventable disease (n = 1, 8%), and thermal event (n = 1, 8%). There were two outbreaks (acute gastroenteritis and chickenpox) that were investigated and controlled.

Conclusions: This onsite disease surveillance imparted a public health legacy by successfully implementing an epidemic intelligence enabled system for early disease detection and response to monitor public health risks. Acute respiratory illnesses emerged as a leading cause of morbidity among visitors. Future MG events should include disease surveillance as part of planning and augment capacity for acute respiratory illness diagnosis and management.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ijid.2020.09.1424DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7513824PMC
December 2020

Recent advances in developing biosensing based platforms for neonatal sepsis.

Biosens Bioelectron 2020 Dec 25;169:112552. Epub 2020 Aug 25.

Amity Institute of Nanotechnology, Amity University, Noida, 201313, Uttar Pradesh, India. Electronic address:

Neonatal sepsis is a bloodstream infection primarily caused by Escherichia coli (E. coli), Group B Streptococcus (GBS), Listeria monocytogenes, Haemophilus influenzae, S. aureus, Klebsiella spp. and non-typhoidal Salmonella bacteria. Neonatal Sepsis is referred as a critical response to the infection in the neonatal period that can lead to the failure of body organs and thereby causing damage to the tissues resulting in death of the neonates. Nearly 4 million deaths across the world are occurred due to neonatal sepsis infections. In order to prevent the bloodstream infections in the neonates, it is indispensable to diagnose the disease properly for appropriate treatment during the point of care. Numerous studies have been reported to identify major biomarkers associated with neonatal sepsis including Serum Amyloid A (SAA), C - reactive protein (CRP), Procalcitonin (PCT) and Lipopolysaccharide-binding protein (LBP). Distinct diagnostic platforms have also been developed detecting the presence of bloodstream infections including electrochemical, potentiometric, and impedimetric sensors. Recently, electrochemical biosensors with the integration of nanomaterials have emerged as a better platform for neonatal sepsis biomarkers detection. This review article summarizes the diverse screening platforms, evaluation parameters, and new advances based on implications of nanomaterials for the development of biosensors detecting neonatal sepsis infections. The review further elucidates the significance and future scope of distinctive platforms which are predominantly associated with detection of neonatal sepsis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bios.2020.112552DOI Listing
December 2020
-->