Publications by authors named "R Thangavelu"

17 Publications

Prophylactic low dose ketamine infusion for prevention of shivering during spinal anesthesia: A randomized double blind clinical trial.

J Anaesthesiol Clin Pharmacol 2020 Oct-Dec;36(4):506-510. Epub 2021 Jan 18.

Department of Biostatistics, Pondicherry Institute of Medical Sciences, Pondicherry, India.

Background And Aims: Regional anesthesia is known to produce perioperative hypothermia and shivering. We aimed to evaluate if prophylactic low dose ketamine bolus followed by infusion would prevent intraoperative and postoperative shivering under spinal anesthesia.

Material And Methods: Sixty patients belonging to American Society of Anaesthesiologists (ASA) 1 and 2 undergoing abdominal and lower limb surgery were randomized to receive either 0.2 mg/kg iv of ketamine bolus followed by infusion 0.1 mg/kg/hr (Group K) or5 ml of saline followed by 0.1 ml/kg/hr solution (Group S) as an infusion throughout the period of surgery. The incidence of shivering was the primary outcome of the study with degree of sedation and the hemodynamic profile between the two groups being the secondary outcomes. Hemodynamics (Heart rate, Mean Blood Pressure and temperature), Grade of shivering and grade of sedation were assessed intraoperatively and for grade of shivering and sedation two hours postoperatively. Repeated measures Analysis of Variance (ANOVA) was used to compare the hemodynamic variables and Chisquare test/Fisher's exact test to compare the grades of shivering and sedation between the two groups.

Results: Intraoperative shivering was seen in eighteen patients in saline group (58.06%) and only with four patients (13.79%) with ketamine group ( < 0.001). Post operative shivering was also significantly less in ketamine group compared to saline ( = 0.01). Also, patients who received ketamine had significant sedation in the intraoperative period ( < 0.001).

Conclusion: Prophylactic low dose ketamine administered as a small bolus followed by an infusion was effective in preventing both intraoperative and postoperative shivering.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4103/joacp.JOACP_201_19DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8022048PMC
January 2021

Draft genome resource of a novel virulent Fusarium oxysporum f. sp. cubense Race 1 (VCG 0124) strain infecting Cavendish (AAA) group of bananas in India.

Plant Dis 2021 Mar 17. Epub 2021 Mar 17.

ICAR-National Research Centre for Banana, Crop Improvement, Tiruchirapalli, India;

Fusarium oxysporum f. sp. cubense (Foc) is one of the most destructive soil-borne fungi causing Fusarium wilt disease in banana. Generally, Foc race 1 (Foc R1) severely affects most of the banana varieties, except Cavendish bananas (AAA). Here we present the draft genome of an isolate of VCG 0124, a novel virulent Foc R1 strain that severely affects the Cavendish group of bananas isolated from Theni district of Tamil Nadu, India. The genome assembly of Foc R1 comprises 61,471,473 bp with 88 contigs and 18,377 protein-coding regions. The genome contains homologs of Foc race specific secreted in xylem (SIX) genes, SIX1, SIX5, SIX9 and SIX13. The absence of SIX4 and SIX6 and deletion of a peptide in SIX1 virulence factor genes in the Foc R1 (VCG0124) strain might be the contributing factor for strain infecting Cavendish bananas in India.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-12-20-2737-ADOI Listing
March 2021

First report of rhizome rot of banana caused by Klebsiella variicola in India.

Plant Dis 2021 Mar 5. Epub 2021 Mar 5.

ICAR-National Research Centre for Banana, Crop Improvement, Tiruchirapalli, India;

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-10-20-2316-PDNDOI Listing
March 2021

Identification of sources resistant to a virulent Fusarium wilt strain (VCG 0124) infecting Cavendish bananas.

Sci Rep 2021 Feb 4;11(1):3183. Epub 2021 Feb 4.

Laboratory of Tropical Crop Improvement, KU Leuven, Leuven, Belgium.

Bananas are vital for food security in many countries, and half of banana production relies solely on 'Cavendish' (AAA), which is presently threatened by the fungal pathogen Fusarium oxysporum f. sp. cubense (Foc) tropical race 4. This particular virulent Foc strain was also found to attack other banana varieties of commercial importance. As there is no single effective management practice available so far, this study was undertaken to determine resistant sources from the genotype collection available at the ICAR-National Research Centre for Banana, Tiruchirappalli, Tamil Nadu, India for direct use by farmers and/or in breeding programmes to develop resistant hybrids. A total of 258 genotypes of different ploidies and genomic constitutions were tested against Foc race 1 (VCG 0124). In total, 19 genotypes (AA Unique-6, BB type-2, AAA Unique-1, AAA Cavendish-1, AAB Mysore-3, AAB Pome-1, AAB Plantain-4 and AAAB-1) were found to be immune; eight genotypes (AA Unique-1, BB type-3, AAA Cavendish-1, AAB Mysore-1, AAB Unique-1, AAB Plantain-1) were highly resistant; and nine genotypes (AA Unique-1, AAA Cavendish-3, AAB Silk-1, AAB Pome-4) were resistant. The genotypes that are resistant to the virulent Foc race 1 (VCG 0124) strain can be exploited directly for commercialization and/or in breeding programs to develop resistant hybrids.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41598-021-82666-7DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7862490PMC
February 2021

First report of Fusarium oxysporum f.sp. cubense VCG 0125 and VCG 01220 of Race 1 infecting Cavendish bananas(Musa sp. AAA) in India.

Plant Dis 2020 Dec 2. Epub 2020 Dec 2.

ICAR-National Research Centre for Banana, Crop Improvement, Tiruchirapalli, India;

Fusarium wilt caused by Fusarium oxysporum f.sp. cubense (Foc) is the most devastating disease affecting commercial and subsistence cultivation of banana (Musa spp.) worldwide. Generally, the Cavendish bananas are resistant to Foc race 1 that destroyed cv. 'Gros Michel' (AAA) and susceptible to tropical race 4 (TR4), which is causing severe epidemics in different banana-growing countries including India (Thangavelu et al. 2019). In 2019, a roving survey was conducted in major banana growing states of India such as Bihar, Uttar Pradesh, Gujarat and Tamil Nadu to assess the incidence of Fusarium wilt disease in Cavendish bananas and also to characterize the pathogens by different methods including Vegetative Compatibility Grouping (VCG) and molecular methods. The Fusarium wilt incidence in cv. Grand Naine (Cavendish group-AAA) was 6-65% in Bihar, 30-45% in Uttar Pradesh, 5-15% in Gujarat and 15- 21% in Tamil Nadu. For characterization, a total of 61 samples from the Fusarium wilt infected Cavendish bananas were collected and single spore culture of Foc was obtained. The morphological characterization revealed the presence of one to two oval- to kidney-shaped cells in false heads and sickle-shaped macroconidia and a foot-shaped basal cell. The pathogenicity was demonstrated by adopting randomized block design with five replications on cv. Grand Naine. The Koch's postulate was successfully completed by re-isolation of the inoculated Foc pathogen and characterization by PCR method. The VCG analysis carried out using nit-M testers of all known VCGs indicated the presence of VCG 0125 from the Foc samples collected from cv. Grand Naine grown in Uttar Pradesh (Siswabazar of Maharakanj district) and Tamil Nadu (Cumbum of Theni district), VCG 01220 from the Foc samples collected from cv. Grand Naine grown in Uttar Pradesh (Siswabazar of Maharakanj district) and Gujarat (Kamrej of Surat district,) and VCG 01213/16 from Foc samples collected from Uttar Pradesh (Siswabazar of Maharakanj district) and Bihar (Falka village of Katihar district) . The molecular confirmation of these VCGs 0125, and 01220 (Foc R1) isolates was carried out by PCR method using the primer set SIX6b_210_F and SIX6b_210_R (Carvalhais et al. 2019) for Foc R1, primer sets Foc TR4-F & Foc TR4 -R (Dita et al. 2010) for Foc TR4 and primer set Foc-1/Foc -2 (Lin et al. 2009) for Race 4. The results showed that only the primer set for Foc R1 has generated the expected amplicon size of 210 bp in the Foc isolates of VCG 0125 and 01220. Besides, the sequencing of Translation Elongation Factor (TEF) 1-α gene and BLAST searches in Genbank for the representative Foc isolates of VCG 0125 (Genbank no. MW 286800) showed 99.84% similarity to Foc R1 (KX365393.1) and Foc isolates of VCG 01220 (Genbank no. MW 286803) showed 99.69% similarity to Foc R1 (KX365413.1). Further, a phylogenetic analysis performed using the TEF1-α gene sequences showed that the Foc race 1 isolates (VCGs 0125 and 01220) from India were grouped with known Foc race 1 isolates from Tanzania and Australia. Based on the experimental results the study has confirmed the presence of VCGs 0125 and 01220 of Foc Race 1 in cv. Grand Naine in India. As these VCGs are most widely distributed and do not found to infect Cavendish bananas so far (Mostert et al. 2017), this report is very important from the quarantine and management perspectives. To the best of our knowledge, this is the first report of the occurrence of VCGs 0125 and 01220 of Foc Race 1 in cv. Grand Naine in India.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-09-20-2052-PDNDOI Listing
December 2020