Publications by authors named "Ping Hou"

159 Publications

Shenxian-Shengmai Oral Liquid Improves Sinoatrial Node Dysfunction through the PKC/NOX-2 Signaling Pathway.

Evid Based Complement Alternat Med 2021 10;2021:5572140. Epub 2021 Apr 10.

Department of Cardiology, Affiliated Hospital of Liaoning University of Traditional Chinese Medicine, Shenyang, China.

Sick sinus syndrome (SSS) is one of the common causes of cardiac syncope and sudden death; the occurrence of SSS is associated with the accumulation of ROS in the sinoatrial node (SAN). Shenxian-shengmai (SXSM) is a traditional Chinese medicine available as oral liquid that causes a significant increase in heart rate. The objective of this study is to observe the improvement of SXSM on SAN function in SSS mice and explore its potential mechanism. In the current study, SSS was simulated in mice by inducing SAN dysfunction using a micro-osmotic pump to inject angiotensin II (Ang II). The mouse model with SSS was used to determine the effect of SXSM on SAN function and to explore its potential mechanism. Furthermore, the HL-1 cell line, derived from mouse atrial myocytes, was used to simulate SAN pacemaker cells. Our results indicated that SXSM significantly increased the heart rate of SSS mice by reducing the AngII-induced accumulation of ROS in the SAN and by inhibiting the expression of HDAC4, thereby reducing the loss of HCN4, a critical component of the cardiac conduction system. MASSON staining revealed a reduction of SAN damage in SSS mice that were treated with SXSM compared with controls. In vitro experiments showed that AngII treatment caused an upregulation of the PKC/NOX-2 signaling pathway in HL-1 cells which could be prevented by pretreatment with SXSM. The protective effect of SXSM was attenuated upon treatment with the PCK agonist PMA. In conclusion, SXSM reduced the AngII-induced accumulation of ROS in the SAN through the PKC/NOX2 signaling pathway, improving the functioning of the SAN and preventing the decrease of heart rate in SSS mice.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2021/5572140DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8055400PMC
April 2021

Potential Roles of Oral Microbiota in the Pathogenesis of Immunoglobin A Nephropathy.

Front Cell Infect Microbiol 2021 2;11:652837. Epub 2021 Apr 2.

Renal Division, Peking University First Hospital, Peking University Institute of Nephrology, Key Laboratory of Renal Disease, Ministry of Health of China, Key Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education, Beijing, China.

Disturbance in microbiota affects the mucosal immune response, and it is gradually recognized to be associated with the Immunoglobin A nephropathy (IgAN). This study aims to explore the potential roles of oral microbiota in disease pathogenesis. Saliva samples were collected from 31 patients with IgAN and 30 controls for 16S rRNA gene sequencing. The evenness, diversity, and composition of oral microbiota were analyzed. Moreover, sub-phenotype association analysis was conducted. Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) database was used to investigate microbiota functions. Compared to healthy controls, microbial diversity tended to decrease in IgAN, and the microbial profiles were remarkably distinguished. The relative abundance of and were enriched, whereas 17 genera, such as , were significantly reduced in IgAN. Variable importance in projection scores showed that 12 genera, including , , and , could discriminate between the two groups. In the sub-phenotype correlation analysis, the relative abundance of and was positively associated with levels of proteinuria and serum IgA, respectively. Further metabolic pathway analysis showed 7 predictive functional profiles, including glycosphingolipid biosynthesis, oxidative phosphorylation, and N-glycan biosynthesis were enriched in IgAN. In conclusion, disturbance in oral microbiota was observed to be associated with IgAN and its sub-phenotypes, which may shed novel insights into disease pathogenesis from a microbiome perspective.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fcimb.2021.652837DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8050349PMC
April 2021

COVID-19 Quarantine Reveals Behavioral Changes Effect on Myopia Progression.

Ophthalmology 2021 Apr 12. Epub 2021 Apr 12.

School of Ophthalmology & Optometry and Eye Hospital, Wenzhou Medical University, Wenzhou, 325027, China; State Key Laboratory of Ophthalmology, Optometry and Visual Science, Wenzhou, 325027, China; National Clinical Research Center for Ocular Disease, Wenzhou, 325027, China.

COVID-19 quarantine provides the largest intervention data of myopia progression in schoolchildren. We found grade is an important risk factor, and COVID-19-induced modifications of student's online time and outdoor activity time sufficiently change myopia progression.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ophtha.2021.04.001DOI Listing
April 2021

Whole-exome sequencing reveals the etiology of the rare primary hepatic mucoepidermoid carcinoma.

Diagn Pathol 2021 Apr 8;16(1):29. Epub 2021 Apr 8.

Department of Hepatobiliary and Pancreatic Surgery, The Second Affiliated Hospital of Nanchang University, No.1, Minde Road, Nanchang, China.

Background: Primary hepatic mucoepidermoid carcinoma (HMEC) is extremely rare and the molecular etiology is still unknown. The CRTC1-MAML2 fusion gene was previously detected in a primary HMEC, which is often associated with MEC of salivary gland in the literature.

Methods: A 64-year-old male was diagnosed with HMEC based on malignant squamous cells and mucus-secreting cells in immunohistochemical examination. Fluorescence in situ hybridization (FISH) was used to detect the CRTC1-MAML2 fusion gene in HMEC. Whole-exome sequencing and Sanger sequencing were used to reveal the molecular characteristics of HMEC and analysis was performed with public data. Pedigree investigation was performed to identify susceptibility genes.

Results: Hematoxylin-eosin staining and immunohistochemistry revealed that the tumor cells were composed of malignant epidermoid malignant cells and mucous cells, indicating a diagnosis of HMEC. The CRTC1-MAML2 fusion gene was not detected in the primary HMEC, and somatic mutations in GNAS, KMT2C and ELF3 genes were identified by sequencing. Analyses of public data revealed somatic GNAS alterations in 2.1% hepatobiliary tumors and relation with parasite infection. Heterozygous germline mutations of FANCA, FANCI, FANCJ/BRIP1 and FAN1 genes were also identified. Pedigree investigation verified that mutation of Fanconi's anemia susceptibility genes were present in the pedigree.

Conclusions: Here we provide the first evidence of the molecular etiology of a rare HMEC associated with germline Fanconi's anemia gene mutations and somatic GNAS R201H mutation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s13000-021-01086-3DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8034126PMC
April 2021

A Functional Variant rs3093023 in Is Associated With IgA Nephropathy by Regulating Th17 Cells in a North Han Chinese Population.

Front Immunol 2021 25;12:600598. Epub 2021 Feb 25.

Renal Division, Department of Medicine, Peking University First Hospital, Beijing, China.

C-C chemokine receptor 6 () is a susceptibility gene of various immune-related diseases, which was suggested to be shared with immunoglobulin A nephropathy (IgAN). In this study, we aimed to identify the functional variants. First, we analyzed the associations of common and rare variants detected by multi-platform chips with IgAN susceptibility using imputation and identified 68 significantly associated common variants located in the regulatory region. Among them, rs3093023 showed both statistical significance (rs3093023-A, odds ratio [OR] = 1.15, = 2.00 × 10) and the expression quantitative trait loci (eQTL) effect ( = 1.45 × 10). It was independently replicated (rs3093023-A, OR = 1.18, = 5.56 × 10) and the association was reinforced in the meta-analysis (rs3093023-A, OR = 1.17, = 6.14 × 10). Although rs3093023 was in a strong linkage disequilibrium with the reported functional variant dinucleotide polymorphism, , the alleles of rs3093023 (G>A) rather than of were shown differential nuclear protein binding effect by electrophoretic mobility shift assay. The RegulomeDB and JASPAR databases predicted Pou2f1 as the potential transcription factor, which was negatively associated with mRNA ( = -0.60, = 3.94 × 10). At the mRNA level, the eQTL effect of was validated ( = 4.39 × 10), and was positively associated with the expression of and rather than that of and . At the protein level, a higher CCR6 cell ratio was observed in a risk allele dose-dependent manner in lymphocytes ( = 3.57 × 10), CD3 T cells ( = 4.54 × 10), and CD4 T cells ( = 1.32 × 10), but not in CD8 T cells. Clinical-pathological analysis showed that rs3093023 risk allele was significantly associated with diastolic blood pressure, serum creatinine, and high ratio of tubular atrophy/interstitial fibrosis. Overall, the rs3093023 was prioritized as the function variant in , which may contribute to IgAN susceptibility by regulating Th17 cells.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fimmu.2021.600598DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7946973PMC
February 2021

Interaction between and Associates with Galactose-Deficient IgA1 and IgA Nephropathy.

J Am Soc Nephrol 2021 Mar 16;32(3):545-552. Epub 2021 Feb 16.

Renal Division, Peking University First Hospital, Beijing, China

Background: Galactose-deficient IgA1 plays a key role in the pathogenesis of IgA nephropathy, the most common primary GN worldwide. Although serum levels of galactose-deficient IgA1 have a strong genetic component, the genetic link between this molecule and IgA nephropathy has not yet been clearly established.

Methods: To identify novel loci associated with galactose-deficient IgA1, we performed a quantitative genome-wide association study for serum galactose-deficient IgA1 levels, on the basis of two different genome-wide association study panels conducted in 1127 patients with IgA nephropathy. To test genetic associations with susceptibility to IgA nephropathy, we also enrolled 2352 patients with biopsy-diagnosed IgA nephropathy and 2632 healthy controls. Peripheral blood samples from 59 patients and 27 healthy controls were also collected for gene expression analysis.

Results: We discovered two loci, in and that achieved genome-wide significance, explaining about 3.7% and 3.4% of variance in serum galactose-deficient IgA1 levels, respectively. We confirmed the previously reported association of with serum galactose-deficient IgA1 levels, but with a different lead single-nucleotide polymorphism (rs10238682; β=0.26, =1.20×10); the locus we identified at (rs7856182; β=0.73, =2.38×10) was novel. Of more interest, we found that exhibits genetic interactions with in both galactose-deficient IgA1 levels (=1.40×10) and disease risk (=6.55×10). mRNA expression in patients with IgA nephropathy was significantly lower compared with healthy controls.

Conclusions: Our data identify as a novel gene associated with galactose-deficient IgA1 and suggest novel genetic interactions. These findings support a key role of genetically conferred dysregulation of galactose-deficient IgA1 in the development of IgA nephropathy.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1681/ASN.2020060823DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7920185PMC
March 2021

Effect of brain normalization methods on the construction of functional connectomes from resting-state functional MRI in patients with gliomas.

Magn Reson Med 2021 Jul 2;86(1):487-498. Epub 2021 Feb 2.

Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, Houston, Texas, USA.

Purpose: Spatial normalization is an essential step in resting-state functional MRI connectomic analysis with atlas-based parcellation, but brain lesions can confound it. Cost-function masking (CFM) is a popular compensation approach, but may not benefit modern normalization methods. This study compared three normalization methods with and without CFM and determined their impact on connectomic measures in patients with glioma.

Methods: Fifty patients with glioma were included. T -weighted images were normalized using three different methods in SPM12, with and without CFM, which were then overlaid on the ICBM152 template and scored by two neuroradiologists. The Dice coefficient of gray-matter correspondence was also calculated. Normalized resting-state functional MRI data were parcellated using the AAL90 atlas to construct an individual connectivity matrix and calculate connectomic measures. The R among the different normalization methods was calculated for the connectivity matrices and connectomic measures.

Results: The older method (Original) performed significantly worse than the modern methods (Default and DARTEL; P < .005 in observer ranking). The use of CFM did not significantly improve the normalization results. The Original method had lower correlation with the Default and DARTEL methods (R = 0.71-0.74) than Default with DARTEL (R = 0.96) in the connectivity matrix. The clustering coefficient appears to be the most, and modularity the least, sensitive connectomic measures to normalization performance.

Conclusion: The spatial normalization method can have an impact on resting-state functional MRI connectome and connectomic measures derived using atlas-based brain parcellation. In patients with glioma, this study demonstrated that Default and DARTEL performed better than the Original method, and that CFM made no significant difference.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/mrm.28690DOI Listing
July 2021

Delicate Control on the Shell Structure of Hollow Spheres Enables Tunable Mass Transport in Water Splitting.

Angew Chem Int Ed Engl 2021 Mar 18;60(13):6926-6931. Epub 2021 Feb 18.

State Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, 1 North 2nd Street, Zhongguancun, Haidian District, Beijing, 100190, P. R. China.

In the study of structure-property relationships for rational materials design, hollow multishell structures (HoMSs) have attracted tremendous attention owing to the optimal balance between mass transfer and surface exposure. Considering the shell structure can significantly affect the properties of HoMSs, in this paper, we provide a novel one-step strategy to continually regulate the shell structures of HoMSs. Through a simple phosphorization process, we can effectively modify the shell from solid to bubble-like and even duplicate the shells with a narrow spacing. Benefitting from the structure merits, the fabricated CoP HoMSs with close duplicated shells can promote gas release owing to the unbalanced Laplace pressure, while accelerating liquid transfer for enhanced capillary force. It can provide effective channels for water and gas and thus exhibits a superior electrocatalytic performance in the hydrogen and oxygen evolution reaction.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/anie.202016285DOI Listing
March 2021

Exome Chip Analyses and Genetic Risk for IgA Nephropathy among Han Chinese.

Clin J Am Soc Nephrol 2021 Feb 18;16(2):213-224. Epub 2021 Jan 18.

Renal Division, Peking University First Hospital, Peking University Institute of Nephrology, Beijing, People's Republic of China

Background And Objectives: IgA nephropathy is the most common form of primary GN worldwide. The evidence of geographic and ethnic differences, as well as familial aggregation of the disease, supports a strong genetic contribution to IgA nephropathy. Evidence for genetic factors in IgA nephropathy comes also from genome-wide association patient-control studies. However, few studies have systematically evaluated the contribution of coding variation in IgA nephropathy.

Design, Setting, Participants, & Measurements: We performed a two-stage exome chip-based association study in 13,242 samples, including 3363 patients with IgA nephropathy and 9879 healthy controls of Han Chinese ancestry. Common variant functional annotation, gene-based low-frequency variants analysis, differential mRNA expression, and gene network integration were also explored.

Results: We identified three non-HLA gene regions (, , and ) and one HLA gene region () with suggestive significance ( <5×10) in single-variant associations. These novel non-HLA variants were annotated as expression-associated single-nucleotide polymorphisms and were located in enhancer regions enriched in histone marks H3K4me1 in primary B cells. Gene-based low-frequency variants analysis suggests as another potential susceptibility gene. Further combined expression and network integration suggested that the five novel susceptibility genes, , , , , and , were involved in IgA nephropathy.

Conclusions: Five novel gene regions with suggestive significance for IgA nephropathy were identified and shed new light for further mechanism investigation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2215/CJN.06910520DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7863642PMC
February 2021

miR-124-3p combined with miR-506-3p delay hepatic carcinogenesis via modulating sirtuin 1.

Biomarkers 2021 May 18;26(3):196-206. Epub 2021 Feb 18.

Department of Hepatobiliary Surgery, The Second Affiliated Hospital of Nanchang University, Nanchang, China.

Objective: Our study aimed at exploring whether miR-124-3p and miR-506-3p collaboratively modulated sirtuin 1 (SIRT1) protein expression in liver cancer. In this study, cell viability, migration and invasion were assessed using CCK8 and transwell assays, respectively. Immunohistochemical (IHC) staining and immunoblotting analysis were performed to evaluate SIRT1 protein expression levels in tissue specimens and cell lines. Moreover, the nude-mouse transplanted tumour model was used to assess liver cancer cell growth . Our results showed that SIRT1 protein levels were significantly up-regulated in liver cancer tissues and cancerous cell lines. Conversely, miR-124-3p and miR-506-3p were down-regulated in liver cancer tissues and cell lines. The protein expression of SIRT1 was significantly declined in HepG2 and SMMC7721 cells after transfection with miR-124-3p or miR-506-3p mimics. miR-124-3p and miR-506-3p collaboratively caused a marked inhibition of liver cancer cell growth, migration and invasion, while the phenomena were neutralized by overexpression of SIRT1. experimental measurements also revealed that miR-124-3p and miR-506-3p synergistically inhibited SIRT1 protein expression and tumour growth in the nude-mouse transplanted tumour model. It was observed that miR-124-3p and miR-506-3p could cooperatively retard liver cancer cell growth via co-inhibiting SIRT1 protein expression.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/1354750X.2020.1854856DOI Listing
May 2021

Machine learning-based integrative analysis of methylome and transcriptome identifies novel prognostic DNA methylation signature in uveal melanoma.

Brief Bioinform 2020 Dec 26. Epub 2020 Dec 26.

School of Biomedical Engineering, Wenzhou Medical University.

Uveal melanoma (UVM) is the most common primary intraocular human malignancy with a high mortality rate. Aberrant DNA methylation has rapidly emerged as a diagnostic and prognostic signature in many cancers. However, such DNA methylation signature available in UVM remains limited. In this study, we performed a genome-wide integrative analysis of methylome and transcriptome and identified 40 methylation-driven prognostic genes (MDPGs) associated with the tumorigenesis and progression of UVM. Then, we proposed a machine-learning-based discovery and validation strategy to identify a DNA methylation-driven signature (10MeSig) composing of 10 MDPGs (AZGP1, BAI1, CCDC74A, FUT3, PLCD1, S100A4, SCN8A, SEMA3B, SLC25A38 and SLC44A3), which stratified 80 patients of the discovery cohort into two risk subtypes with significantly different overall survival (HR = 29, 95% CI: 6.7-126, P < 0.001). The 10MeSig was validated subsequently in an independent cohort with 57 patients and yielded a similar prognostic value (HR = 2.1, 95% CI: 1.2-3.7, P = 0.006). Multivariable Cox regression analysis showed that the 10MeSig is an independent predictive factor for the survival of patients with UVM. With a prospective validation study, this 10MeSig will improve clinical decisions and provide new insights into the pathogenesis of UVM.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/bib/bbaa371DOI Listing
December 2020

injection decreases drainage in lateral neck dissection for metastatic thyroid cancer.

Gland Surg 2020 Oct;9(5):1543-1550

Thyroid and Parathyroid Surgery Center, West China Hospital, Sichuan University, Chengdu, China.

Background: injection (PAI) has been proven effective against chylous fistula but not in decreasing drainage after lateral neck dissection (LND). To verify the safety of spraying PAI onto the surface of the traumatic cavity after total thyroidectomy with LND and to evaluate whether its application can reduce the drainage volume.

Methods: A total of 85 patients with metastatic papillary thyroid cancer (PTC) who agreed to total thyroidectomy with unilateral LND were recruited from March 2016 to September 2017. During the operation, PAI was applied in 44 patients, while 41 remaining patients served as the control group. The thyroid function and parathyroid function, drainage volume, hospital stay, and incidence of complications were compared between the two groups.

Results: The groups had few differences in age, gender, BMI, thyroid function, parathyroid function, diameter of tumor, and the number of the harvested lymph nodes. The median total drainage volume was significantly smaller and the mean hospital stay was obviously shorter in the PAI group compared to the non-PAI group. But the median volumes of peak 24-hour drainage which appeared during the first day after operation had few differences in the two groups. Postoperative fever in the PAI group was higher than in the non-PAI group. None of the patients had permanent recurrent laryngeal nerve paralysis and tumor recurrence on the 12 month after operation.

Conclusions: The application of PAI to the wound cavity after LND is safe and effective for reducing the drainage volume and hospital stay.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.21037/gs-20-731DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7667085PMC
October 2020

Impact of innovative education on the professionalism of undergraduate nursing students in China.

Nurse Educ Today 2021 Mar 1;98:104647. Epub 2020 Nov 1.

School of Nursing, Yangzhou University, Yangzhou, Jiangsu, China. Electronic address:

Aim: To explore the relationships among innovative atmosphere, innovative behavior, professional self-efficacy, professional identity, and professionalism of undergraduate nursing students in China.

Background: In lieu of the global shortage of nurses and low professional willingness of nursing students, innovative qualities are closely related to the professionalism of nurses.

Methods: The participants of this cross-sectional study consisted of 320 nursing students recruited from the Nursing College of a comprehensive university in Jiangsu Province, China who voluntarily completed an anonymous questionnaire from May to October 2019. Structural equation modeling analyses were performed.

Results: There was a positive correlation between all hypothetical pairwise variables (r = 0.496-0.795, p < 0.01). The final research model fits well. The results revealed that innovation atmosphere had a positive effect on innovative behavior and innovative behavior could affect nursing professionalism through self-efficacy and identity.

Conclusion: Innovative education plays a very important role in the professionalism of undergraduate nursing students. Nursing educators can promote the development of professionalism in future nurses by fostering innovative behaviors.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.nedt.2020.104647DOI Listing
March 2021

Alterations in Functional Connectomics Associated With Neurocognitive Changes Following Glioma Resection.

Neurosurgery 2021 02;88(3):544-551

Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, Houston, Texas.

Background: Decline in neurocognitive functioning (NCF) often occurs following brain tumor resection. Functional connectomics have shown how neurologic insults disrupt cerebral networks underlying NCF, though studies involving patients with brain tumors are lacking.

Objective: To investigate the impact of brain tumor resection upon the connectome and relationships with NCF outcome in the early postoperative period.

Methods: A total of 15 right-handed adults with left perisylvian glioma underwent resting-state functional magnetic resonance imaging (rs-fMRI) and neuropsychological assessment before and after awake tumor resection. Graph theoretical analysis was applied to rs-fMRI connectivity matrices to calculate network properties. Network properties and NCF measures were compared across the pre- to postoperative periods with matched pairs Wilcoxon signed-rank tests. Associations between pre- to postoperative change in network and NCF measures were determined with Spearman rank-order correlations (ρ).

Results: A majority of the sample showed postoperative decline on 1 or more NCF measures. Significant postoperative NCF decline was found across measures of verbal memory, processing speed, executive functioning, receptive language, and a composite index. Regarding connectomic properties, betweenness centrality and assortativity were significantly smaller postoperatively, and reductions in these measures were associated with better NCF outcomes. Significant inverse associations (ρ = -.51 to -.78, all P < .05) were observed between change in language, executive functioning, and learning and memory, and alterations in segregation, centrality, and resilience network properties.

Conclusion: Decline in NCF was common shortly following resection of glioma involving eloquent brain regions, most frequently in verbal learning/memory and executive functioning. Better postoperative outcomes accompanied reductions in centrality and resilience connectomic measures.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/neuros/nyaa453DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7884148PMC
February 2021

High Throughput Risk and Impact Screening of Chemicals in Consumer Products.

Risk Anal 2021 Apr 18;41(4):627-644. Epub 2020 Oct 18.

Quantitative Sustainability Assessment, Department of Technology, Management and Economics, Technical University of Denmark, 2800 Kgs, Lyngby, Denmark.

The ubiquitous presence of more than 80,000 chemicals in thousands of consumer products used on a daily basis stresses the need for screening a broader set of chemicals than the traditional well-studied suspect chemicals. This high-throughput screening combines stochastic chemical-product usage with mass balance-based exposure models and toxicity data to prioritize risks associated with household products. We first characterize product usage using the stochastic SHEDS-HT model and chemical content in common household products from the CPDat database, the chemical amounts applied daily varying over more than six orders of magnitude, from mg to kg. We then estimate multi-pathways near- and far-field exposures for 5,500 chemical-product combinations, applying an extended USEtox model to calculate product intake fractions ranging from 0.001 to ∼1, and exposure doses varying over more than nine orders of magnitude. Combining exposure doses with chemical-specific dose-responses and reference doses shows that risks can be substantial for multiple home maintenance products, such as paints or paint strippers, for some home-applied pesticides, leave-on personal care products, and cleaning products. Sixty percent of the chemical-product combinations have hazard quotients exceeding 1, and 9% of the combinations have lifetime cancer risks exceeding 10 . Population-level impacts of household products ingredients can be substantial, representing 5 to 100 minutes of healthy life lost per day, with users' exposures up to 10 minutes per day. To address this issue, present mass balance-based models are already able to provide exposure estimates for both users and populations. This screening study shows large variations of up to 10 orders of magnitude in impact across both chemicals and product combinations, demonstrating that prioritization based on hazard only is not acceptable, since it would neglect orders of magnitude variations in both product usage and exposure that need to be quantified. To address this, the USEtox suite of mass balance-based models is already able to provide exposure estimates for thousands of product-chemical combinations for both users and populations. The present study calls for more scrutiny of most impacting chemical-product combinations, fully ensuring from a regulatory perspective consumer product safety for high-end users and using protective measures for users.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/risa.13604DOI Listing
April 2021

TOP2A and CENPF are synergistic master regulators activated in cervical cancer.

BMC Med Genomics 2020 10 6;13(1):145. Epub 2020 Oct 6.

Department of Laboratory, Hangzhou Jianggan District People's Hospital, Hangzhou, Zhejiang, China.

Background: Identification of master regulators (MRs) using transcriptome data in cervical cancer (CC) could help us to develop biomarkers and find novel drug targets to fight this disease.

Methods: We performed differential expression (DE) analyses of public microarray and RNA-seq transcriptome data of CC and normal cervical tissues (N). Virtual Inference of Protein activity by Enriched Regulon analysis (VIPER) was used to convert the DE outcomes to differential activity (DA) signature for MRs. Synergy analysis was conducted to study synergistic effect of MR-pairs. TCGA and microarray data were used to test the association of expression of a MR and a clinical feature or a molecular feature (e.g. somatic mutations). Various bioinformatic tools/websites (DAVID, GEPIA2, Oncomine, cBioPortal) were used to analyze the expression of the top MRs and their regulons.

Results: Ten DE and 10 DA signatures were generated for CC. Two MRs, DNA topoisomerase II alpha (TOP2A) and centromere protein F (CENPF) were found to be up-regulated, activated and synergistic in CC compared to N across the 10 datasets. The two MRs activate a common set of genes (regulons) with functions in cell cycle, chromosome, DNA damage etc. Higher expression of CENPF was associated with metastasis. High expression of both MRs is associated with somatic mutation of a set of genes including tumor suppressors (TP53, MSH2, RB1) and genes involved in cancer pathways, cell cycle, DNA damage and repair. The magnitude of up-regulation and the absolute expression level of both MRs in CC are significantly higher compared to many other cancer types.

Conclusion: TOP2A and CENPF are a synergistic pair of MRs that are overexpressed and activated in CC. Their high expression is correlated with some prognosis features (e.g. metastasis) and molecular features (e.g. somatic mutations) and distinctly high in CC vs. many other cancer types. They may be good biomarkers and anticancer drug targets for CC.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12920-020-00800-2DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7541258PMC
October 2020

Prognostic value of pretreatment contrast-enhanced computed tomography in esophageal neuroendocrine carcinoma: A multi-center follow-up study.

World J Gastroenterol 2020 Aug;26(31):4680-4693

Department of Radiology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, Henan Province, China.

Background: The rare incidence of esophageal neuroendocrine carcinoma (NEC) and limited treatment experience result in insufficient clinical observations and unsuitable guidelines for its management.

Aim: To investigate the prognostic value of pretreatment contrast-enhanced computed tomography (CT) characteristics in patients with esophageal NEC.

Methods: Seventy-seven esophageal NEC patients who received contrast-enhanced CT at two hospitals were enrolled in this study from June 2014 to December 2019. The clinical features and image characteristics were recorded accordingly. Univariate survival analysis was performed using the Kaplan-Meier method and log-rank test, and multivariate analysis was carried out with a Cox proportional hazards model.

Results: The multivariate analysis performed using the Cox proportional hazards model showed that N stage, adjuvant chemotherapy, and degree of enhancement were independent prognostic factors for overall survival (OS). Meanwhile, adjuvant chemotherapy was an independent prognostic factor for progression-free survival (PFS). The hazard ratios (HRs) of N stage, adjuvant chemotherapy, and degree of enhancement (mild moderate/marked) for OS were 0.426 ( = 0.024), 3.862 ( = 0.006), and 2.169/0.809 ( = 0.037), respectively. The HR of adjuvant chemotherapy for PFS was 6.432 ( < 0.001). Adjuvant chemotherapy was significantly associated with degree of enhancement ( = 0.018).

Conclusion: Adjuvant chemotherapy is an independent prognostic factor for OS and PFS. Additionally, N stage and degree of enhancement are prognostic factors for OS in patients with esophageal NEC.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3748/wjg.v26.i31.4680DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7445868PMC
August 2020

Primary hepatic malignant vascular tumors: a follow-up study of imaging characteristics and clinicopathological features.

Cancer Imaging 2020 Aug 14;20(1):59. Epub 2020 Aug 14.

Department of Radiology, The First Affiliated Hospital of Zhengzhou University, No. 1 East Jianshe Road, Zhengzhou, Henan, China.

Background: Owing to its low incidence, there is insufficient clinical awareness and diagnostic experience with primary hepatic malignant vascular tumors (PHMVTs). The aim of our study was to investigate the imaging and clinicopathological features of patients with PHMVTs and analyze the clinicopathological correlations.

Methods: We retrospectively analyzed 42 patients who had pathologically confirmed PHMVT during the period from June 2012 to December 2019 and enrolled them in our study. The computed tomography (CT) and magnetic resonance (MR) images and pathological findings of each patient were recorded.

Results: There were more female (29/42) than male patients. The imaging features of primary hepatic angiosarcoma (PHA) (n = 11) included ill-defined margins (11/11, 100%), necrosis (5/11, 45%), calcification (3/11, 27%) and "slow in-slow out" centripetal enhancement (7/11, 64%). Patients with epithelioid hemangioendothelioma (EHE) (n = 15) presented with ill-defined margins (15/15, 100%), necrosis (6/15, 40%), calcification (2/15, 13%), "fast in-slow out" centripetal enhancement (10/15, 67%), halo sign (15/15, 100%), pseudocapsule sign (4/15, 27%), lollipop sign (2/15, 13%) and capsule retraction sign (2/15, 13%). Patients with malignant hemangiopericytoma (MHP) (n = 3) showed ill-defined margins (3/3, 100%), necrosis (3/3, 100%) and "fast in-slow out" progressive enhancement (3/3, 100%). Infantile hemangioendotheliomas (IHEs) (n = 13) were defined by ill-defined margins (7/13, 54%), necrosis (8/13, 62%), calcification (5/13, 38%) and "fast in-slow out" centripetal enhancement (13/13, 100%). Immunohistochemistry showed strong positive expression of CD31, CD34, ERG, FaVIII and FLI-1. Patients with IHE (96 months) and EHE (88 months) had the longest survival times, followed by those with MHP (23 months), while patients with PHA (15 months) had the shortest survival time.

Conclusion: On CT and MR images, most PHMVTs were ill-defined, heterogeneous, hypervascular masses with centripetal progressive enhancement and possibly calcification, especially in female patients. The prognosis of patients with PHMVT was associated with the pathological type of the tumor.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s40644-020-00336-9DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7427980PMC
August 2020

A novel missense mutation of RPGR identified from retinitis pigmentosa affects splicing of the ORF15 region and causes loss of transcript heterogeneity.

Biochem Biophys Res Commun 2020 10 9;531(2):172-179. Epub 2020 Aug 9.

Laboratory of Genomic and Precision Medicine, Wuxi School of Medicine, Jiangnan University, Wuxi, Jiangsu, China; Joint Primate Research Center for Chronic Diseases, Jiangnan University and Guangdong Institute of Applied Biological Resources, Jiangnan University, Wuxi, Jiangsu, China; Guangdong Institute of Applied Biological Resources, Guangzhou, Guangdong, China. Electronic address:

Mutations in the retinitis pigmentosa GTPase regulator (RPGR) gene, are the major cause of X-linked retinitis pigmentosa (RP), in which exon open reading frame 15 (ORF15) of RPGR has been implicated to play a substantial role. We identified a novel hemizygous missense mutation E585K of RPGR from whole-exome sequencing of RP. RNA-Seq analysis and functional study were conducted to investigate the underlying pathogenic mechanism of the mutation. Our results showed that the mutation actually affected RPGR ORF15 splicing. RNA-Seq analysis of the human retina followed by validation in cells revealed a complex splicing pattern near the 3' boundary of RPGR exon 14 in the ORF15 region, resulting from a variety of alternative splicing events (ASEs). The wildtype RPGR mini-gene expressed in human 293T cells confirmed these ASEs in vitro. In contrast, without new RNA species detected, the mutant mini-gene disrupted the splicing pattern of the ORF15 region, and caused loss of RPGR transcript heterogeneity. The RNA species derived from the mutant mini-gene were predominated by a minor out-of-frame transcript that was also observed in wildtype RPGR, resulting from an upstream alternative 5' splice site in exon 14. Our findings therefore provide insights into the influence of RPGR exonic mutations on alternative splicing of the ORF15 region, and the underlying molecular mechanism of RP.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bbrc.2020.06.109DOI Listing
October 2020

The role of resting-state functional MRI for clinical preoperative language mapping.

Cancer Imaging 2020 Jul 11;20(1):47. Epub 2020 Jul 11.

Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.

Background: Task-based functional MRI (tb-fMRI) is a well-established technique used to identify eloquent cortex, but has limitations, particularly in cognitively impaired patients who cannot perform language paradigms. Resting-state functional MRI (rs-fMRI) is a potential alternative modality for presurgical mapping of language networks that does not require task performance. The purpose of our study is to determine the utility of rs-fMRI for clinical preoperative language mapping when tb-fMRI is limited.

Methods: We retrospectively reviewed 134 brain tumor patients who underwent preoperative fMRI language mapping. rs-fMRI was post-processed with seed-based correlation (SBC) analysis, when language tb-fMRI was limited. Two neuroradiologists reviewed both the tb-fMRI and rs-fMRI results. Six neurosurgeons retrospectively rated the usefulness of rs-fMRI for language mapping in their patients.

Results: Of the 134 patients, 49 cases had limited tb-fMRI and rs-fMRI was post-processed. Two neuroradiologists found rs-fMRI beneficial for functional language mapping in 41(84%) and 43 (88%) cases respectively; Cohen's kappa is 0.83, with a 95% confidence interval (0.61, 1.00). The neurosurgeons found rs-fMRI "definitely" useful in 26 cases (60%) and "somewhat" useful in 13 cases (30%) in locating potential eloquent language centers of clinical interest. Six unsuccessful rs-fMRI cases were due to: head motion (2 cases), nonspecific functionality connectivity outside the posterior language network (1 case), and an unknown system instability (3 cases).

Conclusions: This study is a proof of concept that shows SBC rs-fMRI may be a viable alternative for clinical language mapping when tb-fMRI is limited.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s40644-020-00327-wDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7353792PMC
July 2020

Computational Methods and Applications for Identifying Disease-Associated lncRNAs as Potential Biomarkers and Therapeutic Targets.

Mol Ther Nucleic Acids 2020 Sep 21;21:156-171. Epub 2020 May 21.

School of Biomedical Engineering, School of Ophthalmology & Optometry and Eye Hospital, Wenzhou Medical University, Wenzhou 325027, P.R. China. Electronic address:

Long non-coding RNAs (lncRNAs) have been recognized as critical components of a broad genomic regulatory network and play pivotal roles in physiological and pathological processes. Identification of disease-associated lncRNAs is becoming increasingly crucial for fundamentally improving our understanding of molecular mechanisms of disease and developing novel biomarkers and therapeutic targets. Considering lower efficiency and higher time and labor cost of biological experiments, computer-aided inference of disease-associated RNAs has become a promising avenue for facilitating the study of lncRNA functions and provides complementary value for experimental studies. In this study, we first summarize data and knowledge resources publicly available for the study of lncRNA-disease associations. Then, we present an updated systematic overview of dozens of computational methods and models for inferring lncRNA-disease associations proposed in recent years. Finally, we explore the perspectives and challenges for further studies. Our study provides a guide for biologists and medical scientists to look for dedicated resources and more competent tools for accelerating the unraveling of disease-associated lncRNAs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.omtn.2020.05.018DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7321789PMC
September 2020

Computational principles and practice for decoding immune contexture in the tumor microenvironment.

Brief Bioinform 2020 Jun 3. Epub 2020 Jun 3.

School of Biomedical Engineering, Wenzhou Medical University.

Tumor-infiltrating immune cells (TIICs) have been recognized as crucial components of the tumor microenvironment (TME) and induced both beneficial and adverse consequences for tumorigenesis as well as outcome and therapy (particularly immunotherapy). Computer-aided investigation of immune cell components in the TME has become a promising avenue to better understand the interplay between the immune system and tumors. In this study, we presented an overview of data sources, computational methods and software tools, as well as their application in inferring the composition of tumor-infiltrating immune cells in the TME. In parallel, we explored the future perspectives and challenges that may be faced with more accurate quantitative infiltration of immune cells in the future. Together, our study provides a little guide for scientists in the field of clinical and experimental immunology to look for dedicated resources and more competent tools for accelerating the unraveling of tumor-immune interactions with the implication in precision immunotherapy.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/bib/bbaa075DOI Listing
June 2020

Effect of latanoprost on intraocular pressure, visual acuity and C-reactive protein.

Saudi J Biol Sci 2020 Jun 16;27(6):1569-1572. Epub 2020 Mar 16.

Department of Glaucoma, Jinhua Eye Hospital, Jinhua 231000, Zhejiang, China.

Objective: To investigate the effect of latanoprost on intraocular pressure (IOP), visual acuity and C-reactive protein (CRP) in patients with primary open-angle glaucoma (POAG).

Methods: A total of 163 POAG patients (266 eyes) admitted to our hospital from February 2015 to July 2017 were selected and divided into observation group (81 cases, 132 eyes, latanoprost eye drops) and control group (82 cases, 134 eyes, timolol maleate eye drops) according to different treatment plans. The clinical efficacy of the two groups after treatment was evaluated. The IOP, visual acuity and CRP level were compared between the two groups before and after treatment. Then the adverse reactions of the two groups were observed and recorded.

Results: After treatment, the total effective rate was 92.59% (75 cases) in the observation group and was 80.49% (66 cases) in the control group, with statistic difference between groups ( < 0.05); The IOP, visual acuity and CRP level between the two groups before treatment showed no statistic difference, the mentioned three indexes of the two groups were significantly improved after treatment, and statistic difference was found before and after treatment ( < 0.05); Moreover, the above three indicators had statistically significant differences between groups after treatment ( < 0.05); The difference of intraocular pressure and visual acuity between the two groups before and after treatment were statistically different ( < 0.05); After treatment, the incidence of adverse reactions in the observation group such as allergy, vomiting, breathlessness and tachycardia were not significantly different from those in the control group ( > 0.05).

Conclusion: Latanoprost can improve IOP, visual acuity, and CRP levels. It improves eye hemodynamics, and has significant efficacy in treating primary open-angle glaucoma. Also, it has good security.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.sjbs.2020.03.013DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7254158PMC
June 2020

Mechanistically derived patient-level framework for precision medicine identifies a personalized immune prognostic signature in high-grade serous ovarian cancer.

Brief Bioinform 2020 May 20. Epub 2020 May 20.

An accurate prognosis assessment for cancer patients could aid in guiding clinical decision-making. Reliance on traditional clinical features alone in a complex clinical environment is challenging and unsatisfactory in the era of precision medicine; thus, reliable prognostic biomarkers are urgently required to improve a patient staging system. In this study, we proposed a patient-level computational framework from mechanistic and translational perspectives to establish a personalized prognostic signature (named PLPPS) in high-grade serous ovarian carcinoma (HGSOC). The PLPPS composed of 68 immune genes achieved accurate prognostic risk stratification for 1190 patients in the meta-training cohort and was rigorously validated in multiple cross-platform independent cohorts comprising 792 HGSOC patients. Furthermore, the PLPPS was shown to be the better prognostic factor compared with clinical parameters in the univariate analysis and retained a significant independent association with prognosis after adjusting for clinical parameters in the multivariate analysis. In benchmark comparisons, the performance of PLPPS (hazard ratio (HR), 1.371; concordance index (C-index), 0.604 and area under the curve (AUC), 0.637) is comparable to or better than other published gene signatures (HR, 0.972 to 1.340; C-index, 0.495 to 0.592 and AUC, 0.48-0.624). With further validation in prospective clinical trials, we hope that the PLPPS might become a promising genomic tool to guide personalized management and decision-making of HGSOC in clinical practice.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/bib/bbaa069DOI Listing
May 2020

Computational recognition of lncRNA signature of tumor-infiltrating B lymphocytes with potential implications in prognosis and immunotherapy of bladder cancer.

Brief Bioinform 2020 May 8. Epub 2020 May 8.

Long noncoding RNAs (lncRNAs) have been associated with cancer immunity regulation and the tumor microenvironment (TME). However, functions of lncRNAs of tumor-infiltrating B lymphocytes (TIL-Bs) and their clinical significance have not yet been fully elucidated. In the present study, a machine learning-based computational framework is presented for the identification of lncRNA signature of TIL-Bs (named 'TILBlncSig') through integrative analysis of immune, lncRNA and clinical profiles. The TILBlncSig comprising eight lncRNAs (TNRC6C-AS1, WASIR2, GUSBP11, OGFRP1, AC090515.2, PART1, MAFG-DT and LINC01184) was identified from the list of 141 B-cell-specific lncRNAs. The TILBlncSig was capable of distinguishing worse compared with improved survival outcomes across different independent patient datasets and was also independent of other clinical covariates. Functional characterization of TILBlncSig revealed it to be an indicator of infiltration of mononuclear immune cells (i.e. natural killer cells, B-cells and mast cells), and it was associated with hallmarks of cancer, as well as immunosuppressive phenotype. Furthermore, the TILBlncSig revealed predictive value for the survival outcome and immunotherapy response of patients with anti-programmed death-1 (PD-1) therapy and added significant predictive power to current immune checkpoint gene markers. The present study has highlighted the value of the TILBlncSig as an indicator of immune cell infiltration in the TME from a noncoding RNA perspective and strengthened the potential application of lncRNAs as predictive biomarkers of immunotherapy response, which warrants further investigation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/bib/bbaa047DOI Listing
May 2020

Health literacy, social support, and care ability for caregivers of dementia patients: Structural equation modeling.

Geriatr Nurs 2020 Sep - Oct;41(5):600-607. Epub 2020 Apr 21.

School of Nursing, Yangzhou University, Yangzhou, Jiangsu, China. Electronic address:

At present, the level of health literacy, social support, and care ability of dementia caregivers is not very high. Therefore, the purpose of this study was to construct a structural equation model to explore the relationship between health literacy, social support, and the care ability of dementia caregivers. It is hoped that the study will provide a theoretical basis for future intervention. We recruited 225 dementia patients and their caregivers from August 2018 to June 2019 at the Department of Geriatrics and Neurology. We issued a health literacy questionnaire, social support scale, and a care ability questionnaire. Statistical analyses were performed using SPSS 19.0 and SPSS Amos 23.0. The mean scores for health literacy, social support, and care ability were 13.93±4.18, 34.64±6.42, and 44.44±9.31, respectively. Health literacy was directly related to social support (path coefficient = 0.454). Social support was directly related to care ability (path coefficient = 0.293). Furthermore, health literacy was directly related to care ability (path coefficient = 0.561), while health literacy had indirect associations with care ability via social support (path coefficient = 0.133). This study showed that improving the health literacy of caregivers effectively improved their care ability, and that social support was important for the link between health literacy and care ability. Medical staff and family members can provide appropriate health education and social support according to the characteristics of caregivers to improve the care ability of caregivers, improve the quality of life of patients, and delay the disease process.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.gerinurse.2020.03.014DOI Listing
March 2021

Gastrointestinal mixed adenoneuroendocrine carcinoma: a population level analysis of epidemiological trends.

J Transl Med 2020 03 14;18(1):128. Epub 2020 Mar 14.

Department of General Surgery, The Second Affiliated Hospital of Nanchang University, No. 1, Minde Road, Nanchang, 330006, China.

Background: The rise in incidence and mortality of gastrointestinal mixed adenoneuroendocrine carcinoma (MANEC) has not been well focused. The aim of our study was to examine epidemiological trends in incidence and incidence-based (IB) mortality of gastrointestinal MANEC at a population level.

Methods: The incidence and IB mortality of gastrointestinal MANEC as well as data on affected patients from 2000 to 2016 were obtained from the Surveillance, Epidemiology, and End Results database. Trends in incidence and IB mortality were assessed using Joinpoint regression. The Kaplan-Meier method and log-rank test were used for survival analysis. Cox proportional hazards regression was used to identify independent predictors of mortality.

Results: 581 patients diagnosed with gastrointestinal MANEC were enrolled. Gastrointestinal MANEC incidence was 0.23 cases per 1,000,000 individuals in 2000 and 1.16 cases per 1,000,000 individuals in 2016, with an annual percent change (APC) of 8.0% (95% CI 5.7-10.3%, P < 0.05). IB mortality also showed a sustained increase (APC 12.9%, 95% CI 9.0-16.8%, P < 0.05). In Cox regression analysis, age at diagnosis, tumor grade and stage, lymph node metastasis, surgery, and tumor size were independently associated with mortality. Median survival was 75 months (95% CI 60-128 months). Median survival of appendiceal MANEC was significantly longer than that of cecal MANEC (115 vs. 31 months; P < 0.001).

Conclusions: We found a sustained and rapid increase both in incidence and IB mortality of gastrointestinal MANEC, manifesting that there has been no significant improvement in patient outcomes, nor progress in prevention and treatment. Additional resources should be devoted to gastrointestinal MANEC research.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12967-020-02293-0DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7071749PMC
March 2020

Clinical application of multi-material artifact reduction (MMAR) technique in Revolution CT to reduce metallic dental artifacts.

Insights Imaging 2020 Mar 6;11(1):32. Epub 2020 Mar 6.

Department of Radiology, the First Affiliated Hospital of Zhengzhou University, Zhengzhou, 450000, Henan, China.

Background: This study aimed to explore the performance of Revolution CT virtual monoenergetic images (VMI) combined with the multi-material artifact reduction (MMAR) technique in reducing metal artifacts in oral and maxillofacial imaging.

Results: There were significant differences in image quality scores between VMI + MMAR images and VMI+MARS (multiple artifact reduction system) images at each monochromatic energy level (p = 0.000). Compared with the MARS technology, the MMAR technology further reduced metal artifacts and improved the image quality. At VMI and VMI, the SD, CNR, and AI in the Revolution CT group were significantly lower than in the Discovery CT, but no significant differences in these parameters were found between two groups at VMI, VMI, and VMI (p > 0.05). The attenuation was comparable between two groups at any energy level (p > 0.05).

Conclusions: Compared with the MARS reconstruction technique of Discovery CT, the MMAR technique of Revolution CT is better to reduce the artifacts of dental implants in oral and maxillofacial imaging, which improves the image quality and the diagnostic value of surrounding soft tissues.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s13244-020-0836-1DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7058730PMC
March 2020

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families.

BMC Nephrol 2020 02 28;21(1):69. Epub 2020 Feb 28.

Renal Division, Peking University First Hospital; Peking University Institute of Nephrology; Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, 100034, People's Republic of China.

Background: Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified.

Methods: Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information.

Results: A total of nine different mutations were identified: IVS1-16C > A, c.305C > T/p.(A102V), c.395G > A/p.(R132H), c.736C > T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G > T/p.(D408Y), c.1496G > A/p.(R499H) and c.1540C > T/p.(P514S); two novel mutations in SLC5A2, c.1222G > T/p.(D408Y) and c.1496G > A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6 g/d.

Conclusion: We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C > A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12882-020-01725-9DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7047355PMC
February 2020

Identification of tumor immune infiltration-associated lncRNAs for improving prognosis and immunotherapy response of patients with non-small cell lung cancer.

J Immunother Cancer 2020 02;8(1)

School of Biomedical Engineering, School of Ophthalmology & Optometry and Eye Hospital, Wenzhou Medical University, Wenzhou, China

Background: Increasing evidence has demonstrated the functional relevance of long non-coding RNAs (lncRNAs) to immunity regulation and the tumor microenvironment in non-small cell lung cancer (NSCLC). However, tumor immune infiltration-associated lncRNAs and their value in improving clinical outcomes and immunotherapy remain largely unexplored.

Methods: We developed a computational approach to identify an lncRNA signature (TILSig) as an indicator of immune cell infiltration in patients with NSCLC through integrative analysis for lncRNA, immune and clinical profiles of 115 immune cell lines, 187 NSCLC cell lines and 1533 patients with NSCLC. Then the influence of the TILSig on the prognosis and immunotherapy in NSCLC was comprehensively investigated.

Results: Computational immune and lncRNA profiling analysis identified an lncRNA signature (TILSig) consisting of seven lncRNAs associated with tumor immune infiltration. The TILSig significantly stratified patients into the immune-cold group and immune-hot group in both training and validation cohorts. These immune-hot patients exhibit significantly improved survival outcome and greater immune cell infiltration compared with immune-cold patients. Multivariate analysis revealed that the TILSig is an independent predictive factor after adjusting for other clinical factors. Further analysis accounting for TILSig and immune checkpoint gene revealed that the TILSig has a discriminatory power in patients with similar expression levels of immune checkpoint genes and significantly prolonged survival was observed for patients with low TILSig and low immune checkpoint gene expression implying a better response to immune checkpoint inhibitor (ICI) immunotherapy.

Conclusions: Our finding demonstrated the importance and value of lncRNAs in evaluating the immune infiltrate of the tumor and highlighted the potential of lncRNA coupled with specific immune checkpoint factors as predictive biomarkers of ICI response to enable a more precise selection of patients.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1136/jitc-2019-000110DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7057423PMC
February 2020