Publications by authors named "Michael Melzer"

122 Publications

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States.

Plant Dis 2021 Mar 3. Epub 2021 Mar 3.

University of Hawaii, Plant and Environmental Protection Sciences, 3190 Maile Way, St. John 310, Honolulu, Hawaii, United States, 96822;

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-12-20-2736-PDNDOI Listing
March 2021

Expression of Flavodiiron Proteins Flv2-Flv4 in Chloroplasts of Arabidopsis and Tobacco Plants Provides Multiple Stress Tolerance.

Int J Mol Sci 2021 Jan 25;22(3). Epub 2021 Jan 25.

Instituto de Biología Molecular y Celular de Rosario (IBR-UNR/CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas, Universidad Nacional de Rosario (UNR), Rosario 2000, Argentina.

With the notable exception of angiosperms, all phototrophs contain different sets of flavodiiron proteins that help to relieve the excess of excitation energy on the photosynthetic electron transport chain during adverse environmental conditions, presumably by reducing oxygen directly to water. Among them, the Flv2-Flv4 dimer is only found in β-cyanobacteria and induced by high light, supporting a role in stress protection. The possibility of a similar protective function in plants was assayed by expressing Flv2-Flv4 in chloroplasts of tobacco and Arabidopsis. Flv-expressing plants exhibited increased tolerance toward high irradiation, salinity, oxidants, and drought. Stress tolerance was reflected by better growth, preservation of photosynthetic activity, and membrane integrity. Metabolic profiling under drought showed enhanced accumulation of soluble sugars and amino acids in transgenic Arabidopsis and a remarkable shift of sucrose into starch, in line with metabolic responses of drought-tolerant genotypes. Our results indicate that the Flv2-Flv4 complex retains its stress protection activities when expressed in chloroplasts of angiosperm species by acting as an additional electron sink. The genes constitute a novel biotechnological tool to generate plants with increased tolerance to agronomically relevant stress conditions that represent a significant productivity constraint.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/ijms22031178DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7865949PMC
January 2021

COMPOSITUM 1 contributes to the architectural simplification of barley inflorescence via meristem identity signals.

Nat Commun 2020 10 12;11(1):5138. Epub 2020 Oct 12.

Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Corrensstr, 3 OT Gatersleben, D-06466, Seeland, Germany.

Grasses have varying inflorescence shapes; however, little is known about the genetic mechanisms specifying such shapes among tribes. Here, we identify the grass-specific TCP transcription factor COMPOSITUM 1 (COM1) expressing in inflorescence meristematic boundaries of different grasses. COM1 specifies branch-inhibition in barley (Triticeae) versus branch-formation in non-Triticeae grasses. Analyses of cell size, cell walls and transcripts reveal barley COM1 regulates cell growth, thereby affecting cell wall properties and signaling specifically in meristematic boundaries to establish identity of adjacent meristems. COM1 acts upstream of the boundary gene Liguleless1 and confers meristem identity partially independent of the COM2 pathway. Furthermore, COM1 is subject to purifying natural selection, thereby contributing to specification of the spike inflorescence shape. This meristem identity pathway has conceptual implications for both inflorescence evolution and molecular breeding in Triticeae.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41467-020-18890-yDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7550572PMC
October 2020

Novel Fig-Associated Viroid-Like RNAs Containing Hammerhead Ribozymes in Both Polarity Strands Identified by High-Throughput Sequencing.

Front Microbiol 2020 18;11:1903. Epub 2020 Aug 18.

Istituto per la Protezione Sostenibile delle Piante, Consiglio Nazionale delle Ricerche, Bari, Italy.

Based on high-throughput sequencing (HTS) data, the existence of viroid-like RNAs (Vd-LRNAs) associated with fig trees grown in the Hawaiian Islands has been predicted. One of these RNAs has been characterized as a circular RNA ranging in size from 357 to 360 nucleotides. Structural and biochemical features of this RNA, tentatively named fig hammerhead viroid-like RNA (FHVd-LR), markedly resemble those previously reported for several viroids and viroid-like satellite RNAs (Vd-LsatRNAs), which are non-protein-coding RNAs infecting their hosts autonomously and in combination with a helper virus, respectively. The full-length sequence of FHVd-LR variants was determined by RT-PCR, cloning, and sequencing. Despite a low global sequence identity with known viroids and Vd-LsatRNAs, FHVd-LR contains a hammerhead ribozyme (HRz) in each polarity strand. Northern blot hybridization assays identified the circular and linear forms of both polarity strands of FHVd-LR and showed that one strand, assigned the (+) polarity, accumulates at higher levels than the (-) polarity strand The (+) polarity RNA assumes a rod-like secondary structure of minimal free energy with the conserved domains of the HRzs located in opposition to each other, a feature typical of several viroids and Vd-LRNAs. The HRzs of both FHVd-LR polarity strands were shown to be active during transcription, self-cleaving the RNAs at the predicted sites. These data, together with the sequence variability observed in the cloned and sequenced full-length variants, indicate that FHVd-LR is a novel viroid or Vd-LsatRNA. According to HTS data, the coexistence of FHVd-LR of different sizes in the same host cannot be excluded. The relationships of FHVd-LR with previously reported viroids and Vd-LsatRNAs, and the need to perform bioassays to conclusively clarify the biological nature of this circular RNA, are discussed.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fmicb.2020.01903DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7461866PMC
August 2020

The transcription factor WRKY22 is required during cryo-stress acclimation in Arabidopsis shoot tips.

J Exp Bot 2020 08;71(16):4993-5009

Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Gatersleben, Seeland, Germany.

Storage of meristematic tissue at ultra-low temperatures offers a mean to maintain valuable genetic resources from vegetatively reproduced plants. To reveal the biology underlying cryo-stress, shoot tips of the model plant Arabidopsis thaliana were subjected to a standard preservation procedure. A transcriptomic approach was taken to describe the subsequent cellular events which occurred. The cryoprotectant treatment induced the changes in the transcript levels of genes associated with RNA processing and primary metabolism. Explants of a mutant lacking a functional copy of the transcription factor WRKY22 were compromised for recovery. A number of putative downstream targets of WRKY22 were identified, some related to phytohormone-mediated defense, to the osmotic stress response, and to development. There were also alterations in the abundance of transcript produced by genes encoding photosynthesis-related proteins. The wrky22 mutant plants developed an open stomata phenotype in response to their exposure to the cryoprotectant solution. WRKY22 probably regulates a transcriptional network during cryo-stress, linking the explant's defense and osmotic stress responses to changes in its primary metabolism. A model is proposed linking WRKY53 and WRKY70 downstream of the action of WRKY22.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/jxb/eraa224DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7475261PMC
August 2020

Providing an Additional Electron Sink by the Introduction of Cyanobacterial Flavodiirons Enhances Growth of Under Various Light Intensities.

Front Plant Sci 2020 25;11:902. Epub 2020 Jun 25.

Molecular Plant Nutrition, Department of Physiology and Cell Biology, Leibniz Institute of Plant Genetics and Crop Plant Research, Seeland, Germany.

The ability of plants to maintain photosynthesis in a dynamically changing environment is of central importance for their growth. As the photosynthetic machinery is a sensitive and early target of adverse environmental conditions as those typically found in the field, photosynthetic efficiency is not always optimal. Cyanobacteria, algae, mosses, liverworts and gymnosperms produce flavodiiron proteins (Flvs), a class of electron sinks not represented in angiosperms; these proteins act to mitigate the photoinhibition of photosystem I under high or fluctuating light. Here, genes specifying two cyanobacterial Flvs have been expressed in the chloroplasts of in an attempt to improve plant growth. Co-expression of and enhanced the efficiency of light utilization, boosting the plant's capacity to accumulate biomass as the growth light intensity was raised. The / transgenics displayed an increased production of ATP, an acceleration of carbohydrate metabolism and a more pronounced partitioning of sucrose into starch. The results suggest that Flvs are able to establish an efficient electron sink downstream of PSI, thereby ensuring efficient photosynthetic electron transport at moderate to high light intensities. The expression of Flvs thus acts to both protect photosynthesis and to control the ATP/NADPH ratio; together, their presence is beneficial for the plant's growth potential.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fpls.2020.00902DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7330091PMC
June 2020

Genome-Informed Recombinase Polymerase Amplification Assay Coupled with a Lateral Flow Device for In-Field Detection of Species.

Plant Dis 2020 Aug 12;104(8):2217-2224. Epub 2020 Jun 12.

Department of Plant and Environmental Protection Sciences, University of Hawaii at Manoa, Honolulu, HI 96822, U.S.A.

spp. cause blackleg and soft rot diseases of potato and several other plant species worldwide, resulting in high economic losses. Rapid detection and identification of the pathogen is essential for facilitating efficient disease management. Our aim in this research was to develop a rapid and field-deployable recombinase polymerase amplification (RPA) assay coupled with a lateral flow device (LFD) that will accurately detect spp. in infected plant tissues without the need for DNA isolation. A unique genomic region (A/C genes) conserved among spp. was used to design highly specific robust primers and probes for an RPA assay. Assay specificity was validated with 34 representative strains from all spp. and 24 strains from other genera and species; no false positives or negatives were detected. An RPA assay targeting the internal transcribed spacer region of the host genome was included to enhance the reliability and accuracy of the assay. The detection limit of 1 fg was determined by both sensitivity and spiked sensitivity assays; no inhibitory effects were observed when 1 µl of host sap, macerated in Tris-EDTA buffer, was added to each reaction in the sensitivity tests. The developed RPA assay is rapid, highly accurate, sensitive, and fully field deployable. It has numerous applications in routine diagnostics, surveillance, biosecurity, and disease management.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-09-19-1988-REDOI Listing
August 2020

Barley HISTIDINE KINASE 1 (HvHK1) coordinates transfer cell specification in the young endosperm.

Plant J 2020 08 3;103(5):1869-1884. Epub 2020 Jul 3.

Department of Molecular Genetics, Leibniz Institute for Plant Genetics and Crop Plant Research (IPK), Seeland/OT Gatersleben, D-06466, Germany.

Cereal endosperm represents the most important source of the world's food; nevertheless, the molecular mechanisms underlying cell and tissue differentiation in cereal grains remain poorly understood. Endosperm cellularization commences at the maternal-filial intersection of grains and generates endosperm transfer cells (ETCs), a cell type with a prominent anatomy optimized for efficient nutrient transport. Barley HISTIDINE KINASE1 (HvHK1) was identified as a receptor component with spatially restricted expression in the syncytial endosperm where ETCs emerge. Here, we demonstrate its function in ETC fate acquisition using RNA interference-mediated downregulation of HvHK1. Repression of HvHK1 impairs cell specification in the central ETC region and the development of transfer cell morphology, and consecutively defects differentiation of adjacent endosperm tissues. Coinciding with reduced expression of HvHK1, disturbed cell plate formation and fusion were observed at the initiation of endosperm cellularization, revealing that HvHK1 triggers initial cytokinesis of ETCs. Cell-type-specific RNA sequencing confirmed loss of transfer cell identity, compromised cell wall biogenesis and reduced transport capacities in aberrant cells and elucidated two-component signaling and hormone pathways that are mediated by HvHK1. Gene regulatory network modeling was used to specify the direct targets of HvHK1; this predicted non-canonical auxin signaling elements as the main regulatory links governing cellularization of ETCs, potentially through interaction with type-B response regulators. This work provides clues to previously unknown molecular mechanisms directing ETC specification, a process with fundamental impact on grain yield in cereals.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/tpj.14875DOI Listing
August 2020

Barley strigolactone signalling mutant hvd14.d reveals the role of strigolactones in abscisic acid-dependent response to drought.

Plant Cell Environ 2020 09 22;43(9):2239-2253. Epub 2020 Jul 22.

Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia, Katowice, Poland.

Strigolactones (SLs) are a group of plant hormones involved in many aspects of plant development and stress adaptation. Here, we investigated the drought response of a barley (Hordeum vulgare L.) mutant carrying a missense mutation in the gene encoding the SL-specific receptor HvD14. Our results clearly showed that hvd14.d mutant is hyper-sensitive to drought stress. This was illustrated by a lower leaf relative water content (RWC), impaired photosynthesis, disorganization of chloroplast structure, altered stomatal density and slower closure of stomata in response to drought in the mutant compared to the wild type parent cultivar Sebastian. Although the content of abscisic acid (ABA) and its derivatives remained unchanged in the mutant, significant differences in expression of genes related to ABA biosynthesis were observed. Moreover, hvd14.d was insensitive to ABA during seed germination. Analysis of Arabidopsis thaliana mutant atd14-1 also demonstrated that mutation in the SL receptor resulted in increased sensitivity to drought. Our results indicate that the drought-sensitive phenotype of barley SL mutant might be caused by a disturbed ABA metabolism and/or signalling pathways. These results together uncovered a link between SL signalling and ABA-dependent drought stress response in barley.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/pce.13815DOI Listing
September 2020

Supernumerary B chromosomes of Aegilops speltoides undergo precise elimination in roots early in embryo development.

Nat Commun 2020 06 2;11(1):2764. Epub 2020 Jun 2.

Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Gatersleben, 06466 Seeland, OT Gatersleben, Germany.

Not necessarily all cells of an organism contain the same genome. Some eukaryotes exhibit dramatic differences between cells of different organs, resulting from programmed elimination of chromosomes or their fragments. Here, we present a detailed analysis of programmed B chromosome elimination in plants. Using goatgrass Aegilops speltoides as a model, we demonstrate that the elimination of B chromosomes is a strictly controlled and highly efficient root-specific process. At the onset of embryo differentiation B chromosomes undergo elimination in proto-root cells. Independent of centromere activity, B chromosomes demonstrate nondisjunction of chromatids and lagging in anaphase, leading to micronucleation. Chromatin structure and DNA replication differ between micronuclei and primary nuclei and degradation of micronucleated DNA is the final step of B chromosome elimination. This process might allow root tissues to survive the detrimental expression, or overexpression of B chromosome-located root-specific genes with paralogs located on standard chromosomes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41467-020-16594-xDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7265534PMC
June 2020

An Immunological Glance on Pancreatic Ductal Adenocarcinoma.

Int J Mol Sci 2020 May 8;21(9). Epub 2020 May 8.

Department of Internal Medicine I, Ulm University Hospital, 89081 Ulm, Germany.

Pancreatic ductal adenocarcinoma (PDAC) has still a dismal prognosis. Different factors such as mutational landscape, intra- and intertumoral heterogeneity, stroma, and immune cells impact carcinogenesis of PDAC associated with an immunosuppressive microenvironment. Different cell types with partly opposing roles contribute to this milieu. In recent years, immunotherapeutic approaches, including checkpoint inhibitors, were favored to treat cancers, albeit not every cancer entity exhibited benefits in a similar way. Indeed, immunotherapies rendered little success in pancreatic cancer. In this review, we describe the communication between the immune system and pancreatic cancer cells and propose some rationale why immunotherapies may fail in the context of pancreatic cancer. Moreover, we delineate putative strategies to sensitize PDAC towards immunological therapeutics and highlight the potential of targeting neoantigens.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/ijms21093345DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7246613PMC
May 2020

Photosynthetic characterization of flavodoxin-expressing tobacco plants reveals a high light acclimation-like phenotype.

Biochim Biophys Acta Bioenerg 2020 08 18;1861(8):148211. Epub 2020 Apr 18.

Instituto de Biología Molecular y Celular de Rosario (IBR-UNR/CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas, Universidad Nacional de Rosario (UNR), 2000 Rosario, Argentina. Electronic address:

Flavodoxins are electron carrier flavoproteins present in bacteria and photosynthetic microorganisms which duplicate the functional properties of iron-sulphur containing ferredoxins and replace them under adverse environmental situations that lead to ferredoxin decline. When expressed in plant chloroplasts, flavodoxin complemented ferredoxin deficiency and improved tolerance to multiple sources of biotic, abiotic and xenobiotic stress. Analysis of flavodoxin-expressing plants grown under normal conditions, in which the two carriers are present, revealed phenotypic effects unrelated to ferredoxin replacement. Flavodoxin thus provided a tool to alter the chloroplast redox poise in a customized way and to investigate its consequences on plant physiology and development. We describe herein the effects exerted by the flavoprotein on the function of the photosynthetic machinery. Pigment analysis revealed significant increases in chlorophyll a, carotenoids and chlorophyll a/b ratio in flavodoxin-expressing tobacco lines. Results suggest smaller antenna size in these plants, supported by lower relative contents of light-harvesting complex proteins. Chlorophyll a fluorescence and P700 spectroscopy measurements indicated that transgenic plants displayed higher quantum yields for both photosystems, a more oxidized plastoquinone pool under steady-state conditions and faster plastoquinone dark oxidation after a pulse of saturating light. Many of these effects resemble the phenotypes exhibited by leaves adapted to high irradiation, a most common environmental hardship faced by plants growing in the field. The results suggest that flavodoxin-expressing plants would be better prepared to cope with this adverse situation, and concur with earlier observations reporting that hundreds of stress-responsive genes were induced in the absence of stress in these lines.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bbabio.2020.148211DOI Listing
August 2020

Identification and complete genomic sequence of a novel sadwavirus discovered in pineapple (Ananas comosus).

Arch Virol 2020 May 29;165(5):1245-1248. Epub 2020 Mar 29.

Department of Plant and Environmental Protection Sciences, University of Hawaii, Honolulu, HI, USA.

The complete genomic sequence of a putative novel member of the family Secoviridae was determined by high-throughput sequencing of a pineapple accession obtained from the National Plant Germplasm Repository in Hilo, Hawaii. The predicted genome of the putative virus was composed of two RNA molecules of 6,128 and 4,161 nucleotides in length, excluding the poly-A tails. Each genome segment contained one large open reading frame (ORF) that shares homology and phylogenetic identity with members of the family Secoviridae. The presence of this new virus in pineapple was confirmed using RT-PCR and Sanger sequencing from six samples collected in Oahu, Hawaii. The name "pineapple secovirus A" (PSVA) is proposed for this putative new sadwavirus.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00705-020-04592-9DOI Listing
May 2020

PsbS contributes to photoprotection in Chlamydomonas reinhardtii independently of energy dissipation.

Biochim Biophys Acta Bioenerg 2020 06 12;1861(5-6):148183. Epub 2020 Mar 12.

Plant Biochemistry, Heinrich-Heine-Universität Düsseldorf, 40225 Düsseldorf, Germany. Electronic address:

Photosynthetic organisms are frequently exposed to excess light conditions and hence to photo-oxidative stress. To counteract photo-oxidative damage, land plants and most algae make use of non- photochemical quenching (NPQ) of excess light energy, in particular the rapidly inducible and relaxing qE-mechanism. In vascular plants, the constitutively active PsbS protein is the key regulator of qE. In the green algae C. reinhardtii, however, qE activation is only possible after initial high-light (HL) acclimation for several hours and requires the synthesis of LHCSR proteins which act as qE regulators. The precise function of PsbS, which is transiently expressed during HL acclimation in C. reinhardtii, is still unclear. Here, we investigated the impact of different PsbS amounts on HL acclimation characteristics of C. reinhardtii cells. We demonstrate that lower PsbS amounts negatively affect HL acclimation at different levels, including NPQ capacity, electron transport characteristics, antenna organization and morphological changes, resulting in an overall increased HL sensitivity and lower vitality of cells. Contrarily, higher PsbS amounts do not result in a higher NPQ capacity, but nevertheless provide higher fitness and tolerance towards HL stress. Strikingly, constitutively expressed PsbS protein was found to be degraded during HL acclimation. We propose that PsbS is transiently required during HL acclimation for the reorganization of thylakoid membranes and/or antenna proteins along with the activation of NPQ and adjustment of electron transfer characteristics, and that degradation of PsbS is essential in the fully HL acclimated state.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bbabio.2020.148183DOI Listing
June 2020

ICTV Virus Taxonomy Profile: .

J Gen Virol 2020 04 5;101(4):364-365. Epub 2020 Mar 5.

Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Mississippi, MS 39762, USA.

Viruses in the family have a mono-, bi- or tripartite positive-sense RNA genome of 13-19 kb, and non-enveloped, filamentous particles 650-2200 nm long and 12 nm in diameter. They infect plants, mainly dicots, many of which are fruit crops. This is a summary of the ICTV Report on the family , which is available at ictv.global/report/closteroviridae.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1099/jgv.0.001397DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7414439PMC
April 2020

Triacylglycerol and phytyl ester synthesis in sp. PCC6803.

Proc Natl Acad Sci U S A 2020 03 2;117(11):6216-6222. Epub 2020 Mar 2.

Institute of Molecular Physiology and Biotechnology of Plants, University of Bonn, 53115 Bonn, Germany;

Cyanobacteria are unicellular prokaryotic algae that perform oxygenic photosynthesis, similar to plants. The cells harbor thylakoid membranes composed of lipids related to those of chloroplasts in plants to accommodate the complexes of photosynthesis. The occurrence of storage lipids, including triacylglycerol or wax esters, which are found in plants, animals, and some bacteria, nevertheless remained unclear in cyanobacteria. We show here that the cyanobacterium sp. PCC6803 accumulates both triacylglycerol and wax esters (fatty acid phytyl esters). Phytyl esters accumulate in higher levels under abiotic stress conditions. The analysis of an insertional mutant revealed that the acyltransferase slr2103, with sequence similarity to plant esterase/lipase/thioesterase (ELT) proteins, is essential for triacylglycerol and phytyl ester synthesis in The recombinant slr2103 enzyme showed acyltransferase activity with phytol and diacylglycerol, thus producing phytyl esters and triacylglycerol. Acyl-CoA thioesters were the preferred acyl donors, while acyl-ACP (acyl carrier protein), free fatty acids, or galactolipid-bound fatty acids were poor substrates. The slr2103 protein sequence is unrelated to acyltransferases from bacteria (AtfA) or plants (DGAT1, DGAT2, PDAT), and therefore establishes an independent group of bacterial acyltransferases involved in triacylglycerol and wax ester synthesis. The identification of the gene responsible for triacylglycerol synthesis in cyanobacteria opens the possibility of using prokaryotic photosynthetic cells in biotechnological applications.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1073/pnas.1915930117DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7084069PMC
March 2020

The zeaxanthin epoxidase is degraded along with the D1 protein during photoinhibition of photosystem II.

Plant Direct 2019 Nov 1;3(11):e00185. Epub 2019 Dec 1.

Plant Biochemistry Heinrich-Heine-University Düsseldorf Düsseldorf Germany.

The xanthophyll zeaxanthin is synthesized in chloroplasts upon high light exposure of plants and serves central photoprotective functions. The reconversion of zeaxanthin to violaxanthin is catalyzed by the zeaxanthin epoxidase (ZEP). ZEP shows highest activity after short and moderate high light periods, but becomes gradually down-regulated in response to increasing high light stress along with down-regulation of photosystem II (PSII) activity. ZEP activity and ZEP protein levels were studied in response to high light stress in four plant species: , , and . In all species, ZEP protein was degraded during photoinhibition of PSII in parallel with the D1 protein of PSII. In the presence of streptomycin, an inhibitor of chloroplast protein synthesis, photoinhibition of PSII and ZEP activity as well as degradation of D1 and ZEP protein was strongly increased, indicating a close correlation of ZEP regulation with PSII photoinhibition and repair. The concomitant high light-induced inactivation/degradation of ZEP and D1 prevents the reconversion of zeaxanthin during photoinhibition and repair of PSII. This regulation of ZEP activity supports a coordinated degradation of D1 and ZEP during photoinhibition/repair of PSII and an essential photoprotective function of zeaxanthin during the PSII repair cycle.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/pld3.185DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6885522PMC
November 2019

Papaya Ringspot Virus Isolates From Papaya in Bangladesh: Detection, Characterization, and Distribution.

Plant Dis 2019 Nov 26;103(11):2920-2924. Epub 2019 Sep 26.

Department of Plant and Environmental Protection Sciences, University of Hawaii at Manoa, Honolulu, HI 96822, U.S.A.

Papaya ringspot virus (PRSV) is the major constraint to papaya () production in Bangladesh. Disease symptoms occurred in 90 to 100% of the plants surveyed. Full-length genomes of PRSV strains from severely infected papaya plants were determined using the Illumina NextSeq 500 platform, followed by Sanger DNA sequencing of viral genomes obtained by reverse-transcription PCR(RT-PCR). The genome sequences of two distinct PRSV strains, PRSV BD-1 (10,300 bp) and PRSV BD-2 (10,325 bp) were 74 and 83% identical to each other, respectively, at the nucleotide and amino acid levels. PRSV BD-1 and PRSV BD-2 were 74 to 75% and 79 to 88% identical, respectively, to other full-length PRSV sequences at the nucleotide level. Based on phylogenetic analysis, PRSV BD-2 was most closely related to PRSV-Meghalaya (MF356497) from papaya in India. PRSV BD-1 formed a branch distinct from the other PRSV sequences based on nucleotide and amino acid sequence comparisons. Comparisons of the genome sequences of these two strains with other sequenced PRSV genomes indicated two putative recombination events in PRSV BD-2. One recombinant event contained a 2,766-nucleotide fragment highly identical to PRSV-Meghalaya (MF356497). The other recombinant event contained a 5,105-nucleotide fragment highly identical to PRSV-China (KY933061). The occurrence rates of PRSV BD-1 and PRSV BD-2 in the sampled areas of Bangladesh were approximately 19 and 69%, respectively. Plants infected with both strains (11%) exhibited more severe symptoms than plants infected with either strain alone. The full-length genome sequences of these new PRSV strains and their distribution provide important information regarding the dynamics of papaya ringspot virus infections in papaya in Bangladesh.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-12-18-2186-REDOI Listing
November 2019

Characterization of Ti Ringspot-Associated Virus, a Novel Emaravirus Associated with an Emerging Ringspot Disease of .

Plant Dis 2019 Sep 12;103(9):2345-2352. Epub 2019 Jul 12.

Department of Plant and Environmental Protection Sciences, University of Hawaii, Honolulu, HI 96822.

Ti ringspot is an emerging foliar disease of the ti plant () in Hawaii that is quickly spreading throughout the islands. Symptoms include small chlorotic ringspots on leaves that often coalesce to form larger lesions. Although several virus species have been discovered in symptomatic plants, none have been associated with these symptoms. Here, we report and characterize a novel virus closely associated with ti ringspot symptoms in Hawaii. The presence of double membrane bodies approximately 85 nm in diameter in symptomatic cells and sequence analyses of five genomic RNA segments obtained by high-throughput sequencing indicate that this virus is most closely related to members of the plant virus genus . Phylogenetic and sequence homology analyses place this virus on a distinct clade within the genus along with , blue palo verde broom virus, and . Sequence identity values with taxonomically relevant proteins indicate that this represents a new virus species, which we are tentatively naming ti ringspot-associated virus (TiRSaV). TiRSaV-specific reverse transcription PCR assays detected the virus in several experimental herbaceous host species following mechanical inoculation. TiRSaV was also detected in eriophyid mites collected from symptomatic ti plants, which may represent a putative arthropod vector of the virus.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-09-18-1513-REDOI Listing
September 2019

Leaf Variegation and Impaired Chloroplast Development Caused by a Truncated CCT Domain Gene in Barley.

Plant Cell 2019 07 25;31(7):1430-1445. Epub 2019 Apr 25.

Genomics of Genetic Resources Group, Department of Genebank, Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), 06466 Seeland, Germany

Chloroplasts fuel plant development and growth by converting solar energy into chemical energy. They mature from proplastids through the concerted action of genes in both the organellar and the nuclear genome. Defects in such genes impair chloroplast development and may lead to pigment-deficient seedlings or seedlings with variegated leaves. Such mutants are instrumental as tools for dissecting genetic factors underlying the mechanisms involved in chloroplast biogenesis. Characterization of the green-white variegated mutant of barley () has greatly broadened the field of chloroplast biology, including the discovery of retrograde signaling. Here, we report identification of the gene (also known as ) by positional cloning as well as its functional validation based on independently induced mutants by Targeting Induced Local Lesions in Genomes (TILLING) and RNA-guided clustered regularly interspaced short palindromic repeats-associated protein 9 endonuclease-mediated gene editing. The phenotypes of the independent mutants imply residual activity of HvCMF7 in the original allele conferring an imperfect penetrance of the variegated phenotype even at homozygous state of the mutation. is a homolog of the Arabidopsis () () transcription factor gene , which was reported to be involved in the expression of nuclear genes essential for chloroplast biogenesis. Notably, in barley we localized HvCMF7 to the chloroplast, without any clear evidence for nuclear localization.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1105/tpc.19.00132DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6635869PMC
July 2019

A New Strain of Bean Common Mosaic Virus From Lima Bean (): Biological and Molecular Characterization.

Plant Dis 2019 Jun 15;103(6):1220-1227. Epub 2019 Apr 15.

2 Department of Entomology, Plant Pathology and Nematology, University of Idaho, Moscow, ID, U.S.A.; and.

Lima bean () is a popular cultivated legume vegetable grown in the United States for dry bean or canned bean production. In 2017, two symptomatic plants exhibiting mosaic, vein banding, and growth retardation were collected in a public garden in Honolulu, HI. Both samples contained bean common mosaic virus (BCMV), and the two BCMV isolates were subjected to biological characterization on a panel of 11 differential cultivars of common bean (), and to molecular characterization through whole genome sequencing. Both samples contained nearly identical BCMV sequences, named BCMV-A1, which, in turn, were 93% identical to the peanut stripe virus strain of BCMV. BCMV-A1 induced an unusually severe systemic necrosis in cultivar 'Dubbele Witte', and pronounced necrotic or chlorotic reaction in inoculated leaves of five other bean differentials. BCMV-A1 was able to partially overcome resistance alleles and expressed singly in common bean, inducing no systemic symptoms. Phylogenetic analysis of the BCMV-A1 sequence, and distinct biological reactions in common bean differentials suggested that BCMV-A1 represented a new lima bean strain of BCMV. In 2017, two BCMV isolates were collected in Idaho from common bean, and based on partial genome sequences were found 99% identical to the BCMV-A1 sequence. The data suggest that the lima bean strain of BCMV may have a wider circulation, including common bean as a host. This new strain of BCMV may thus pose a significant threat to common bean production.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-08-18-1307-REDOI Listing
June 2019

Occurrence of tomato leaf curl Bangladesh virus and associated subviral DNA molecules in papaya in Bangladesh: molecular detection and characterization.

Arch Virol 2019 Jun 4;164(6):1661-1665. Epub 2019 Apr 4.

Department of Plant and Environmental Protection Sciences, University of Hawaii at Manoa, Honolulu, HI, 96822, USA.

Forty-five papaya samples showing severe leaf curl symptoms were tested by PCR with a degenerate primer set for virus species in the genus Begomovirus. Of these, 29 were positive for tomato leaf curl Bangladesh virus (ToLCBV). The complete genome sequences of ToLCBV (GenBank accession no. MH380003) and its associated tomato leaf curl betasatellite (ToLCB) (MH397223) from papaya isolate Gaz17-Pap were determined and characterized. Defective betasatellites were found in ToLCBV-positive papaya isolates Gaz19-Pap, Gaz20-Pap and Gaz21-Pap. This study confirmed that papaya is a host of ToLCBV, ToLCB, and other defective and recombinant DNA satellites in Bangladesh.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00705-019-04235-8DOI Listing
June 2019

Molecular Characterization and Distribution of Two Strains of Dasheen mosaic virus on Taro in Hawaii.

Plant Dis 2017 Dec 13;101(12):1980-1989. Epub 2017 Oct 13.

College of Tropical Agriculture and Human Resources, University of Hawaii, Honolulu, HI 96822.

Dasheen mosaic virus (DsMV) is one of the major viruses affecting taro (Colocasia esculenta) production worldwide. Whole genome sequences were determined for two DsMV strains, Hawaii Strain I (KY242358) and Hawaii Strain II (KY242359), from taro in Hawaii. They represent the first full-length coding sequences of DsMV reported from the United States. Hawaii Strains I and II were 77 and 85% identical, respectively, with other completely sequenced DsMV isolates. Hawaii Strain I was most closely related to vanilla mosaic virus (VanMV) (KX505964.1), a strain of DsMV infecting vanilla in the southern Pacific Islands. Hawaii Strain II was most closely related to a taro DsMV isolate CTCRI-II-14 (KT026108.1) from India. Phylogenetic analysis of all available DsMV isolates based on amino acid sequences of their coat protein showed some correlation between host plant and genetic diversity. Analyses of DsMV genome sequences detected three recombinants from China and India among the six isolates with known complete genome sequences. The DsMV strain NC003537.1 from China is a recombinant of KJ786965.1 from India and Hawaii Strain II. Another DsMV strain KT026108.1 is a recombinant of Hawaii Strain II and NC003537.1 from China. The third DsMV strain KJ786965.1 from India is a recombinant of Hawaii Strain II and NC003537.1 from China. To our knowledge, this is the first report of recombination events in DsMV. Both Hawaii Strains I and II of DsMV were found widespread throughout the Hawaiian islands.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-04-17-0516-REDOI Listing
December 2017

Enhanced Safety and Efficacy of Oncolytic VSV Therapy by Combination with T Cell Receptor Transgenic T Cells as Carriers.

Mol Ther Oncolytics 2019 Mar 8;12:26-40. Epub 2018 Dec 8.

Klinik und Poliklinik für Innere Medizin II, Klinikum rechts der Isar, Technical University, 81675 Munich, Germany.

Vesicular stomatitis virus (VSV) represents an attractive oncolytic virotherapy platform because of its potent tumor cell-killing and immune-stimulating properties; yet the clinical translation of VSV faces numerous challenges, such as inefficient systemic delivery and severe side effects such as neurotoxicity. We hypothesized that we could overcome these limitations and simultaneously enhance the therapy, by combining VSV with adoptively transferred T cell receptor (TCR) transgenic T cells as carrier cells. We show that CD8 T central memory cells (CD8 T cm) can be efficiently loaded with VSV, they support intracellular virus production, and they can efficiently transfer VSV to tumor cells without compromising their own viability or antitumor reactivity. Loading VSV onto CD8 T cm not only improves the safety compared with systemic administration of naked virus, but this approach also allows for an effective delivery of virus to its tumor target, resulting in an effective combination therapy in NSG mice bearing subcutaneous human acute myeloid leukemia (AML) tumors. We conclude that the combination of potent tumor debulking provided by the oncolytic VSV with the added effector functions afforded by the cytotoxic immune carrier cells results in a potent and safer immunotherapeutic, which can be further developed for clinical translation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.omto.2018.12.001DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6325079PMC
March 2019

Proteomic Analysis of Plasmodesmata From Cell Suspension Cultures in Relation With Callose Biosynthesis.

Front Plant Sci 2018 19;9:1681. Epub 2018 Nov 19.

Division of Glycoscience, School of Engineering Sciences in Chemistry, Biotechnology and Health, Royal Institute of Technology, AlbaNova University Centre, Stockholm, Sweden.

Plasmodesmata are channels that link adjacent cells in plant tissues through which molecular exchanges take place. They are involved in multiple processes vital to plant cells, such as responses to hormonal signaling or environmental challenges including osmotic stress, wounding and pathogen attack. Despite the importance of plasmodesmata, their proteome is not well-defined. Here, we have isolated fractions enriched in plasmodesmata from cell suspension cultures of and identified 201 proteins that are enriched in these fractions, thereby providing further insight on the multiple functions of plasmodesmata. Proteomics analysis revealed an enrichment of proteins specifically involved in responses to stress, transport, metabolism and signal transduction. Consistent with the role of callose deposition and turnover in the closure and aperture of the plasmodesmata and our proteomic analysis, we demonstrate the enrichment of callose synthase activity in the plasmodesmata represented by several gene products. A new form of calcium-independent callose synthase activity was detected, in addition to the typical calcium-dependent enzyme activity, suggesting a role of calcium in the regulation of plasmodesmata through two forms of callose synthase activities. Our report provides the first proteomic investigation of the plasmodesmata from a tree species and the direct biochemical evidence for the occurrence of several forms of active callose synthases in these structures. Data are available via ProteomeXchange with identifier PXD010692.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fpls.2018.01681DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6252348PMC
November 2018

Preparation of Barley Roots for Histological, Structural, and Immunolocalization Studies Using Light and Electron Microscopy.

Methods Mol Biol 2019 ;1900:153-166

Department of Physiology and Cell Biology, Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Seeland, Germany.

Microscopic investigations of biological objects are an integral part in plant research and most fields of life sciences. They allow the description of morphological, histological, and structural aspects of individual cells or tissues. Based on various cell biological tools and methods it is possible to characterize different plant genotypes or study their adaptation to changing environmental conditions. In combination with antibodies raised against specific antigens and epitopes light and electron microscopy enable investigation of the function of single genes/proteins in plant growth and development or their role related to abiotic or biotic stresses.Here, we describe sample preparation of barley roots for cell biological investigations using light and electron microscopy, to characterize morphological, structural, and functional aspects on root sections and the root surface.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/978-1-4939-8944-7_10DOI Listing
June 2019

Air potato (Dioscorea bulbifera) plants displaying virus-like symptoms are co-infected with a novel potyvirus and a novel ampelovirus.

Virus Genes 2019 Feb 20;55(1):117-121. Epub 2018 Nov 20.

Department of Plant and Environmental Protection Sciences, University of Hawaii, Honolulu, HI, 96822, USA.

Air potato (Dioscorea bulbifera) plants being grown at the Florida Department of Agriculture and Consumer Services Division of Plant Industry Biological Control Laboratory II in Alachua County, Florida were observed exhibiting foliar mosaic symptoms characteristic of virus infection. A double-stranded RNA library generated from a symptomatic plant underwent high-throughput sequencing to determine if viral pathogens were present. Sequence data revealed the presence of two viral genomes, one with properties congruent with members of the genus Potyvirus (family Potyviridae), and the other with members of the genus Ampelovirus (family Closteroviridae). Sequence comparisons and phylogenetic placement indicate that both viruses represent novel species. The names "dioscorea mosaic virus" and "air potato virus 1" are proposed for the potyvirus and ampelovirus, respectively.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s11262-018-1616-6DOI Listing
February 2019

Oviposition Preferences and Behavior of Wild-Caught and Laboratory-Reared Coconut Rhinoceros Beetle, (Coleoptera: Scarabaeidae), in Relation to Substrate Particle Size.

Insects 2018 Oct 15;9(4). Epub 2018 Oct 15.

Department of Plant and Environmental Protection Sciences, University of Hawai'i at Mānoa, Honolulu, HI 96822, USA.

The coconut rhinoceros beetle (CRB), (L.) (Coleoptera: Scarabaeidae), has become one of the most important coconut and oil palm pests. This species was detected attacking coconut palms on O'ahu, Hawai'i in December 2013, and an eradication program was initiated. One of the major challenges for eradication has been the identification of new breeding sites. Information on the factors influencing oviposition is needed to aid in finding sites likely to host the immature stages of this insect. In this study, a series of choice tests were conducted to assess the oviposition preferences of both laboratory-reared and wild-caught CRB. Mated females, of both lab-reared and wild-caught beetles, were offered for oviposition a choice between sand and two mulch substrates, one with small and one with large particle sizes. Both types of CRB laid eggs preferentially in substrate of small particle size rather than large and none laid eggs in sand. Lab-reared and wild-caught CRB differed in their oviposition behavior and size. These results can be used to aid in the identification of breeding sites for management programs and eradication efforts.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/insects9040141DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6315680PMC
October 2018

Detection of Jasmine virus H and characterization of a second pelarspovirus infecting star jasmine (Jasminum multiflorum) and angelwing jasmine (J. nitidum) plants displaying virus-like symptoms.

Arch Virol 2018 Nov 1;163(11):3051-3058. Epub 2018 Aug 1.

Department of Plant and Environmental Protection Sciences, University of Hawaii, Honolulu, HI, 96822, USA.

Star jasmine (Jasminum multiflorum) plants growing in Hawaii expressing a diverse array of virus-like foliar symptoms were examined for the presence of a causal agent. Symptomatic tissues collected from three locations on the island of Oahu, Hawaii consistently harbored double-stranded (ds)RNAs approximately 4.2 and 1.7 kbp in size. Sanger and high-throughput sequencing approaches revealed these dsRNAs were from two distinct virus species co-infecting the same host plant. One of these two viruses was the recently characterized Jasmine virus H (JaVH), and the second we designated as Jasmine mosaic-associated virus (JMaV). Both viruses were subsequently found, by high-throughput sequencing, in a single angelwing jasmine (J. nitidum) plant exhibiting similar ringspot symptoms and growing at the U.S. National Arboretum in Washington, DC. Phylogenetic placement, genome organization, and sequence comparisons indicate these two viruses are classifiable as members of the genus Pelarspovirus (family Tombusviridae). To determine if either of these viruses were associated with the observed symptoms, a PCR-based detection assay was developed to detect and distinguish these two viruses in several Hawaii-grown plants. All 32 samples collected from four Oahu locations displayed symptoms. All 32 samples were positive for JaVH, and 16 were positive for JMaV. An asymptomatic star jasmine plant from the island of Hawaii was negative for both JaVH and JMaV. Both viruses were also found in a symptomatic J. sambac sample from Maryland while only JMaV was detected in a symptomatic Jasminum sp. sample from California.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00705-018-3947-yDOI Listing
November 2018

Expression of a Plastid-Targeted Flavodoxin Decreases Chloroplast Reactive Oxygen Species Accumulation and Delays Senescence in Aging Tobacco Leaves.

Front Plant Sci 2018 17;9:1039. Epub 2018 Jul 17.

Instituto de Biología Molecular y Celular de Rosario (IBR-UNR/CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas, Universidad Nacional de Rosario, Rosario, Argentina.

Leaf senescence is a concerted physiological process involving controlled degradation of cellular structures and reallocation of breakdown products to other plant organs. It is accompanied by increased production of reactive oxygen species (ROS) that are proposed to signal cell death, although both the origin and the precise role of ROS in the execution of this developmental program are still poorly understood. To investigate the contribution of chloroplast-associated ROS to natural leaf senescence, we used tobacco plants expressing a plastid-targeted flavodoxin, an electron shuttle flavoprotein present in prokaryotes and algae. When expressed in plants, flavodoxin specifically prevents ROS formation in chloroplasts during stress situations. Senescence symptoms were significantly mitigated in these transformants, with decreased accumulation of chloroplastic ROS and differential preservation of chlorophylls, carotenoids, protein contents, cell and chloroplast structures, membrane integrity and cell viability. Flavodoxin also improved maintenance of chlorophyll-protein complexes, photosynthetic electron flow, CO assimilation, central metabolic routes and levels of bioactive cytokinins and auxins in aging leaves. Delayed induction of senescence-associated genes indicates that the entire genetic program of senescence was affected by flavodoxin. The results suggest that ROS generated in chloroplasts are involved in the regulation of natural leaf senescence.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fpls.2018.01039DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6056745PMC
July 2018