Publications by authors named "Kiana Hassanpour"

27 Publications

  • Page 1 of 1

Secondary Piggyback Intraocular Lens for Management of Residual Ametropia after Cataract Surgery.

J Ophthalmic Vis Res 2021 Jan-Mar;16(1):12-20. Epub 2021 Jan 20.

Ophthalmic Research Center, Research Institute for Ophthalmology and Vision Science, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To investigate the indications, clinical outcomes, and complications of secondary piggyback intraocular lens (IOL) implantation for correcting residual refractive error after cataract surgery.

Methods: In this prospective interventional case series, patients who had residual refractive error after cataract surgery and were candidates for secondary piggyback IOL implantation between June 2015 and September 2018 were included. All eyes underwent secondary IOL implantation with the piggyback technique in the ciliary sulcus. The types of IOLs included Sulcoflex and three-piece foldable acrylic lenses. Patients were followed-up for at least one year.

Results: Eleven patients were included. Seven patients had hyperopic ametropia, and four patients had residual myopia after cataract surgery. The preoperative mean of absolute residual refractive error was 7.20 7.92, which reached 0.42 1.26 postoperatively ( 0.001). The postoperative spherical equivalent was within 1 diopter of target refraction in all patients. The average preoperative uncorrected distance visual acuity was 1.13 0.35 LogMAR, which significantly improved to 0.41 0.24 LogMAR postoperatively ( = 0.008). There were no intra- or postoperative complications during the 22.4 9.5 months of follow-up.

Conclusion: Secondary piggyback IOL implantation is an effective and safe technique for the correction of residual ametropia following cataract surgery. Three-piece IOLs can be safely placed as secondary piggyback IOLs in situations where specifically designed IOLs are not available.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18502/jovr.v16i1.8244DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7841270PMC
January 2021

Systemic supplemental oxygen therapy during accelerated corneal cross-linking for progressive keratoconus; a randomized clinical trial.

J Cataract Refract Surg 2020 Nov 23. Epub 2020 Nov 23.

Ophthalmic Research Center, Research Institute for Ophthalmology and Vision Science, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To investigate the potential additive effect of systemic supplemental oxygen administered during accelerated corneal crosslinking (CXL) for progressive keratoconus (KCN).

Setting: Department of ophthalmology at an academic center DESIGN:: Randomized Clinical Trial METHODS:: This study includes eyes with progressive KCN ranodmized to three different CXL protocols. The first group (OA-CXL) included 19 eyes that underwent an accelerated CXL protocol (9 mW/ cm2 for 10 minutes) while receiving systemic oxygen at a rate of 5 liters/minute for 10 minutes. The second group consisted of 14 eyes undergoing the same accelerated CXL protocol without supplemental oxygen therapy (A-CXL). The third group (C-CXL) was comprised of 14 eyes undergoing conventional CXL according to the Dresden protocol. All subjects were followed for at least six months. Visual acuity, keratometry and corneal biomechanical parameters including corneal hysteresis (CH) and corneal resistance factor (CRF) were measured preoperatively and 6 months postoperatively.

Results: Reduction in K max was significantly greater in the OA-CXL (P=0.01). At baseline, mean K max was 54.31 ± 3.64 D in the OA-CXL group, 54.66 ± 4.99 D in the A-CXL group and 56.03 ± 5.28 D in the C-CXL group (P=0.58), which reached 53.58 ± 3.24, 54.59 ± 4.65 and 55.87 ± 4.73 D at six months in the three study groups, respectively (P= 0.115). Mean CRF was increased significantly only in the OA-CXL group from a baseline value of 6.32 ± 2.12 to 7.38 ± 1.88 mmHg at 6 months (P=0.009) CONCLUSION:: This study suggests superior efficacy of an accelerated CXL protocol coupled with systemic oxygen supplementation as compared to the accelerated CXL protocol and the conventional protocolin eyes with progressive KCN. . In addition to greater reduction in K max as the primary outcome, improvement in corneal biomechanics was also observed at 6 months.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1097/j.jcrs.0000000000000513DOI Listing
November 2020

Is post-trabeculectomy serous choroidal detachment a risk factor for failure in the long term.

Eur J Ophthalmol 2020 Nov 26:1120672120972626. Epub 2020 Nov 26.

Department of Ophthalmology, Imam Hossein Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Background: To investigate the long-term effect of serous choroidal detachment on the success of trabeculectomy in glaucoma patients.

Methods: In this case-control study, 17 patients who underwent trabeculectomy and developed choroidal detachment, and completed at least 3 years of follow-up were included. The controls were matched based on age, sex, preoperative intraocular pressure, and glaucoma type, and lack of choroidal detachment. Surgical success was defined based on two definitions of 5 < IOP < 16 and 20% reduction from the baseline and no need for further glaucoma surgery and all the same but 5 < IOP < 22.

Results: The mean estimated duration of survival ±SD was 2.73 ± 0.35 years (CI 95% 2.1, 3.4), which was significantly shorter than 3.98 ± 0.38 years (CI 95% 3.3, 4.7) in the control group. (LogRank = 5.03  = 0.02). Cumulative probability of success was 76.5%, 52.9%, 29.4%, 17.6%, and 11.8% in year 1, 2, 3, 4, and 5 in the case group, respectively. Corresponding values were 88.2%, 82.4%, 68.6%, 58.8%, and 47.1%. In the control group, respectively. At baseline, average IOP was 22.3 ± 2.7 and 23.8 ± 8.3 mmHg in the case and control groups, respectively ( = 0.17). Mean IOP was significantly higher in the case group than in the control group in years 2, 3, 4, and 5.

Conclusion: Serous choroidal detachment affects the long-term surgical success of trabeculectomy, especially in patients with advanced glaucoma when lower target pressure is required.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1177/1120672120972626DOI Listing
November 2020

Combining Baerveldt Implant with Trabectome Negates Tube Fenestration: A Coarsened-matched Comparison.

J Ophthalmic Vis Res 2020 Oct-Dec;15(4):509-516. Epub 2020 Oct 25.

Department of Ophthalmology, School of Medicine, University of Pittsburgh, Pittsburgh, Pennsylvania, United States.

Purpose: To assess the efficacy and survival rate of the Trabectome-mediated ab interno trabeculectomy combined with non-fenestrated Baerveldt glaucoma implant compared with the Baerveldt glaucoma implant alone.

Methods: In this retrospective comparative case series, 175 eyes undergoing primary glaucoma surgery (Baerveldt-Trabectome [BT] group: 60 eyes and Baerveldt [B] group: 115 eyes) were included. Participants were identified using the procedural terminology codes. Groups were then matched by Coarsened Exact Matching that resulted in the inclusion of 51 eyes in each group. The primary outcome measure was surgical success defined as 5 mmHg intraocular pressure (IOP) 21 mmHg, and IOP reduction 20% from baseline, and no need to reoperation for glaucoma. Secondary outcome measures were IOP, number of glaucoma medications, and best-corrected visual acuity (BCVA).

Results: The cumulative probability of success at one year was 61% in the BT group and 50% in the B group. IOP decreased from 23.5 2.4 mmHg at baseline to 14.1 2.7 mmHg at the final follow-up in the BT group ( = 0.001). The corresponding values for the B group were 23.2 2.0 mmHg and 13.9 1.6 mmHg, respectively ( = 0.001). There was no significant difference between the groups in terms of IOP at the final follow-up ( = 0.56). The number of medications at baseline was 2.3 0.3 in both groups. However, the BT group needed fewer drops at all postoperative time intervals and used 1.1 0.3 versus 2.0 0.4 eye drops (group B) at the final follow-up visit ( = 0.004). Eyes in B with phacoemulsification had a significantly higher IOP on day 1 compared to B (23.2 14.3 versus 17.9 11.4, = 0.041). During the one-year follow-up, 7 (13.7%) patients in BT group and 18 (35.2%) in B group experienced hypotony ( = 0.04). No dangerous hypotony or hypertension occurred in BT group. The mean BCVA at baseline was 0.64 0.85 logMAR and changed to 0.55 0.75 logMAR in BT and B groups, respectively ( = 0.663). The corresponding numbers for the final follow-up visit was 0.72 1.07 and 0.63 0.97 logMAR, respectively ( = 0.668).

Conclusion: We observed similar rates of success and IOP reduction using BT and B techniques. BT group needed fewer glaucoma medications. Tube fenestration was unnecessary in BT group resulting in less postoperative ocular hypotony and hypertension. The results of our study indicate that additional trabectome procedure makes Baerveldt glaucoma implant safer, easier to handle, and more predictable in the most vulnerable patients with advanced glaucoma.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18502/jovr.v15i4.7789DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7591847PMC
October 2020

Macular hole and submacular hemorrhage secondary to retinal arterial macroaneurysm - successfully treated with a novel surgical technique.

GMS Ophthalmol Cases 2020 6;10:Doc31. Epub 2020 Aug 6.

Ophthalmic Research Center, Research Institute for Ophthalmology and Vision Science, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

To present a 65-year-old patient with macular hole (MH) and submacular hemorrhage (SMH) secondary to a ruptured retinal arterial macroaneurysm (RAM) which was successfully treated with a novel surgical technique. A 65-year-old woman presented with a 1-week history of sudden-onset visual loss in her right eye. Her best-corrected visual acuity (BCVA) was hand motion in the right eye. Her fundus examination revealed intraretinal and massive subretinal hemorrhage with macular involvement. An MH with an approximate diameter of 600 microns was also noted. The patient was treated by a standard pars plana vitrectomy (PPV) and internal limiting membrane (ILM) peeling, followed by 10 µg recombinant tissue plasminogen activator injection into the submacular space via the MH with a 25-gauge vitrectomy probe. BCVA of the patient increased to 20/320 and 20/60, one and four weeks after surgery, respectively. Optical coherence tomography (OCT) images confirmed the complete anatomical closure of the MH and the restoration of the outer retinal layers such as the external limiting membrane and the ellipsoid zone. This case report expands our knowledge about the management of MH in combination with SMH after a ruptured RAM. We suggest the use of a vitrectomy probe and MH for subretinal recombinant tissue plasminogen activator (rtPA) injection.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3205/oc000158DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7452955PMC
August 2020

The Long-term Visual Outcomes of Primary Congenital Glaucoma.

J Ophthalmic Vis Res 2020 Jul-Sep;15(3):326-330. Epub 2020 Aug 6.

Division of Ophthalmology, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, USA.

Purpose: To evaluate the long-term visual outcomes of ab externo trabeculotomy for primary congenital glaucoma (PCG) at a single pediatric ophthalmology center.

Methods: In this retrospective single-center case series, data from 63 eyes of 40 patients who underwent ab externo trabeculotomy between September 2006 and June 2018 were included. The data were analyzed for best corrected visual acuity (BCVA), stereopsis, and surgical success. Kaplan-Meier analysis was performed using the surgical success criteria defined as intraocular pressure (IOP) 21 mmHg and 20% below baseline without the need for additional glaucoma surgery.

Results: BCVA at the time of diagnosis was 0.37 0.48 logMAR, which changed to 0.51 0.56 logMAR at the final follow-up ( = 0.08). Twenty-five percent of patients had BCVA equal to or better than 20/40 at the final visit. The mean refraction at baseline was -4.78 5.87 diopters, which changed to less myopic refraction of -2.90 3.83 diopters at the final visit. Optical correction was prescribed in 66% of eyes at the final visit. The average final stereopsis was 395.33 sec of arc. The linear regression model showed a significant association between the surgery success rate and final BCVA as well as stereoacuity (-values: 0.04 and 0.03, respectively). Intraocular pressure (IOP) decreased significantly from 29.79 7.67 mmHg at baseline to 16.13 3.41 mmHg at the final follow-up ( = 0.001).

Conclusion: Patients with PCG can achieve an acceptable visual acuity and stereoacuity, particularly in cases of timely intervention and close follow-up.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18502/jovr.v15i3.7451DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7431714PMC
August 2020

The role of primary needle revision after Ahmed glaucoma valve (AGV) implantation.

Int Ophthalmol 2021 Jan 27;41(1):99-105. Epub 2020 Aug 27.

Basir Eye Health Research Center, Tehran, Iran.

Purpose: To evaluate the efficacy and safety of primary needle revision after Ahmed Glaucoma Valve (AGV) implantation in comparison with glaucoma medication use.

Methods: In this interventional case series, 23 eyes of 23 patients who underwent AGV implantation were enrolled. Needle revision was performed when the intraocular pressure was higher than the target pressure before glaucoma medications. Using a 30-gauge needle, the Tenon's capsule over the plate was incised and the bleb was reformed. Patients were examined on a postoperative day one, weekly (for four weeks), and every 1-3 months. Two criteria were used to define cumulative success as a minimum 20% reduction in IOP and 5 < IOP ≤ 21 mmHg (Criteria A) or 5 < IOP ≤ 18 mmHg (Criteria B) without (Complete success) or with (Qualified success) glaucoma medication.

Results: In this pilot study, we enrolled 23 patients with a mean age of 53.8 ± 12.4 years (25-78 years) who underwent AGV implantation and a one-year follow-up period. The mean number of primary needle revision was 2.2 ± 1.6 (1-6). One year postoperatively, the cumulative success rate was 91.4% and 86.9% based on Criteria A and B, respectively. The average of preoperative IOP was 28.26 ± 8.86 mmHg (range 15-46 mmHg), reaching 13.78 ± 3.54 mmHg (range 8-20) at the end of the one-year follow-up. (P < 0.001) The mean preoperative medication significantly decreased from a median of 4 (range 3-4) at baseline to 2 (range 1-4) after the one-year follow-up (P < 0.001). One patient experienced leakage over the plate, which was successfully treated via conservative management.

Conclusion: This pilot study showed that primary needle revision is a safe and effective method for controlling IOP after AGV implantation with a lower need for medication.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s10792-020-01556-5DOI Listing
January 2021

Bilateral Keratoconus in a Patient with Isolated Foveal Hypoplasia.

J Ophthalmic Vis Res 2020 Apr-Jun;15(2):256-258. Epub 2020 Apr 6.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18502/jovr.v15i2.6745DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7151513PMC
April 2020

Lower- and higher-order aberrations after photorefractive keratectomy with and without compensation of pupil centroid shift: fellow eye comparison.

J Cataract Refract Surg 2020 02;46(2):267-275

From the Labbafinejad Medical Center, Department of Ophthalmology, Shahid Beheshti University of Medical Sciences (Faramarzi, Hassanpour, Yazdani), Tehran, Iran; and John A Moran Eye Center, Department of Ophthalmology and Visual Sciences, University of Utah (Moshirfar), Salt Lake City, USA.

Purpose: To study the effect of pupil centroid shift (PCS) compensation on lower- and higher-order aberrations (HOAs) after photorefractive keratectomy (PRK).

Setting: Labbafinejad Medical Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Design: Prospective intrasubject fellow eye study.

Methods: One hundred twelve eyes of 56 patients with simple myopia or myopic astigmatism scheduled for PRK were enrolled. Preoperatively, the amount of PCS was measured in the horizontal and vertical directions. All eyes received wavefront-optimized treatment with static cyclotorsion compensation. PCS compensation was turned on for the right eye of each subject (PCS-on group), and turned off for the left eye (PCS-off group). Postoperatively, refraction and corneal HOAs were compared between the study groups at 6 months.

Results: Mean preoperative myopia was -3.84 diopters (D) ± 2.41 (SD) vs -3.75 ± 2.27 D (P = .408), whereas mean preoperative cylinder was -1.18 D ± 1.15 (SD) vs -1.14 ± 1.16 D (P = .769) in the PCS-on and PCS-off groups, respectively. Mean absolute PCS values were 62.25 μm ± 41.82 (SD) vs 55.92 ± 37.47 μm (P = .45) in the horizontal direction and 65.04 ± 47.16 μm vs 58.40 ± 45.44 μm in the vertical direction (P = .29) in the PCS-on and PCS-off groups, respectively. The study groups were comparable in terms of postoperative refraction and root mean square of total corneal HOAs.

Conclusions: Compensation of PCS did not affect lower- and higher-order aberrations after wavefront-optimized PRK with static cyclotorsion compensation in myopic or myopic astigmatic eyes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1097/j.jcrs.0000000000000010DOI Listing
February 2020

The value of Morbidity & Mortality (M&M) conferences in residency training: a proposed model from an academic medical center in Iran.

Patient Saf Surg 2020 27;14. Epub 2020 Jan 27.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Boostan 9 St. Pasdaran Ave., Tehran, 16666 Iran.

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s13037-020-0231-3DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6986155PMC
January 2020

Long-term surgical outcomes of ab externo trabeculotomy in the management of primary congenital glaucoma.

J AAPOS 2019 08 26;23(4):222.e1-222.e5. Epub 2019 Jun 26.

Division of Ophthalmology, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, United States; Department of Ophthalmology, Northwestern University Feinberg School of Medicine, Chicago, United States.

Purpose: To analyze the long-term results of ab externo trabeculotomy with a Harms trabeculotome at a single, tertiary care pediatric hospital.

Methods: The medical records of pediatric patients operated on between September 2006 and June 2018 were reviewed retrospectively. Kaplan-Meier analysis was performed, with success defined as postoperative intraocular pressure (IOP) of ≤21 mm Hg, >20% reduction from preoperative IOP, and no need for further glaucoma surgery. Risk factors for failure were identified using Cox proportional hazards ratio.

Results: A total of 63 eyes of 40 patients were included. The cumulative probability of success rate was 83% at 3 months, 76% at 6, 73% at 12, 72% at 18, and 65% at final visit. Presentation within 3 months of life was associated with a less favorable outcome. Thirty-five eyes (56%) underwent repeat trabeculotomy to treat a different area of the trabecular meshwork because of inadequately controlled IOP after the first session. Of those who needed another session of trabeculotomy, the final success rate was 60.2%. IOP significantly decreased from 29.79 ± 7.67 mm Hg at baseline to 16.13 ± 3.41 mm Hg by final follow-up (P = 0.001). Patients were followed for an average of 85.74 ± 32.95 months. IOP and success rates remained stable 18 months after surgery.

Conclusions: In our patient cohort, ab externo trabeculotomy was associated with good long-term results. More extensive trabeculotomy (ie, more than one procedure) was associated with better long-term success rates.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jaapos.2019.05.008DOI Listing
August 2019

Efficacy and safety of micropulse laser trabeculoplasty for primary open angle glaucoma.

Int J Ophthalmol 2019 18;12(5):784-788. Epub 2019 May 18.

Department of Ophthalmology, School of Medicine, University of Pittsburgh, PA 15213, USA.

Aim: To evaluate the efficiency and safety of micropulse laser trabeculoplasty (MLT) for primary open angle glaucoma (POAG) patients.

Methods: Retrospective study. POAG patients undergoing MLT in Peking University Third Hospital from June 2016 to November 2017. Seventy-two eyes of 72 POAG patients were enrolled. Only one eye of each patient was treated by MLT. The intraocular pressure (IOP) before MLT and at 1d, 1, 4, 12 and 24wk and glaucoma medication before and after treatment were compared.

Results: The IOP was 20.6±5.9 mm Hg before MLT and 20.8±6.8 mm Hg at 2h after MTL. The IOP at 1d, 1, 4, 12 and 24wk was 17.9±4.4, 18.0±4.3, 17.5±3.4, 17.0±2.7, and 16.5±2.9 mm Hg, respectively. The IOP before and after MLT demonstrated a statistically significant difference by ANOVA analyses (=5.797, <0.001). Least significant difference -tests showed there was no statistically significant difference between pre-MLT IOP within 2h after MLT (=0.207). The statistically significant difference was confirmed between the pre-MLT IOP at 1d, 1, 4, 12 and 24wk after MLT (=0.006, 0.009, 0.001, <0.001, <0.001, respectively). The number of glaucoma medications before MLT was 1.7±1.4 and 1.5±1.4 24wk after MLT with a significantly statistical difference (=2.219, =0.031).

Conclusion: MLT is effective and safe for POAG patients. No patient experienced IOP spikes after MLT. The IOP 6mo after treatment decreased significantly with less glaucoma medication.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18240/ijo.2019.05.13DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6520269PMC
May 2019

Recurrent Peripheral Stromal Keratitis Following Corneal Collagen Cross-linking: A Case Report.

J Ophthalmic Vis Res 2019 Apr-Jun;14(2):211-214

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: Corneal collagen cross-linking (CXL) has become the standard initial intervention in eyes with progressive keratoconus (KC) that have not undergone keratoplasty. The prolonged exposure of the de-epithelialized cornea predisposes it to adverse complications, such as microbial keratitis and melting. Herein, we report a case of bilateral recurrent peripheral stromal keratitis following CXL.

Case Report: We present a 29-year-old woman who complained of ocular redness and discomfort in both eyes for 4 months, and had undergone bilateral CXL 10 months before. The best spectacle corrected visual acuity (BSCVA) was 60/200 in the right and 80/200 in the left eye. Both eyes showed moderate conjunctival hyperemia, dilation, and engorgement of the perilimbal episcleral vessels. There was a peripheral corneal stromal infiltration with thinning, and an overlying epithelial defect in the right eye with a lucid interval from the limbus. She was treated with lubricating eye drops and ointments and topical corticosteroids every 4 hours for 2 weeks then slowly tapered off. Afterwards, she experienced multiple recurrences in both eyes, which were successfully managed with topical corticosteroids and lubricants. After 2 years, her BSCVA was 20/30 with -3.00-5.50 * 90 in the right eye and 20/40 with -4.00-4.50 * 90 in the left.

Conclusion: Although CXL is a safe method, studies with longer follow-ups are needed to investigate the risk of rare complications.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4103/jovr.jovr_100_18DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6504722PMC
May 2019

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment.

Ophthalmic Genet 2019 04 15;40(2):146-149. Epub 2019 Apr 15.

c Ophthalmic Research Center , Shahid Beheshti University of Medical Sciences , Tehran , Iran.

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/13816810.2019.1597374DOI Listing
April 2019

Fuchs heterochromic iridocyclitis-associated glaucoma: a retrospective comparison of primary Ahmed glaucoma valve implantation and trabeculectomy with mitomycin C.

F1000Res 2018 22;7:876. Epub 2018 Jun 22.

Department of Epidemiology and Biostatistics, School of Public Health, Tehran University of Medical Sciences, Tehran, Tehran, 19839-63113, Iran.

The aim of this study was to compare the safety and efficacy of primary trabeculectomy with mitomycin C and Ahmed glaucoma valve (AGV) implantation in patients with Fuchs heterochromic iridocyclitis (FHIC)-related glaucoma, a rare complication of an uncommon form of uveitis. s In this retrospective comparative case series, 26 FHIC-associated glaucoma patients received trabeculectomy (n=12) or an AGV (n=14). Primary outcome measures were surgical success, defined as intraocular pressure (IOP) ≤21 mmHg, decreasing ≥20% from baseline, and no secondary glaucoma surgery. Secondary outcome measures were the number of glaucoma medications, complications, best corrected visual acuity (BCVA), and IOP. The follow-up was 34.0±17.7 months in patients that received trabeculectomy and 33.4±18.6 months in AGV (P= 0.837). The cumulative probability of success rate was 41.7% for trabeculectomy and 85.7% for AGV, with no significant difference in complications (P>0.05). The IOP in patients that received trabeculectomy dropped from 23.4±3.3 mmHg to 21.6±5.2 mmHg at the final visit (P= 0.041). In patients that received AGV, the IOP decreased from 24±7.8 to 17.1±2.6 mmHg (P= 0.003). The number of glaucoma medications at baseline were 3.3±0.5 in those that received trabeculectomy and 3±0.6 in those that received AGV (P=0.233), and decreased to 2.4±1.0 (P=0.008) and 1.7±0.6 (P=0.002), respectively. BCVA was equal in both groups and did not change (P>0.05). Primary AGV had a higher success rate than trabeculectomy, with patients also needing fewer medications for the management of FHIC-associated glaucoma.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.12688/f1000research.15244.2DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6198260PMC
September 2019

Five-year clinical outcomes of combined phacoemulsification and trabectome surgery at a single glaucoma center.

Graefes Arch Clin Exp Ophthalmol 2019 Feb 26;257(2):357-362. Epub 2018 Sep 26.

Department of Ophthalmology, School of Medicine, University of Pittsburgh, 203 Lothrop St, Suite 819, Pittsburgh, PA, 15213, USA.

Purpose: To analyze the 5-year results of trabectome ab interno trabeculectomy of a single glaucoma center.

Method: In this retrospective interventional single-center case series, data of 93 patients undergoing ab interno trabeculotomy between September 2010, and December 2012 were included. Kaplan-Meier analysis was performed using success criteria defined as postoperative intraocular pressure (IOP) ≤ 21 mmHg, and > 20% reduction from preoperative IOP, and no need for further glaucoma surgery. Risk factors for failure were identified using Cox proportional hazards ratio (HR).

Results: The retention rate for 5-year follow-up was 66%. The cumulative probability of success at 1, 2, 3, 4, and 5 years was 82.6%, 76.7%, 73.9%, 72.3%, and 67.5%. Risk factors for failure were lower baseline IOP (HR = 0.27, P = 0.001), younger age (HR = 0.25, P = 0.02), and higher central corneal thickness (HR = 0.18, P = 0.01). Exfoliative glaucoma was associated with a higher success rate (HR = 0.39, P = 0.02). IOP was decreased significantly from 20.0 ± 5.6 mmHg at baseline to 15.6 ± 4.6 mmHg at 5-year follow-up (P = 0.001). The baseline number of glaucoma medications was 1.8 ± 1.2, which decreased to 1.0 ± 1.2 medications at 5 years.

Conclusion: Trabectome surgery was associated with a good long-term efficacy and safety profile in this single-center case series with a high retention rate.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00417-018-4146-yDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7798351PMC
February 2019

Factors associated with lamina cribrosa displacement after trabeculectomy measured by optical coherence tomography in advanced primary open-angle glaucoma.

Graefes Arch Clin Exp Ophthalmol 2018 Dec 24;256(12):2391-2398. Epub 2018 Sep 24.

Department of Ophthalmology, School of Medicine, University of Pittsburgh, 203 Lothrop St., Pittsburgh, PA, 15213, USA.

Purpose: To investigate the relationship of lamina cribrosa displacement to corneal biomechanical properties and visual function after mitomycin C-augmented trabeculectomy.

Method: Eighty-one primary open-angle eyes were imaged before and after trabeculectomy using an enhanced depth spectral domain optical coherence tomography (SDOCT). Corneal biomechanical properties were measured with the ocular response analyzer before the surgery. The anterior lamina cribrosa (LC) was marked at several points in each of the six radial scans to evaluate LC displacement in response to intraocular pressure (IOP) reduction. A Humphrey visual field test (HVF) was performed before the surgery as well as 3 and 6 months, postoperatively.

Results: Factors associated with a deeper baseline anterior lamina cribrosa depth (ALD) were cup-disc ratio (P = 0.04), baseline IOP (P = 0.01), corneal hysteresis (P = 0.001), and corneal resistance factor (P = 0.001). After the surgery, the position of LC became more anterior (negative), posterior (positive), or remained unchanged. The mean LC displacement was - 42 μm (P = 0.001) and was positively correlated with the magnitude of IOP reduction (regression coefficient = 0.251, P = 0.02) and negatively correlated with age (regression coefficient = - 0.224, P = 0.04) as well as baseline cup-disk ratio (Regression coefficient = - 0.212, P = 0.05). Eyes with a larger negative LC displacement were more likely to experience an HVF improvement of more than a 3 dB gain in mean deviation (P = 0.002).

Conclusion: A larger IOP reduction and younger age was correlated with a larger negative LC displacement and improving HVF. The correlation between lower SDOCT cup-disc ratio and postoperative negative LC displacement was borderline (P = 0.05). Corneal biomechanics did not predict LC displacement.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00417-018-4135-1DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7798352PMC
December 2018

Extended pharmacological miosis is superfluous after glaucoma angle surgery: A retrospective study.

F1000Res 2018 12;7:178. Epub 2018 Feb 12.

Department of Ophthalmology, School of Medicine, University of Pittsburgh, Pittsburgh, PA, USA.

Pilocarpine is commonly used after angle surgery for glaucoma despite a host of side effects and risks. We hypothesized that a pharmacological miosis during the first two months does not improve short- and long-term results of trabectome-mediated trabeculectomy. In this retrospective comparative 1-year case series, we compared 187 trabectome surgery eyes with (P+) or without (P-) 1% pilocarpine for two months. Primary outcome measures were the surgical success defined as intraocular pressure (IOP) ≤ 21 mmHg and decreased ≥ 20%, and no secondary glaucoma surgery. Secondary outcome measures were the number of glaucoma medications, complications, and IOP. We categorized 86 (46%) eyes as P- and 101 (54%) eyes as P+. The mean age was 69.8±10.1 in P- and 70.5±9.4 in P+ (P=0.617) with equal gender distribution (P=0.38). The cumulative probability of qualified success at 12 months was 78.1% in the P- and 81% in the P+ (P=0.35). The IOP was decreased significantly from 20.2±6.8 mmHg at baseline to 15.0±4.8 mmHg at 12 months follow-up in P- (P=0.001) and 18.8±5.3 and 14.7±4.0, respectively (P=0.001). The medications decreased significantly from 1.4±1.2 in P- and 1.4±1.2 in P+ at baseline to 1.0±1.2 and 0.7±1.0, respectively (P=0.183). P- and P+ did not differ in IOP or medications (all P>0.05). In Multivariate Cox Regression models, the baseline IOP and central corneal thickness were associated with failure. Use of postoperative pilocarpine does not improve the efficacy of trabectome surgery.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.12688/f1000research.13756.1DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5897784PMC
February 2018

Impact of same-session trabectome surgery on Ahmed glaucoma valve outcomes.

Graefes Arch Clin Exp Ophthalmol 2018 Aug 30;256(8):1509-1515. Epub 2018 Mar 30.

Department of Ophthalmology, School of Medicine, University of Pittsburgh, 203 Lothrop St, Pittsburgh, PA, 15213, USA.

Purpose: To evaluate the efficacy and survival rates of same session ab interno trabeculectomy with the trabectome and Ahmed glaucoma valve implant (AT) in comparison to the Ahmed glaucoma valve alone (A).

Method: A total of 107 eyes undergoing primary glaucoma surgery were enrolled in this retrospective comparative case series, including 48 eyes which underwent AT and 59 eyes which received A alone. Participants were identified using the procedural terminology codes, and their medical records were reviewed. The primary outcome measure was success defined as IOP > 5 mmHg, ≤ 21 mmHg and ≥ 20% reduction of IOP from baseline at two consecutive visits after 3 months, and no need for glaucoma reoperation. Secondary outcome measures were IOP, the number of glaucoma medications, incidence of a hypertensive phase, and best corrected visual acuity (BCVA).

Results: The cumulative probability of success at 1 year was 70% in AT, and 65% in A (p = 0.85). IOP decreased significantly from 26.6 ± 10.1 mmHg at baseline to 14.7 ± 3.3 mmHg at the final follow-up in AT (p = 0.001). The corresponding numbers for A were 27.8 ± 10.2 and 16.7 ± 4.9, respectively (p = 0.001). The final IOP was significantly lower in AT (p = 0.022). The number of medications at baseline was comparable in both groups (2.6 ± 1.2 in AT and 2.5 ± 1.3 in A, p = 0.851). Corresponding number at 1 year visit was 1.2 ± 2 in AT and 2.8 ± 1.8 in A (p = 0.001). The incidence of a hypertensive phase was 18.7% in AT and 35.5% in A (p = 0.05). HP resolved in only 30% of eyes. The criteria for HP resolution were fulfilled in 9 eyes (30%). There was no difference in the rate of resolution of the hypertensive phase between AT and A (33.3 and 28.5%, respectively, p = 0.67).

Conclusion: Ahmed glaucoma valve implant with same session trabectome surgery significantly decreased the rate of the hypertensive phase and postoperative IOP as well as the number of glaucoma medications.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00417-018-3967-zDOI Listing
August 2018

Graft-free glaucoma drainage device implantation: Short tunnel small flap technique.

Eur J Ophthalmol 2019 Jan 27;29(1):57-60. Epub 2018 Mar 27.

2 Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose:: To introduce a new technique of short tunnel small flap graft-free glaucoma drainage device implantation and report our early experience.

Methods:: In a retrospective study, patients with uncontrolled primary open-angle glaucoma underwent short tunnel small flap graft-free Ahmed glaucoma valve implantation. In this technique, plate is sutured 8-10 mm posterior to the limbus and a partial thickness flap is made at 1 or 11 o'clock position, 1 mm posterior the limbus. Tube was passed through a tunnel immediately anterior to the plate into the proximal edge of the flap and then inserted into the anterior chamber via a route underneath the flap. Flap then covered the distal end of the tube and conjunctiva was sutured. Patients were followed for a minimum of 12 months for any sign of tube exposure and rise of intraocular pressure.

Results:: A total of 16 consecutive patients with refractory primary open-angle glaucoma and uncontrolled intraocular pressure were included in this study. Mean age of participants was 59 ± 8.3 years and nine (56%) were male. Mean intraocular pressure at the time of presentation was 26 ± 6.2 mm Hg, which dropped to 16 ± 4.5 at 12 months postoperative follow-up. The number of medications at baseline was 3 ± 1 eye drops, which was decreased to 1 ± 1.2 at 12 months. There were no conjunctival and flap-related complications or any sign of tube exposure during 1-year postoperative period.

Conclusion:: Short tunnel small flap graft-free glaucoma drainage device implantation technique combines advantages of both tunneling and flap techniques. Also, it may result in better tube positioning and more favorable cosmetic outcomes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1177/1120672118761458DOI Listing
January 2019

Clinical outcomes of Ahmed glaucoma valve implantation in pediatric glaucoma.

Eur J Ophthalmol 2019 Jan 27;29(1):44-51. Epub 2018 Mar 27.

1 Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose:: To evaluate the outcomes of Ahmed glaucoma valve implantation in refractory primary congenital glaucoma as well as primary procedure in aphakic glaucoma.

Method:: In this retrospective study, medical records of patients who underwent Ahmed glaucoma valve implantation for refractory glaucoma and aphakic glaucoma were reviewed. Primary outcome measures were the surgical success defined as intraocular pressure ≤21 mm Hg and decreased ≥20% and no secondary glaucoma surgery. Secondary outcome measures were the number of glaucoma medications, complications, best corrected visual acuity, and intraocular pressure.

Results:: A total of 62 eyes of refractory primary congenital glaucoma patients (group 1) and 33 eyes of aphakic glaucoma patients (group 2) were included in our study. Mean follow-up was 51 ± 33 months in group 1 and 49 ± 41 months in group 2 (p = 0.82). The cumulative probability of success was 90% in both groups at the first year; however, the success rate was 52.5% in group 1 and 71.5% in group 2 at 5 years' follow-up visit. In group 1, the mean intraocular pressure ± standard deviation was 33.1 ± 8.6 mm Hg at the baseline and decreased to 17.1 ± 5.3 mm Hg at 1 year and 18.5 ± 6.4 at 3 years postoperatively (all p's < 0.001). Corresponding values for group 2 were 28.9 ± 6.1, 15.2 ± 4.6, and 16.0 ± 5.9 mm Hg, respectively (all p's < 0.001). The baseline number of glaucoma medications was 3 ± 0.7 that decreased to 2 ± 0.8 at final follow-up (p = 0.02).

Conclusion:: Ahmed glaucoma valve implantation has a moderate success rate in the management of refractory primary congenital glaucoma with an increased chance of tube-related complications. The surgical success rate is higher in case of primary Ahmed glaucoma valve implant for aphakic glaucoma with acceptable safety profile.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1177/1120672118761332DOI Listing
January 2019

The Effect of Combined Systemic Erythropoietin and Steroid on Non-arteritic Anterior Ischemic Optic Neuropathy: A Prospective Study.

Curr Eye Res 2017 07 26;42(7):1079-1084. Epub 2017 Feb 26.

c Orange Coast College , Costa Mesa , CA , USA.

Background: To investigate the effect of combined intravenous (IV) erythropoietin (EPO) and corticosteroid as well as systemic steroid alone for the treatment of non-arteritic anterior ischemic optic neuropathy (NAION).

Methods: In this prospective interventional comparative case series, 113 consecutive patients diagnosed with recent onset (less than 14 days) NAION were included. Patients were categorized into three groups. 40 patients received systemic IV corticosteroid combined with recombinant human erythropoietin (rhEPO) (group 1), 43 patients received systemic corticosteroid alone (group 2), and 30 patients were enrolled as the control group (group 3). Functional and structural outcomes were analyzed 3 and 6 months after treatment. Best corrected visual acuity (BCVA) was the main outcome, and mean deviation (MD) and peripaillary retinal nerve fiber layer thickness (PRNFLT) were secondary outcome measures.

Results: The mean BCVA at the time of presentation was 0.98 (±0.65), 0.96 (±0.67), and 1.02 (±0.63) log MAR in groups 1, 2, and 3, respectively (P = 0.95). At month 3, the corresponding values were 0.73 (±0.45), 0.76 (±0.49), and 0.8 (±0.45) log MAR (P = 0.80), and at the 6-month follow-up, they were 0.76 (±0.45), 0.71 (±0.4), and 0.71 (±0.46) log MAR, respectively (P = 0.87). There was no statistically significant difference in BCVA between months 3 and 6, which implies stabilization of the visual acuity by month 3. Considering the visual field, within 6 months of follow-up after disease onset, the MD index improved in all groups with no statistically significant differences between them (P = 0.82). PRNFLT at presentation was 178 (±60), 186 (±59), and 166 (±57) micrometers in groups 1, 2, and 3, respectively (P= 0.99), which decreased to 77 (±16), 83 (±22), and 73 (±11), respectively, at final visit (P = 0.14) Conclusion: We found no beneficial effect of either systemic steroid alone or combined with EPO in the visual outcome of NAION patients.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/02713683.2016.1270328DOI Listing
July 2017

Recurrent focal choroidal excavation following multiple evanescent white dot syndrome (MEWDS) associated with acute idiopathic blind spot enlargement.

Int Ophthalmol 2018 Apr 3;38(2):815-821. Epub 2017 Apr 3.

Ophthalmic Research Center and Ophthalmology Department, Labbafinejad Medical Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To present a recurrent case of conforming focal choroidal excavation (FCE) following multiple evanescent white dot syndrome (MEWDS) in a 25-year-old woman.

Methods: Following spontaneous MEWDS sings resolution our patient noted a recurrent decrease in vision. Repeated OCT revealed elevation and mild disruption of RPE layer at fovea without previous angiographic MEWDS signs. At this time, short-term systemic steroid therapy was started and visual acuity became normal.

Results: Following quiescence of the new-onset phase, the conforming type of FCE located in inferior macula appeared in OCT. In the following next 2 years recurrence of presumptive focal subfoveal choriocapillaritis occurred for three times presenting with blurred vision. During every acute attack, above-mentioned FCE disappeared and returned back again after resolution of presumptive focal choriocapillaritis.

Conclusions: This is the first and unique case of recurrent type of FCE following MEWDS. It seems to disappear during active phase of presumptive focal choriocapillaritis and then returns after the eye has become quiescent.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s10792-017-0511-9DOI Listing
April 2018

Worldwide inequality in production of systematic reviews.

Med J Islam Repub Iran 2015 27;29:309. Epub 2015 Dec 27.

VMD, PhD, Professor in Epidemiology, Epidemiology and Biostatistics Department, School of Public Health, Tehran University of Medical Sciences, & Knowledge Utilization Research Center, Tehran University of Medical Sciences, Tehran, Iran.

Background: Investment in science is vital for the development and well-being of societies. This study aims to assess the scientific productivity of countries by quantifying their publication of systematic reviews taking the gross national income per capita (GNIPC) into account.

Methods: Medline and ISI Web of Science were searched for systematic reviews published between 1st January 2006 and 31st December 2010. The productivity of each country was quantified by exploring the authors' affiliation. The GNIPC was used according to the World Bank Report. Concentration index (CI) was calculated as the index of inequality.

Results: CI of percentage of systematic reviews as a function of percentage of countries ranked by GNIPC was 0.82 which indicates inequality in production of systematic reviews in pro rich countries. Countries with high income produced 206.23 times more systematic reviews than low income countries, while this ratio for lower middle and upper middle countries was 9.67 and 12.97, respectively. The highest concentration index was observed in clinical sciences (0.76) and the lowest in public health (0.61).

Conclusion: This study demonstrates a significant gap between industrialized and nonindustrialized countries in the production of systematic reviews. Addressing this gap needs tremendous national and international efforts.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4764280PMC
February 2016

Neuroendocrine tumor of the gallbladder.

Arch Iran Med 2013 Feb;16(2):123-5

Hematology and Oncology Research Center, Vali-Asr Hospital, Tehran University of Medical Science, Tehran, Iran.

Neuroendocrine tumors (NET) arise from neuroendocrine cells and are an exceedingly rare malignancy in the gallbladder. In this case report, a 52-year-old woman with complaints of episodic abdominal pain for two months prior was admitted to our hospital. She had no other signs and symptoms and her laboratory tests were within normal limits. Ultrasonography showed a broad-necked mass (26 × 12 mm) in the gallbladder for which she underwent laparoscopic cholecystectomy. The final pathological diagnosis was a high grade neuroendocrine carcinoma of the gallbladder with involvement of the lymph nodes and omentum. The patient received the chemotherapy regimens of gemcitabine plus cisplatin, followed by docetaxel plus sunitinib for her metastatic liver lesions. She also underwent radiofrequency ablation. Serial CT-scans revealed metastatic liver lesions that had decreased in size, with no significant improvement. The patient refused additional treatment and at 46 months, she was doing well with no complaints of any pain, disease recurrence, or metastatic progression.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/013162/AIM.0014DOI Listing
February 2013

Attitude toward plagiarism among Iranian medical faculty members.

Acta Med Iran 2012 ;50(11):778-81

Brain and Spinal Injury Research Center, Tehran University of Medical Sciences, Tehran, Iran.

The goal of this study was to assess attitude towards plagiarism in faculty members of Medical School at Tehran University of Medical Sciences. One hundred and twenty medical faculty members of Tehran University of Medical Sciences were enrolled in this cross-sectional study. They were asked to answer to valid and reliable Persian version of attitude towards plagiarism questionnaire. Attitude toward plagiarism, positive attitude toward self-plagiarism and plagiarism acceptance were assessed. Eighty seven filled-up questionnaires were collected. Mean total number of correct answers was 11.6±3.1. Mean number of correct answers to questions evaluating self-plagiarism was 1.7±0.4 and mean number of correct answers to questions evaluating plagiarism acceptance was 1.4±0.2. There was no significant correlation between plagiarism acceptance and self-plagiarism (r=0.17, P=0.1). It is essential to provide materials (such as workshops, leaflets and mandatory courses) to make Iranian medical faculty members familiar with medical research ethics issues such as plagiarism.
View Article and Find Full Text PDF

Download full-text PDF

Source
July 2013

Attitude towards plagiarism among Iranian medical students.

J Med Ethics 2013 Apr 13;39(4):249. Epub 2012 Apr 13.

Brain and Spinal Injury Repair Research Center, Tehran University of Medical Sciences, Tehran, Iran.

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1136/medethics-2012-100560DOI Listing
April 2013