Publications by authors named "Jun Rao"

53 Publications

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

Virol J 2021 02 18;18(1):38. Epub 2021 Feb 18.

Department of Clinical Laboratory, Hubei Provincial Hospital of Traditional Chinese Medicine, Wuhan, 430061, Hubei, China.

Background: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously.

Methods: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected.

Results: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found.

Conclusion: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12985-021-01510-6DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7891017PMC
February 2021

Fabrication of flexible composite film based on xylan from pulping process for packaging application.

Int J Biol Macromol 2021 Mar 21;173:285-292. Epub 2021 Jan 21.

Beijing Advanced Innovation Center for Tree Breeding by Molecular Design, Beijing Forestry University, Beijing 100083, China; Beijing Key Laboratory of Lignocellulosic Chemistry, Beijing Forestry University, Beijing 100083, China. Electronic address:

To realize the application of xylan based film in food and drug packaging, the poor mechanical property and film-forming property of xylan based film must be overcome. Herein, a good oxygen barrier composite film with desired mechanical properties was prepared based on carboxymethly xylan (CMX), chitosan (CS), and graphene oxide (GO). The results of scanning electron microscope revealed the composite film had a dense and continuous structure, which will endow the composite film with excellent mechanical property. As expected, the composite film with the 0.5% mass fraction of GO exhibited best mechanical property, among which the tensile stress, tensile strain, and Young's modulus of the composite film reached 50.81 MPa, 47.61%, and 1.39 GPa, respectively. The oxygen barrier properties of the composite films significantly increased with the addition of graphene oxide due to the dense, stacked multilayer structure. In addition, these composite films exhibited good antibacterial properties. Therefore, these films show great promise in the field of food packaging and wound dressing due to their excellent mechanical, oxygen barrier and antibacterial properties.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ijbiomac.2021.01.128DOI Listing
March 2021

Atrophy and cognitive profiles in older adults with temporal lobe epilepsy are similar to mild cognitive impairment.

Brain 2021 02;144(1):236-250

Center for Multimodal Imaging and Genetics, University of California, San Diego, CA, USA.

Epilepsy incidence and prevalence peaks in older adults yet systematic studies of brain ageing and cognition in older adults with epilepsy remain limited. Here, we characterize patterns of cortical atrophy and cognitive impairment in 73 older adults with temporal lobe epilepsy (>55 years) and compare these patterns to those observed in 70 healthy controls and 79 patients with amnestic mild cognitive impairment, the prodromal stage of Alzheimer's disease. Patients with temporal lobe epilepsy were recruited from four tertiary epilepsy surgical centres; amnestic mild cognitive impairment and control subjects were obtained from the Alzheimer's Disease Neuroimaging Initiative database. Whole brain and region of interest analyses were conducted between patient groups and controls, as well as between temporal lobe epilepsy patients with early-onset (age of onset <50 years) and late-onset (>50 years) seizures. Older adults with temporal lobe epilepsy demonstrated a similar pattern and magnitude of medial temporal lobe atrophy to amnestic mild cognitive impairment. Region of interest analyses revealed pronounced medial temporal lobe thinning in both patient groups in bilateral entorhinal, temporal pole, and fusiform regions (all P < 0.05). Patients with temporal lobe epilepsy demonstrated thinner left entorhinal cortex compared to amnestic mild cognitive impairment (P = 0.02). Patients with late-onset temporal lobe epilepsy had a more consistent pattern of cortical thinning than patients with early-onset epilepsy, demonstrating decreased cortical thickness extending into the bilateral fusiform (both P < 0.01). Both temporal lobe epilepsy and amnestic mild cognitive impairment groups showed significant memory and language impairment relative to healthy control subjects. However, despite similar performances in language and memory encoding, patients with amnestic mild cognitive impairment demonstrated poorer delayed memory performances relative to both early and late-onset temporal lobe epilepsy. Medial temporal lobe atrophy and cognitive impairment overlap between older adults with temporal lobe epilepsy and amnestic mild cognitive impairment highlights the risks of growing old with epilepsy. Concerns regarding accelerated ageing and Alzheimer's disease co-morbidity in older adults with temporal lobe epilepsy suggests an urgent need for translational research aimed at identifying common mechanisms and/or targeting symptoms shared across a broad neurological disease spectrum.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/brain/awaa397DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7880670PMC
February 2021

Plasmacytoid Dendritic Cell Infiltration in Acute Myeloid Leukemia.

Cancer Manag Res 2020 6;12:11411-11419. Epub 2020 Nov 6.

Medical Center of Hematology, Xinqiao Hospital, Army Medical University, Chongqing 400037, People's Republic of China.

Introduction: Increasing evidence has demonstrated that plasmacytoid dendritic cells (PDCs) in the tumor microenvironment (TME) play an important role in tumorigenesis and progression. PDC infiltration has been found in certain malignancies such as classic Hodgkin's lymphoma and chronic myelomonocytic leukemia. Our previous work reported that PDC infiltration could occur in acute myeloid leukemia (AML), but the clinical significance of PDC in AML has not been thoroughly investigated.

Patients And Methods: Here, we evaluated the clinical significance of PDC to AML transition in a leukemia microenvironment. The frequency of PDCs in 80 acute myelomonocytic leukemia (AML-M4) and 83 acute monocytic leukemia (AML-M5) patients was determined by flow cytometry.

Results: We found 62 cases with PDC infiltration. These patients showed higher numbers of bone marrow blasts, higher mean Hb concentration, and required more cycles of chemotherapy before achieving complete remission (CR), but had lower white blood cell and platelet counts compared to patients without PDC infiltration. Drug sensitivity analysis showed that patients with PDC infiltration had lower sensitivity to standard chemotherapy regimens. Kaplan-Meier survival curves demonstrated that patients with PDC infiltration had a shorter overall survival (OS) time and progression-free survival time.

Discussion: These results suggested that PDC infiltration can be used for risk stratification of AML-M4/M5, and PDCs may transdifferentiate into leukemia in an AML microenvironment.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2147/CMAR.S260825DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7654521PMC
November 2020

Effect of rhG-CSF Combined With Decitabine Prophylaxis on Relapse of Patients With High-Risk MRD-Negative AML After HSCT: An Open-Label, Multicenter, Randomized Controlled Trial.

J Clin Oncol 2020 12 27;38(36):4249-4259. Epub 2020 Oct 27.

Medical Center of Hematology, Xinqiao Hospital, Army Medical University, Chongqing, China.

Purpose: Relapse is a major cause of treatment failure after allogeneic hematopoietic stem-cell transplantation (allo-HSCT) for high-risk acute myeloid leukemia (HR-AML). The aim of this study was to explore the effect of recombinant human granulocyte colony-stimulating factor (rhG-CSF) combined with minimal-dose decitabine (Dec) on the prevention of HR-AML relapse after allo-HSCT.

Patients And Methods: We conducted a phase II, open-label, multicenter, randomized controlled trial. Two hundred four patients with HR-AML who had received allo-HSCT 60-100 days before randomization and who were minimal residual disease negative were randomly assigned 1:1 to either rhG-CSF combined with minimal-dose Dec (G-Dec group: 100 µg/m of rhG-CSF on days 0-5 and 5 mg/m of Dec on days 1-5) or no intervention (non-G-Dec group). The primary outcome was relapse after transplantation, and the secondary outcomes were chronic graft-versus-host disease (cGVHD), safety of the treatment, and survival.

Results: The estimated 2-year cumulative incidence of relapse in the G-Dec group was 15.0% (95% CI, 8.0% to 22.1%), compared with 38.3% (95% CI, 28.8% to 47.9%) in the non-G-Dec group ( < .01), with a hazard ratio (HR) of 0.32 (95% CI, 0.18 to 0.57; < .01). There was no statistically significant difference between the G-Dec and non-G-Dec groups in the 2-year cumulative incidence of cGVHD without relapse (23.0% [95% CI, 14.7% to 31.3%] and 21.7% [95% CI, 13.6% to 29.7%], respectively; = .82), with an HR of 1.07 (95% CI, 0.60 to 1.92; = .81). After rhG-CSF combined with minimal-dose Dec maintenance, increasing numbers of natural killer, CD8+ T, and regulatory T cells were observed.

Conclusion: Our findings suggest that rhG-CSF combined with minimal-dose Dec maintenance after allo-HSCT can reduce the incidence of relapse, accompanied by changes in the number of lymphocyte subtypes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1200/JCO.19.03277DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7768335PMC
December 2020

Targeted delivery of β-glucosidase-loaded magnetic nanoparticles: effect of external magnetic field duration and intensity.

Nanomedicine (Lond) 2020 09 4;15(21):2029-2040. Epub 2020 Sep 4.

Department of Urology, Hubei Province Academy of Traditional Chinese Medicine, Wuhan, Hubei, PR China.

The effect of applied magnetic field duration and intensity on the delivery of β-glucosidase-loaded magnetic nanoparticles was evaluated. The prepared β-glucosidase-loaded magnetic nanoparticles were targeted to subcutaneous tumors with an external magnetic field. Iron concentration and enzyme activity in tumor tissue were analyzed via electron spin resonance detection, Prussian blue staining and enzyme activity measurement. The increase in magnetic nanoparticles quantity and enzyme activity in tumor tissue was not synchronous with the magnetic targeting duration. In addition, accumulation of magnetic nanoparticles and the increase in enzyme activity were not synchronous with the magnetic field intensity. The results suggested that appropriate magnetic field conditions should be considered for targeted delivery of bioactivity proteins based on magnetic nanoparticles.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2217/nnm-2020-0186DOI Listing
September 2020

Plasma circulating tumor DNA assessment reveals as a potential poor prognostic factor in extranodal NK/T-cell lymphoma.

Biomark Res 2020 17;8:27. Epub 2020 Jul 17.

Medical Center of Hematology, Xinqiao Hospital, Army Medical University, Chongqing, China.

Background: The early detection of tumors upon initial diagnosis or during routine surveillance is important for improving survival outcomes. Here, we investigated the feasibility and clinical significance of circulating tumor DNA (ctDNA) detection for Extranodal NK/T-cell lymphoma, nasal type (ENTKL).

Methods: The plasma ctDNA assessment was based on blood specimens collected from 65 newly diagnosed patients with ENKTL in the hematology medical center of Xinqiao Hospital. Longitudinal samples collected under chemotherapy were also included. The gene mutation spectrum of ENKTL was analyzed via next generation sequencing.

Results: We found that the most frequently mutated genes were (23.1%), (12.3%), (10.8%), (9.2%), (9.2%), (9.2%), (9.2%) and (7.7%). The mutation allele frequencies of and were significantly correlated with the disease stage, and mutated were positively correlated with the metabolic tumor burden of the patients. Compared with the tumor tissue, ctDNA profiling showed good concordance (93.75%). Serial ctDNA analysis showed that treatment with chemotherapy could decrease the number and mutation allele frequencies of the genes. Compared with PET/CT, ctDNA has more advantages in tracking residual disease in patients. In addition, patients with mutated had higher expression compared with those with wild type, and mutated predicted poor prognosis.

Conclusion: Our results unveil the mutation spectrum of ENKTL patients' plasma, which can be used to monitor the disease status of the patients exactly, and is the most frequently mutated gene with prognosis prediction value. The application of ctDNA sequencing can provide precision treatment strategies for patients.

Trial Registration: This study is registered with chictr.org (ChiCTR1800014813, registered 7 February, 2018-Retrospectively registered).
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s40364-020-00205-4DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7366898PMC
July 2020

Magnetically Directed Enzyme/Prodrug Prostate Cancer Therapy Based on β-Glucosidase/Amygdalin.

Int J Nanomedicine 2020 29;15:4639-4657. Epub 2020 Jun 29.

Department of Urology, Hubei Provincial Hospital of Traditional Chinese Medicine, Wuhan, Hubei, People's Republic of China.

Background: β-Glucosidase (β-Glu) can activate amygdalin to kill prostate cancer cells, but the poor specificity of this killing effect may cause severe general toxicity in vivo, limiting the practical clinical application of this approach.

Materials And Methods: In this study, starch-coated magnetic nanoparticles (MNPs) were successively conjugated with β-Glu and polyethylene glycol (PEG) by chemical coupling methods. Cell experiments were used to confirm the effects of immobilized β-Glu on amygdalin-mediated prostate cancer cell death in vitro. Subcutaneous xenograft models were used to carry out the targeting experiment and magnetically directed enzyme/prodrug therapy (MDEPT) experiment in vivo.

Results: Immobilized β-Glu activated amygdalin-mediated prostate cancer cell death. Tumor-targeting studies showed that PEG modification increased the accumulation of β-Glu-loaded nanoparticles in targeted tumor tissue subjected to an external magnetic field and decreased the accumulation of the nanoparticles in the liver and spleen. Based on an enzyme activity of up to 134.89 ± 14.18mU/g tissue in the targeted tumor tissue, PEG-β-Glu-MNP/amygdalin combination therapy achieved targeted activation of amygdalin and tumor growth inhibition in C57BL/6 mice bearing RM1 xenografts. Safety evaluations showed that this strategy had some impact on liver and heart function but did not cause obvious organ damage.

Conclusion: All findings indicate that this magnetically directed enzyme/prodrug therapy strategy has the potential to become a promising new approach for targeted therapy of prostate cancer.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2147/IJN.S242359DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7334483PMC
August 2020

Phosphoproteomics Reveals Key Regulatory Kinases and Modulated Pathways Associated with Ovarian Cancer Tumors.

Onco Targets Ther 2020 29;13:3595-3605. Epub 2020 Apr 29.

Jiangxi Provincial Key Laboratory of Translational Medicine and Oncology, Jiangxi Cancer Hospital, Jiangxi Cancer Center, Nanchang 330029, People's Republic of China.

Background: Ovarian cancer (OC) is the seventh most common cancer worldwide for women. However, there are no sufficient diagnostic methods and few treatment options available due to poor understanding of its pathogenic mechanisms.

Methods: To comprehensively analyze the phosphoproteomic characterization for OC, we took advantage of a quantitative global phosphoproteomics method, titanium(IV) immobilized metal affinity chromatography (Ti-IMAC) coupled to nanoscale liquid chromatography and quadrupole time-of-flight tandem mass spectrometry (nanoLC/Q-TOF-MS/MS) on ovarian tissue samples obtained from five OC patients and five matched controls.

Results: A total of 722 phosphorylated sites corresponding to 534 proteins were significantly different (fold change ≥ 2, < 0.01) between OC patients and the controls. Among them, 83 transcription factors mainly consisted of transcription cofactors, zf-C2H2, and chromatin remodeling factors and 29 kinases were included. Further functional analysis suggested significantly biological processes were highly enriched and involved in the pathogenesis of OC, especially fructose and mannose metabolism. Moreover, the regulatory roles of modulated pathways, including MAPK, ErbB, and GnRH signaling pathways were also identified as critical processes involved in OC. The results here highlighted key phosphorylated proteins, particularly kinases, and the corresponding cancer-related metabolic and signal pathways that played important roles in the development of OC. Additionally, the expression levels of two kinases, phosphorylated CDK (T14) and phosphorylated PRKCQ (S695), were validated by Western blot analysis in the other group of ovarian tissue samples.

Conclusion: Altogether, our data not only provided novel insights into the potential biomarkers and therapy options for OC but also extended our knowledge on its pathophysiological mechanism.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2147/OTT.S240164DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7196812PMC
April 2020

Identification of key miRNAs in the progression of hepatocellular carcinoma using an integrated bioinformatics approach.

PeerJ 2020 6;8:e9000. Epub 2020 May 6.

Department of Hepatobiliary Surgery, Jiangxi Cancer Hospital, Nanchang, Jiangxi, China.

Backgroud: It has been shown that aberrant expression of microRNAs (miRNAs) and transcriptional factors (TFs) is tightly associated with the development of HCC. Therefore, in order to further understand the pathogenesis of HCC, it is necessary to systematically study the relationship between the expression of miRNAs, TF and genes. In this study, we aim to identify the potential transcriptomic markers of HCC through analyzing common microarray datasets, and further establish the differential co-expression network of miRNAs-TF-mRNA to screen for key miRNAs as candidate diagnostic markers for HCC.

Method: We first downloaded the mRNA and miRNA expression profiles of liver cancer from the GEO database. After pretreatment, we used a linear model to screen for differentially expressed genes (DEGs) and miRNAs. Further, we used weighed gene co-expression network analysis (WGCNA) to construct the differential gene co-expression network for these DEGs. Next, we identified mRNA modules significantly related to tumorigenesis in this network, and evaluated the relationship between mRNAs and TFs by TFBtools. Finally, the key miRNA was screened out in the mRNA-TF-miRNA ternary network constructed based on the target TF of differentially expressed miRNAs, and was further verified with external data set.

Results: A total of 465 DEGs and 215 differentially expressed miRNAs were identified through differential genes expression analysis, and WGCNA was used to establish a co-expression network of DEGs. One module that closely related to tumorigenesis was obtained, including 33 genes. Next, a ternary network was constructed by selecting 256 pairs of mRNA-TF pairs and 100 pairs of miRNA-TF pairs. Network mining revealed that there were significant interactions between 18 mRNAs and 25 miRNAs. Finally, we used another independent data set to verify that miRNA hsa-mir-106b and hsa-mir-195 are good classifiers of HCC and might play key roles in the progression of HCC.

Conclusion: Our data indicated that two miRNAs-hsa-mir-106b and hsa-mir-195-are identified as good classifiers of HCC.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.7717/peerj.9000DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7210814PMC
May 2020

Hemicelluloses-based magnetic aerogel as an efficient adsorbent for Congo red.

Int J Biol Macromol 2020 Jul 30;155:369-375. Epub 2020 Mar 30.

Beijing Key Laboratory of Lignocellulosic Chemistry, Beijing Forestry University, Beijing 100083, China.

A renewable, efficient, and low-cost material is essential for adsorbing water pollution, such as dyes and heavy metal ions pollution. Here in, we demonstrate an aerogel to remove the dyes from water based on hemicellulose. The dialdehyde hemicelluloses (DAH) were synthesized by oxidation of hemicellulose extracted from straw with NaIO. The hydrogels were prepared based on the dialdehyde hemicellulose and chitosan-FeO composite by the Schiff's base reaction, which were processed with vacuum freeze-drying technique to obtain aerogels. It was found that hydroxyl groups at C and C of hemicellulose were oxidized to aldehyde groups after modification, and the content of aldehyde group was 5.57 mmol/g. The maximum compress strength of aerogel was 0.37 MPa, and the maximum absorption capacity of Congo red dye was 137.74 mg/g. Aerogels with FeO exhibited magnetism which enables the aerogels to easily recycle. Meanwhile, the thermal stability, mechanical properties of the aerogels and its adsorption property to Congo red dye could be improved directly by the addition of FeO.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ijbiomac.2020.03.231DOI Listing
July 2020

A CpG Methylation Classifier to Predict Relapse in Adults with T-Cell Lymphoblastic Lymphoma.

Clin Cancer Res 2020 07 31;26(14):3760-3770. Epub 2020 Mar 31.

State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, P.R. China.

Purpose: Adults with T-cell lymphoblastic lymphoma (T-LBL) generally benefit from treatment with acute lymphoblastic leukemia (ALL)-like regimens, but approximately 40% will relapse after such treatment. We evaluated the value of CpG methylation in predicting relapse for adults with T-LBL treated with ALL-like regimens.

Experimental Design: A total of 549 adults with T-LBL from 27 medical centers were included in the analysis. Using the Illumina Methylation 850K Beadchip, 44 relapse-related CpGs were identified from 49 T-LBL samples by two algorithms: least absolute shrinkage and selector operation (LASSO) and support vector machine-recursive feature elimination (SVM-RFE). We built a four-CpG classifier using LASSO Cox regression based on association between the methylation level of CpGs and relapse-free survival in the training cohort ( = 160). The four-CpG classifier was validated in the internal testing cohort ( = 68) and independent validation cohort ( = 321).

Results: The four-CpG-based classifier discriminated patients with T-LBL at high risk of relapse in the training cohort from those at low risk ( < 0.001). This classifier also showed good predictive value in the internal testing cohort ( < 0.001) and the independent validation cohort ( < 0.001). A nomogram incorporating five independent prognostic factors including the CpG-based classifier, lactate dehydrogenase levels, Eastern Cooperative Oncology Group performance status, central nervous system involvement, and / status showed a significantly higher predictive accuracy than each single variable. Stratification into different subgroups by the nomogram helped identify the subset of patients who most benefited from more intensive chemotherapy and/or sequential hematopoietic stem cell transplantation.

Conclusions: Our four-CpG-based classifier could predict disease relapse in patients with T-LBL, and could be used to guide treatment decision.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1158/1078-0432.CCR-19-4207DOI Listing
July 2020

PEG modification enhances the in vivo stability of bioactive proteins immobilized on magnetic nanoparticles.

Biotechnol Lett 2020 Aug 21;42(8):1407-1418. Epub 2020 Mar 21.

Department of Urology, Hubei Provincial Hospital of Traditional Chinese Medicine, Wuhan, 430000, Hubei, China.

Objective: To increase the in vivo stability of bioactive proteins via optimized loading methods.

Results: β-Glucosidase (β-Glu), as a model protein, was immobilized on magnetic nanoparticles(denoted as MNP-β-Glu) by chemical coupling methods and was further modified by poly(ethylene glycol) (PEG) molecules (denoted as MNP-β-Glu-PEG) to increase its stability. The physicochemical properties of the as-prepared nanohybrids, including the particle size, zeta potential, and enzyme activity, were well characterized. The proper MNP/β-Glu feed ratio was important for optimizing the particle size. Analysis of enzyme activity showed that the stability of immobilized β-Glu compared with free β-Glu was lower in deionized water and higher in blood serum at 37 °C. MNP-β-Glu-PEG retained 77.9% of the initial activity within 30 days at 4 °C, whereas the free enzyme retained only 58.2%. Pharmacokinetic studies of Sprague-Dawley (SD) rats showed that the MNP-β-Glu-PEG group retained a higher enzyme activity in vivo (41.46% after 50 min) than the MNP-β-Glu group (0.03% after 50 min) and the β-Glu group (0.37% after 50 min). Moreover, in contrast to the MNP-β-Glu group, the enzyme activity was not fully synchronous with the decrease in the Fe concentration in the MNP-β-Glu-PEG group.

Conclusions: All findings indicated that the method of immobilization on magnetic nanoparticles and PEG modification is promising for the application of bioactive proteins in vivo.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s10529-020-02867-4DOI Listing
August 2020

THBS1 Is a Novel Serum Prognostic Factors of Acute Myeloid Leukemia.

Front Oncol 2019 7;9:1567. Epub 2020 Feb 7.

Medical Center of Hematology, Xinqiao Hospital, Army Medical University, Chongqing, China.

Dysregulation of cytokines and growth factors is a general feature of tumor microenvironment, and unraveling the expression spectrum of cytokine and growth factor in niche is of utmost importance. Here, we evaluated cytokine profiling of bone marrow serum samples in AML patients and healthy controls. Protein expression profiling of serum from nine AML patients and five healthy controls was obtained using a biotinylated antibody chip. A total of 507 cytokines and growth factors were analyzed. Compared with healthy people, AML patients expressed 31 signature proteins, among which, 27 were significantly higher expressed and 4 proteins were lower. When patients were divided into favorable and poor prognosis, 12 signature proteins were significantly differentially expressed between these two groups. Furthermore, in order to identify the accuracy of cytokine expression profiles, we verified and analyzed the expression of THBS1 (Thrombospondin 1) in 116 patients and 9 healthy people. We found that THBS1 was lowly expressed in AML patients, which might be induced by promoter methylation, and patients with low THBS1 possessed shorter survivor time. Our data indicated that we successfully unveil differentially expressed proteins in AML patients using a biotinylated antibody chip; among them, THBS1 may be a potential therapeutic target for AML patients' treatment.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fonc.2019.01567DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7020255PMC
February 2020

A gene-expression-based signature predicts survival in adults with T-cell lymphoblastic lymphoma: a multicenter study.

Leukemia 2020 09 20;34(9):2392-2404. Epub 2020 Feb 20.

State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, PR China.

We aimed to establish a discriminative gene-expression-based classifier to predict survival outcomes of T-cell lymphoblastic lymphoma (T-LBL) patients. After exploring global gene-expression profiles of progressive (n = 22) vs. progression-free (n = 28) T-LBL patients, 43 differentially expressed mRNAs were identified. Then an eleven-gene-based classifier was established using LASSO Cox regression based on NanoString quantification. In the training cohort (n = 169), high-risk patients stratified using the classifier had significantly lower progression-free survival (PFS: hazards ratio 4.123, 95% CI 2.565-6.628; p < 0.001), disease-free survival (DFS: HR 3.148, 95% CI 1.857-5.339; p < 0.001), and overall survival (OS: HR 3.790, 95% CI 2.237-6.423; p < 0.001) compared with low-risk patients. The prognostic accuracy of the classifier was validated in the internal testing (n = 84) and independent validation cohorts (n = 360). A prognostic nomogram consisting of five independent variables including the classifier, lactate dehydrogenase levels, ECOG-PS, central nervous system involvement, and NOTCH1/FBXW7 status showed significantly greater prognostic accuracy than each single variable alone. The addition of a five-miRNA-based signature further enhanced the accuracy of this nomogram. Furthermore, patients with a nomogram score ≥154.2 significantly benefited from the BFM protocol. In conclusion, our nomogram comprising the 11-gene-based classifier may make contributions to individual prognosis prediction and treatment decision-making.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41375-020-0757-5DOI Listing
September 2020

HJC0152 suppresses human non-small-cell lung cancer by inhibiting STAT3 and modulating metabolism.

Cell Prolif 2020 Mar 5;53(3):e12777. Epub 2020 Feb 5.

Department of Genetics, Stanley S. Scott Cancer Center, Louisiana State University Health Sciences Center, Louisiana Cancer Research Center, New Orleans, LA, USA.

Objectives: Signal transducer and activator of transcription 3 (STAT3) is constitutively activated and overexpressed in many cancers, including non-small-cell lung cancer (NSCLC). We recently developed HJC0152 as an orally active STAT3 inhibitor. This study focused on investigating HJC0152's effect and mechanism of action in NSCLC.

Materials And Methods: We analysed cell proliferation by MTT assays, cell migration by wound healing and transwell assays, protein levels by Western blot, and apoptosis and reactive oxygen species (ROS) level by flow cytometry. A nude mouse tumorigenesis model was established for in vivo experiment. UHPLC-QTOF/MS was used for untargeted metabolomic relative quantitation analysis.

Results: We found that HJC0152 exhibited activity against human NSCLC cells in vitro and NSCLC xenograft tumours in vivo via regulating STAT3 signalling and metabolism. HJC0152 efficiently reduced NSCLC cell proliferation, promoted ROS generation, induced apoptosis, triggered DNA damage and reduced motility in A549 and H460 NSCLC cells. Moreover, HJC0152 significantly inhibited the growth of A549 xenograft tumours in vivo. HJC0152 also affected metabolism, significantly decreasing and perturbating levels of several metabolites in the purine, glutathione and pyrimidine metabolism pathways.

Conclusions: HJC0152 reduces cellular capacity to scavenge free radicals, leading to ROS generation and accumulation and apoptosis. This study provides a rationale for further developing HJC0152 as a potential therapy for NSCLC and provides insights into the mechanisms by which HJC0152 exerts its anti-cancer effects.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/cpr.12777DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7106968PMC
March 2020

Curcumin exerts anti-tumor effects on diffuse large B cell lymphoma via regulating PPARγ expression.

Biochem Biophys Res Commun 2020 03 21;524(1):70-76. Epub 2020 Jan 21.

Medical Center of Hematology, Xinqiao Hospital, Army Medical University, Chongqing, 400037, China; State Key Laboratory of Trauma, Burns and Combined Injury, Army Medical University, Chongqing, 400037, China. Electronic address:

Given the highly heterogeneity of diffuse large B cell lymphoma (DLBCL) and the diverse demands for proper treatment, many patients would relapse or show resistance to current therapeutic regimens, new treatment options are urgent to be explored. Curcumin harbored anti-tumor potential in various cancers, here, we investigated the possible effects and mechanism of curcumin on human DLBCL in vitro and in vivo, we found that curcumin inhibited cell viability in a concentration and time dependent manner, promoted cell apoptosis and arrested cell cycle at G2 phase, and these effects were mediated by PPARγ promotion and Akt/mTOR pathway inactivation. Furthermore, effects of curcumin on human DLBCL cells could be partly rescued by PPARγ antagonist GW9662, and enhanced by PPARγ agonist rosiglitazone. Taken together, our results demonstrated that curcumin inhibited the proliferation of DLBCL cells by up-regulating the expression of PPARγ, and our results might provide novel therapeutic approaches and a potential target to DLBCL treatment.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bbrc.2019.12.129DOI Listing
March 2020

Dissection of flag leaf metabolic shifts and their relationship with those occurring simultaneously in developing seed by application of non-targeted metabolomics.

PLoS One 2020 24;15(1):e0227577. Epub 2020 Jan 24.

Joint International Research Laboratory of Metabolic & Developmental Sciences, SJTU-University of Adelaide Joint Centre for Agriculture and Health, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai, China.

Rice flag leaves are major source organs providing more than half of the nutrition needed for rice seed development. The dynamic metabolic changes in rice flag leaves and the detailed metabolic relationship between source and sink organs in rice, however, remain largely unknown. In this study, the metabolic changes of flag leaves in two japonica and two indica rice cultivars were investigated using non-targeted metabolomics approach. Principal component analysis (PCA) revealed that flag leaf metabolomes varied significantly depending on both species and developmental stage. Only a few of the metabolites in flag leaves displayed the same change pattern across the four tested cultivars along the process of seed development. Further association analysis found that levels of 45 metabolites in seeds that are associated with human nutrition and health correlated significantly with their levels in flag leaves. Comparison of metabolomics of flag leaves and seeds revealed that some flavonoids were specific or much higher in flag leaves while some lipid metabolites such as phospholipids were much higher in seeds. This reflected not only the function of the tissue specific metabolism but also the different physiological properties and metabolic adaptive features of these two tissues.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0227577PLOS
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6980602PMC
April 2020

Metabolomics study of serum and urine samples reveals metabolic pathways and biomarkers associated with pelvic organ prolapse.

J Chromatogr B Analyt Technol Biomed Life Sci 2020 Jan 14;1136:121882. Epub 2019 Nov 14.

Nanchang University, Nanchang 330006, Jiangxi, China; Key Laboratory of Women's Reproductive Health of Jiangxi Province, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang 330006, Jiangxi, China. Electronic address:

Pelvic organ prolapse (POP) is a common medical condition among women and involves complicated diagnostics and controversial surgical management. The exact molecular mechanism underlying POP is poorly understood, especially at the metabolism level. To explore the metabolic mechanism underlying POP and discover potential biomarkers for POP diagnosis, we applied a non-targeted metabolomics approach using ultra-high performance liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry (UHPLC-Q-TOF-MS). Metabolomics study of serum samples from patients with POP (n = 24) and controls (n = 22) revealed a total of 59 metabolites that are significantly different (VIP ≥ 1 and p ≤ 0.05) between the two groups. Between urine samples from POP patients (n = 45) and controls (n = 59), 33 metabolites differed significantly (VIP ≥ 1 and p ≤ 0.05). Metabolic pathways affected by these differentially expressed metabolites were analyzed. In both serum and urine samples, three pathways including arginine biosynthesis and purine metabolism were found to be significantly related to POP. Six metabolites including GPC, 1-methyladenosine, maleic acid, L-pyroglutamic acid, inosine, and citrate are significantly changed (VIP ≥ 1 and p ≤ 0.05) in both serum and urine samples from patients with POP. Receiver operating characteristics (ROC) curve analysis showed that using these six metabolites as a biomarker could distinguish patients with POP from controls with good accuracy in both serum (AUC = 1) and urine samples (AUC = 0.854). Collectively, these results further extended our understanding of key regulatory metabolic pathways involved in the pathophysiology of POP, as well as provided some promising biomarkers for effective POP diagnosis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jchromb.2019.121882DOI Listing
January 2020

Tandem autologous hematopoietic stem cell transplantation for treatment of adult T-cell lymphoblastic lymphoma: a multiple center prospective study in China.

Haematologica 2021 01 1;106(1):163-172. Epub 2021 Jan 1.

Medical center of hematology, Xinqiao Hospital, Army Medical University, Chongqing, China.

T-cell lymphoblastic lymphoma (T-LBL) is a highly aggressive form of lymphoma with poor clinical outcomes and lacks of a standard treatment regimen. In this study, we assessed the safety and efficacy of tandem autologous hematopoietic stem cell transplantation (auto-HSCT) strategy for adult T-LBL and evaluated prognostic factors affecting survival. 181 Newly-diagnosed adult T-LBL patients were enrolled, 89 patients were treated with chemotherapy alone, 46 patients were allocated to single auto-HSCT group, 46 patients were treated with tandem auto-HSCT. The median follow-up time was 37 months, the 3-year progression/relapse rate of the tandem auto-HSCT group was significantly lower than that of the single auto-HSCT group and chemotherapy group (26.5% vs 53.1% and 54.8%). The 3-year PFS and OS rate of the tandem auto-HSCT group (73.5% and 76.3%) were significantly higher than those of the single auto-HSCT group (46.9% and 58.3%) and the chemotherapy group (45.1% and 57.1%). In the tandem auto-HSCT group, age and disease status after the first transplantation impacted the OS and PFS. Multivariate analysis identified that disease status after the first transplantation was the only independent prognostic factor for patients treated with tandem-HSCT. In addition, diagnostic models of the initial CD8+CD28+/CD8+CD28- T cell ratio in predicting the disease status were found to be significant. Taken together, tandem auto-HSCT can be considered an optimal strategy for adult T-LBL patients (ChiCTR-ONN-16008480).
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3324/haematol.2019.226985DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7776263PMC
January 2021

Capric Acid Hybridizing Fly Ash and Carbon Nanotubes as a Novel Shape-Stabilized Phase Change Material for Thermal Energy Storage.

ACS Omega 2019 Sep 5;4(12):14962-14969. Epub 2019 Sep 5.

Key Laboratory of Solid Waste Treatment and Resource Recycle, Ministry of Education, South West University of Science and Technology, Mianyang 621010, Sichuan, China.

Capric acid (CA) is one of the most promising phase change materials to be used in reducing the energy consumption of buildings due to its suitable phase change temperature and high latent heat. In this paper, a novel shape-stabilized phase change material (SSPCM) is fabricated by "hazardous waste" fly ash (FA) via simple impregnation method along with CA and carbon nanotubes (CNTs). In this composite, raw FA without any modification serves as the carrier matrix to improve structural strength and overcome the drawback of the leakage of liquid CA. Simultaneously, CNTs act as an additive to increase the thermal conductivity of composites. The results of leakage tests indicate that CA was successfully confined as 20 wt % in the composite. Then, various characterization techniques were adopted to investigate the structure and properties of the prepared SSPCM of CA/FA/CNT. Scanning electron microscopy and Fourier transform infrared spectroscopy results showed that CA was well adsorbed into the microstructure of FA, and there was no chemical interaction between the components of the composites. Thermogravimetric analysis results demonstrated that the SSPCM presented good thermal stability. Differential scanning calorimetry results indicated that the melting temperature and freezing temperature of CA/FA/CNT were 31.08 and 27.88 °C, respectively, and the latent heats of CA/FA/CNT during the melting and freezing processes were 20.54 and 20.19 J g, respectively. Moreover, compared to the CA and CA/FA, the heat transfer efficiency of CA/FA/CNT was significantly improved by doping 1, 3, 5, and 7 wt % of CNT. All of the results suggest that CA/FA/CNT possessed comfortable melting and freezing temperatures, excellent thermal stability, high latent heat value, and favorable thermal conductivity, and therefore, it is a suitable thermal storage material for building applications. Simultaneously, CA/FA/CNT can improve the comprehensive utilization level of FA.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsomega.9b01746DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6751731PMC
September 2019

Integrated Tear Proteome and Metabolome Reveal Panels of Inflammatory-Related Molecules via Key Regulatory Pathways in Dry Eye Syndrome.

J Proteome Res 2019 05 16;18(5):2321-2330. Epub 2019 Apr 16.

Department of Ophthalmology & Visual Science, Eye & ENT Hospital, Shanghai Medical College , Fudan University , Shanghai , China.

Dry eye syndrome (DES) is a growing public health concern with a high global prevalence; however, the fundamental processes involved in its pathogenic mechanisms remain poorly understood. In the present study, we applied nanoscale liquid chromatography and quadrupole time-of-flight tandem mass spectrometry (nanoLC/Q-TOF-MS/MS) and ultraperformance LC/Q-TOF-MS/MS technologies on tear samples obtained from 18 dry eye patients and 19 healthy controls for integrated proteomic and metabolomic analyses. Overall, 1031 tear proteins were detected, while 190 proteins were determined to be significantly expressed in dry eye patients. Further functional analysis suggested that various biological processes were highly expressed and involved in the pathogenesis of DES, especially immune and inflammatory processes. In total, 156 named metabolites were identified, among which 34 were found to be significantly changed in dry eye patients. The results highlighted the key elements, especially inflammatory-related proteins and metabolites that played important roles in the development of DES. Further, the regulatory roles of primary pathways, including complement and coagulation cascades, glycolysis/gluconeogenesis, and amino acid metabolism, were also identified as processes involved in DES. Collectively, our work not only provided insight into the potential biomarkers of DES for diagnostic and prognostic purposes but extended our knowledge of the physiopathology of this syndrome.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acs.jproteome.9b00149DOI Listing
May 2019

Prognostic and predictive value of a microRNA signature in adults with T-cell lymphoblastic lymphoma.

Leukemia 2019 10 5;33(10):2454-2465. Epub 2019 Apr 5.

State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China.

New prognostic factors are needed to establish indications for haematopoietic stem cell transplantation (HSCT) in first complete remission (CR1) for T-cell lymphoblastic lymphoma (T-LBL) patients. We used microarray to compare T-LBL tissue samples (n = 75) and fetal thymus tissues (n = 20), and identified 35 differentially expressed miRNAs. Using 107 subjects as the training group, we developed a five-miRNA-based classifier to predict patient survival with LASSO Cox regression: lower risk was associated with better prognosis (disease-free survival (DFS): hazard ratio (HR) 4.548, 95% CI 2.433-8.499, p < 0.001; overall survival (OS): HR 5.030, 95% CI 2.407-10.513, p < 0.001). This classifier displayed good performance in the internal testing set (n = 106) and the independent external set (n = 304). High risk was associated with more favorable response to HSCT (DFS: HR 1.675, 95% CI 1.127-2.488, p = 0.011; OS: HR 1.602, 95% CI 1.055-2.433, p = 0.027). When combined with ECOG-PS and/or NOTCH1/FBXW7 status, this classifier had even better prognostic performance in patients receiving HSCT (DFS: HR 2.088, 95% CI 1.290-3.379, p = 0.003; OS: HR 1.996, 95% CI 1.203-3.311, p = 0.007). The five-miRNA classifier may be a useful prognostic biomarker for T-LBL adults, and could identify subjects who could benefit from HSCT.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41375-019-0466-0DOI Listing
October 2019

TRIM69 inhibits cataractogenesis by negatively regulating p53.

Redox Biol 2019 04 2;22:101157. Epub 2019 Mar 2.

Department of Ophthalmology, Eye & ENT Hospital of Fudan University, No. 83 Fenyang Road, Shanghai, 200031, China; Eye Institute, Eye & ENT Hospital of Fudan University, No. 83 Fenyang Road, Shanghai, 200031, China; National Health Commission (NHC) Key Laboratory of Myopia (Fudan University), No. 83 Fenyang Road, Shanghai, 200031, China; Laboratory of Myopia, Chinese Academy of Medical Sciences, No. 83 Fenyang Road, Shanghai, 200031, China; Key Laboratory of Visual Impairment and Restoration of Shanghai, No. 83 Fenyang Road, Shanghai, 200031, China. Electronic address:

Ultraviolet B (UVB) irradiation can induce reactive oxygen species (ROS) production and apoptosis in human lens epithelial cells (HLECs), thus leading to the formation of cataracts. We studied the role of tripartite motif 69 (TRIM69) in cataract formation. The expression of TRIM69 protein was down-regulated in both human cataract capsule tissues and HLECs treated with UVB, whereas the expression of p53 protein exhibited an opposite trend. Ectopic expression of TRIM69 in HLECs significantly suppressed UVB-induced apoptosis and ROS production, whereas knockdown of TRIM69 promoted apoptosis and ROS production. TRIM69 can interact with p53 and induce its ubiquitination. The effects of TRIM69 overexpression in UVB-induced cell apoptosis and ROS production was clearly weakened by p53 overexpression, thus suggesting a role for p53 in TRIM69 functions. Furthermore, inhibition of ROS mitigated the effects of UVB irradiation on ROS production, cell apoptosis, forkhead box protein 3a (Foxo3a) phosphorylation, and TRIM69 expression. Additionally, Foxo3a overexpression significantly enhanced TRIM69 promoter activity, whereas Foxo3a knockdown had the opposite effect. In conclusion, we provide the first demonstration that Foxo3a is a potential transcription factor for TRIM69, and TRIM69 induces p53 ubiquitination. These results suggest that the Foxo3a/TRIM69/p53 regulatory network may be involved in cataract formation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.redox.2019.101157DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6402377PMC
April 2019

Fabrication of hemicelluloses films with enhanced mechanical properties by graphene oxide for humidity sensing.

Carbohydr Polym 2019 Mar 2;208:513-520. Epub 2019 Jan 2.

Forestry and Landscape Architecture, AnHui Agricultural University, No130 Changjiang west road, Shushan District, Hefei, PR China.

An effective and green method to incorporate graphene oxide into quaternized hemicelluloses to form a hemicelluloses based film was introduced in this study. Tight, homogeneous, and smooth surfaces of the film were obtained from the SEM image. Data on the mechanical properties of the films indicated that the hybrid films prepared from QH and GO (component of GO was 4.8%) exhibited a high tensile strength of 43.83 MPa. This finding suggested that addition of GO contributed to the desirable mechanical properties of the hybrid film. The hybrid films exhibited high sensitivity to humidity; they could be bent spontaneously under wet conditions within seconds and stretched under dry conditions. In addition, the results of DMA indicated that the storage modulus of the hybrid films had an order of magnitude change in value at different humidities. These characteristics show that films can be potentially used in bio-medicine, packaging materials, and humidity sensors.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.carbpol.2018.12.099DOI Listing
March 2019

CD5 and CD43 Expression are Associate with Poor Prognosis in DLBCL Patients.

Open Med (Wars) 2018 27;13:605-609. Epub 2018 Nov 27.

Department of Internal Medicine 5th Division Jiangxi Cancer Center, Jiangxi Cancer Hospital, Nanchang University, Nanchang, 330029 P.R. China.

Objective: To investigate the expression and clinical significance of CD5 and CD43 in diffuse large B cell lymphoma (DLBCL) (unspecified).

Methods: Sixty - five patients with diagnosed DLBCL were enrolled. The expressions of CD5, CD43, CD10, Bcl-6 and Mun-1 were detected by immuno histochemistry. The relationship between CD5 and CD43 and clinicopathological features and prognosis of DLBCL was analyzed.

Results: In sixty - five adult DLBCL patients , 6 cases of DLBCL (9.2%) were CD5 positive, 24 cases of DLBCL (36.9%) were CD43 positive, 5 cases of DLBCL (7.7%) were both CD5 and CD43 positive. 40 cases of DLBCL (61.5%) were CD5 and CD43 negative. CD5 expression was not related to age, sex, clinical stage, type of immunophenotype (Hans typing), location, and whether infected with hepatitis B virus (HBV); CD43 expression was correlated with immunophenotyping and HBV i nfection, but was not correlated with the age, sex, clinical stage, and site. Median survival time was significantly lower in CD5- and CD43- positive DLBCL patients than CD5- and CD43-negative patien ts.

Conclusion: The prognosis of DLBCL patients may be worse with positive CD5 and CD43 expression.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1515/med-2018-0089DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6272054PMC
November 2018

RAC1-GTP promotes epithelial-mesenchymal transition and invasion of colorectal cancer by activation of STAT3.

Lab Invest 2018 08 8;98(8):989-998. Epub 2018 Jun 8.

Institute of Pathology and Southwest Cancer Center, Southwest Hospital, Third Military Medical University (Army Medical University), Chongqing, 400038, China.

Epithelial-mesenchymal transition (EMT) plays a critical role in initiating tumor invasion and metastasis of colorectal cancer (CRC), although the underlying mechanisms remain to be clarified. Herein, we demonstrate that the active form of Rac family small GTPase 1 (RAC1-GTP) is overexpressed in CRCs and promotes the EMT-mediated invasion of CRC cells through activation of the signal transducers and activators of transcription 3 (STAT3) pathway. Increased expression of RAC1-GTP in CRC tissues was positively correlated with the TNM stages of CRCs and indicated poor prognosis of CRC patients. Targeting RAC1-GTP activity by its specific inhibitor NSC23766 markedly suppressed the migration and invasion of CRC cells. Mechanistically, RAC1-GTP directly interacted with STAT3 to promote STAT3 phosphorylation, thus promoted EMT of CRC cells. Enforced expression of constitutively activated STAT3 (STAT3-C) abrogated the suppressive effect of RAC1-GTP disruption on the migration and invasion of CRC cells. Importantly, NSC23766 disrupted EMT in CRC cells and significantly diminished growth of CRC xenografts. Taken together, our data indicate that RAC1-GTP is an important player in EMT-mediated tumor invasion and a potential therapeutic target for CRCs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41374-018-0071-2DOI Listing
August 2018

Macranthoidin B Modulates Key Metabolic Pathways to Enhance ROS Generation and Induce Cytotoxicity and Apoptosis in Colorectal Cancer.

Cell Physiol Biochem 2018 18;46(4):1317-1330. Epub 2018 Apr 18.

Department of Clinical Cancer Prevention, Houston, Texas, USA.

Background/aims: Induction of oxidative stress and reactive oxygen species (ROS) mediated-apoptosis have been utilized as effective strategies in anticancer therapy. Macranthoidin B (MB) is a potent inducer of ROS-mediated apoptosis in cancer, but its mechanism of action is poorly understood.

Method: Superoxide production with MB exposure in colorectal cancer (CRC) cells was measured using lucigenin chemiluminescence and real-time PCR. MB's inhibitory effect on proliferation and viability of CRC cells was determined by proliferation assays. MB's effect on apoptosis of CRC cells was determined by Western blotting and annexin V-FITC/PI staining. MB's effect on the growth of CRC xenografts in mice was assessed. An established metabolomics profiling platform combining ultra-performance liquid chromatography-tandem mass spectrometry (LC-MS) with gas chromatography-mass spectrometry (GC-MS) was performed to determine MB's effect on total metabolite variation in CRC cells.

Results: We found that MB increases ROS generation via modulating key metabolic pathways. Using metabolomics profiling platform combining LC-MS with GC-MS, a total of 236 metabolites were identified in HCT-116 cells in which 31 metabolites were determined to be significantly regulated (p ≤ 0.05) after MB exposure. A number of key metabolites revealed by metabolomics analysis include glucose, fructose, citrate, arginine, phenylalanine, and S-adenosylhomocysteine (SAH), suggesting specific modulation of metabolism on carbohydrates, amino acids and peptides, lipids, nucleotide, cofactors and vitamins in HCT-116 CRC cells with MB treatment highly associated with apoptosis triggered by enhanced ROS and activated caspase-3.

Conclusion: Our results demonstrate that MB represses CRC cell proliferation by inducing ROS-mediated apoptosis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1159/000489147DOI Listing
July 2018

The influence of anion chemistry on the ionic conductivity and molecular dynamics in protic organic ionic plastic crystals.

Phys Chem Chem Phys 2018 Feb;20(6):4579-4586

ARC Centre of Excellence for Electromaterials Science (ACES), Institute for Frontier Materials (IFM), Deakin University, Melbourne Campus at Burwood, Burwood VIC 3125, Australia.

Proton conductors are widely used in different electrochemical devices including fuel cells and redox flow batteries. Compared to conventional proton conducting polymer membranes, protic organic ionic plastic crystal (POIPC) is a novel solid-state proton conductor with high proton conductivity even under anhydrous conditions. In this work, different organic protic salts based on the same parent di-functional cation with different anions were synthesized and characterized. It is found that the di-protonated cation plays an important role in defining the thermal properties, leading to stronger plastic crystal behavior and a higher melting point. Static solid-state NMR and the synchrotron XRD results show that the di-protonated cation allows greater dynamics in the crystal in contrast to the mono-protonated counterparts. The 1-(N,N-dimethylammonium)-2-(ammonium)ethane triflate ([DMEDAH][Tf]) has the highest ionic conductivity of 1.1 × 10 S cm at 50 °C, whereas the bis(trifluoromethanesulfonyl)amide counterpart [DMEDAH][TFSA] has the lowest ionic conductivity (2.8 × 10 S cm at 50 °C) with no measureable mobile ion component at this temperature. The fraction of mobile species is significantly suppressed in the TFSA containing salts as against the Tf systems.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1039/c7cp07330eDOI Listing
February 2018

Upregulated TRIM11 Exerts its Oncogenic Effects in Hepatocellular Carcinoma Through Inhibition of P53.

Cell Physiol Biochem 2017 9;44(1):255-266. Epub 2017 Nov 9.

Department of Respiratory Medicine, Putuo Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China.

Background/aims: The tripartite motif containing (TRIM) family plays crucial roles in tumor development and progression. However, little is known about the function and mechanism of TRIM11 in hepatocellular carcinoma (HCC).

Methods: The expression levels of TRIM11 were examined by real-time PCR, Western blot and Immunohistochemical (IHC) staining. TRIM11 knockdown cells were produced by lentivirus infection, and functional assays, such as MTT, colony formation assay, migration and invasion assays and a xenograft tumor model were used to investigate the role of TRIM11 in HCC. We also determined the effect of TRIM11 on p53 signaling and its downstream molecules.

Results: We found that TRIM11 mRNA and protein levels were significantly increased in HCC tissues as compared with normal tissues; increased levels correlated with poor patient survival. By loss- and gain-of-function investigations, knockdown of TRIM11 suppressed cell proliferation, migration, invasion in vitro and tumor growth in vivo. Moreover, TRIM11 negatively regulated p53 expression. Knockdown of p53 abrogated the in vitro and in vivo biological functions of TRIM11 shRNA in HCC cells.

Conclusions: These data show that TRIM11 exerts its oncogenic effect in HCC by downregulating p53 both in vitro and in vivo. Our data provide new insights into the pathogenesis of HCC and indicate that TRIM11 may serve as a new therapeutic target for HCC treatment.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1159/000484678DOI Listing
March 2018