Publications by authors named "Jianping Chen"

554 Publications

Effect of microplastics on organic matter decomposition in paddy soil amended with crop residues and labile C: A three-source-partitioning study.

J Hazard Mater 2021 08 26;416:126221. Epub 2021 May 26.

State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-products, Institute of Plant Virology, Ningbo University, Ningbo 315211, China. Electronic address:

Microplastics (MPs) are a widespread pollutant in terrestrial ecosystems. However, knowledge on how MPs impact soil organic matter (SOM) decomposition and the priming effect (PE) in rice paddy soil remains limited. By employing a three-source-partitioning approach, we investigated the interactive impact of MP dosage (none, low [0.01% w/w] or high [1% w/w]), labile C (C-labeled glucose), and C-labeled rice straw addition on SOM decomposition and PE. Compared to soil without C addition (i.e., control), total SOM-derived CO in low-MP soil declined by 13.2% and 7.1% after straw and glucose addition, respectively. Under combined glucose and rice straw addition, glucose-induced PE was up to 10 times stronger in the presence of low-MPs compared to that in high-MPs. However, glucose induced negative PE on rice straw decomposition in the presence of MPs. SOM decomposition was much higher under low MP dosage than under high MP dosage. However, MPs had a negligible effect on the mineralization of exogenous C substrate (glucose or straw). This study provides a novel and valuable insight on how MPs affect SOM turnover and C sequestration in paddy soil, highlighting the significance of interactions between environmental pollutants and biogeochemical processes that affect CO fluxes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jhazmat.2021.126221DOI Listing
August 2021

Targeting autophagy in ethnomedicine against human diseases.

J Ethnopharmacol 2021 Sep 3:114516. Epub 2021 Sep 3.

School of Pharmacy, Southwest Medical University, Luzhou, 646000, China; Education Ministry Key Laboratory of Medical Electrophysiology, Sichuan Key Medical Laboratory of New Drug Discovery and Druggability Evaluation, Luzhou Key Laboratory of Activity Screening and Druggability Evaluation for Chinese Materia Medica, Southwest Medical University, Luzhou, 646000, China. Electronic address:

Ethnopharmacological Relevance: In the past five years, ethnopharmacy-based drugs have been increasingly used in clinical practice. It has been reported that hundreds of ethnopharmacy-based drugs can modulate autophagy to regulate physiological and pathological processes, and ethnomedicines also have certain therapeutic effects on illnesses, revealing the important roles of these medicines in regulating autophagy and treating diseases.

Aim Of The Study: This study reviews the regulatory effects of natural products on autophagy in recent years, and discusses their pharmacological effects and clinical applications in the process of diseases. It provides the preliminary literature basis and reference for the research of plant drugs in the regulation of autophagy.

Materials And Methods: A comprehensive systematic review in the fields of relationship between autophagy and ethnomedicine in treating diseases from PubMed electronic database was performed. Information was obtained from documentary sources.

Results: We recorded some illnesses associated with autophagy, then classified them into different categories reasonably. Based on the uses of these substances in different researches of diseases, a total of 80 active ingredients or compound preparations of natural drugs were searched. The autophagy mechanisms of these substances in the treatments of diseases have been summarized for the first time, we also looked forward to the clinical application of some of them.

Conclusions: Autophagy plays a key function in lots of illnesses, the regulation of autophagy has become one of the important means to prevent and treat these diseases. About 80 compounds and preparations involved in this review have been proved to have therapeutic effects on related diseases through the mechanism of autophagy. Experiments in vivo and in vitro showed that these compounds and preparations could treat these diseases by regulating autophagy. The typical natural products curcumin and tripterine have powerful roles in regulating autophagy and show good and diversified curative effects.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jep.2021.114516DOI Listing
September 2021

Phase change material enabled 2 × 2 silicon nonvolatile optical switch.

Opt Lett 2021 Sep;46(17):4224-4227

Recently, large-scale photonic integrated circuits have seen rapid development. Optical switches are the elementary units used to realize optical routers and processors. However, the high static power and large footprint of silicon electro-optic and thermo-optic switches are becoming an obstacle for further scaling and high-density integration. In this Letter, we demonstrate a 2×2 nonvolatile silicon Mach-Zehnder optical switch enabled by low-loss phase change material . Changing the phase state of can switch the optical transmission between the bar and cross paths. As no static power is required to maintain the phase state, it can find promising applications in optical switch matrices and reconfigurable optical circuits.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1364/OL.435552DOI Listing
September 2021

Single-frequency integrated laser on erbium-doped lithium niobate on insulator.

Opt Lett 2021 Sep;46(17):4128-4131

The erbium-doped lithium niobate on insulator (Er:LNOI) platform has great promise in the application of telecommunication, microwave photonics, and quantum photonics, due to its excellent electro-optic, piezo-electric, nonlinear nature, as well as the gain characteristics in the telecommunication C-band. Here, we report a single-frequency Er:LNOI integrated laser based on a dual-cavity structure. Facilitated by the Vernier effect and gain competition, the single-frequency laser can operate stably at 1531 nm wavelength with a 1484 nm pump laser. The output laser has a power of 0.31 µW, a linewidth of 1.2 MHz, and a side mode suppression ratio of 31 dB. Our work allows the direct integration of this laser source with existing LNOI components and paves the way for a fully integrated LNOI system.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1364/OL.432921DOI Listing
September 2021

The Role of Gut Microbial β-Glucuronidase in Estrogen Reactivation and Breast Cancer.

Front Cell Dev Biol 2021 12;9:631552. Epub 2021 Aug 12.

School of Chinese Medicine, The University of Hong Kong, Hong Kong, China.

Over the past decade, the gut microbiota has received considerable attention for its interactions with the host. Microbial β-glucuronidase generated by this community has hence aroused concern for its biotransformation activity to a wide range of exogenous (foreign) and endogenous compounds. Lately, the role of gut microbial β-glucuronidase in the pathogenesis of breast cancer has been proposed for its estrogen reactivation activity. This is plausible considering that estrogen glucuronides are the primary products of estrogens' hepatic phase II metabolism and are subject to β-glucuronidase-catalyzed hydrolysis in the gut bile excretion. However, research in this field is still at its very preliminary stage. This review outlines the biology of microbial β-glucuronidase in the gastrointestinal tract and elaborates on the clues to the existence of microbial β-glucuronidase-estrogen metabolism-breast cancer axis. The research gaps in this field will be discussed and possible strategies to address these challenges are suggested.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fcell.2021.631552DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8388929PMC
August 2021

First Report of Turnip Mosaic Virus in Peanut (Arachis hypogaea L.) in China.

Plant Dis 2021 Aug 29. Epub 2021 Aug 29.

Ningbo University, 47862, State Key Laboratory for Quality and Safety of Agro-products, Institute of Plant Virology, Fenghua Road 818, Ningbo, China, 315211;

Peanut (Arachis hypogaea L.) is an important source of edible oil in China but its yield and quality in agricultural production are affected by a number of diseases including those caused by viruses. The four viruses most commonly reported to affect the production of peanut worldwide are peanut stripe virus, cucumber mosaic virus, peanut stunt virus and peanut bud necrosis virus (Srinivasan et al. 2017; Xu et al. 2017). During a disease survey in June 2020, virus-like disease symptoms including mosaic and necrotic spots were observed in field peanut plants in Yuyao county, Zhejiang, China (Supplementary Fig S1). These symptoms differed from those caused by the four major peanut viruses (Dunoyer et al. 2020; Srinivasan et al. 2017; Takahashi et al. 2018; Xu et al. 2017). To identify the putative viral agent(s) associated with the virus-like disease in these plants, leaves from six plants in the same field were collected, pooled and subjected to high throughput RNA-Seq sequencing (HTS). The TruSeq RNA Sample Preparation Kit (Illumina, California, USA) was used to construct cDNA library according to the manufacturer's instructions. An Illumina NovaSeq 6000 platform (Illumina) with PE150 bp and CLC Genomic Workbench 11 (QIAGEN) was used for sequencing and data analysis. After data collection and analysis, a total of 18,592 contigs were generated from de novo assembly of the clean paired-end reads (35,935,936). After comparing with sequences deposited in GenBank using BLASTn, four assembled contigs (ranging from 4,969 to 8,937 nt in length) were found to share 94.9%-95.9% identity to the turnip mosaic virus (TuMV, genus Potyvirus). No other virus sequences were detected in the data. To confirm the presence of TuMV and to obtain its full-length sequence, total RNA was extracted from a single plant selected from initial sample pool by using the plant RNA extraction KIT (Aidlab, Beijing, China). Five primer pairs (Supplementary Table 1), which were anticipated to result in overlapping amplicons covering all but the 5'-end of the genome, were designed based on the TuMV contig sequences and the complete nucleotide sequence of TuMV was subsequently amplified by the reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using the commercial SUPERSWITCH™ 5'RACE cDNA Kit (Tiosbio, Beijing, China). All the PCR products were subsequently cloned into pEASY®-T5 Zero (TransGen Biotech, Beijing, China), and three clones of each fragment were randomly selected and sequenced by Sanger sequencing at Ykang (Ykang, Hangzhou, China). The complete sequence of the TuMV isolate (designated isolate Ningbo) was deposited in GenBank under accession number MZ062212. BLASTn analysis showed that TuMV-Ningbo shared a sequence identity of 96.0% with a Brassica isolate of TuMV in China (HQ446216) and 95.9% with a Brassica isolate in the Czech Republic (LC537547). Phylogenetic analysis grouped the three into a cluster (Supplementary Fig S2), suggesting Ningbo as a member of the world-B Group (Kawakubo et al. 2021). A western blot analysis of leaf sap using a TuMV CP antibody prepared by our laboratory (unpublished data) confirmed the presence of TuMV in all of the samples used for the HTS analysis. Peanut and Nicotiana benthamiana plants growing in the green house were also mechanically inoculated with peanut leaf sap obtained from one of samples. Seven days after inoculation, mosaic and leaf curing symptoms were observed on inoculated plants and the infection of TuMV was subsequently confirmed by RT-PCR (primers TuMV-CP: 5'- GCAGGTGAAACGCTTGATGC -3' and 5'- CAACCCCTGAACGCCCAGTA-3') and western blot assay. In contrast, no symptoms nor TuMV were detected in the mock-inoculated plants. TuMV is an important pathogen of brassica crops and is known to have a worldwide host range. However, to our knowledge, this is the first report of TuMV infection in peanut in China and the finding suggests that the threat of TuMV should be considered when interplanting peanuts and cruciferous vegetables, as in common in this region of China.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-05-21-0997-PDNDOI Listing
August 2021

Binding between elongation factor 1A and the 3'-UTR of Chinese wheat mosaic virus is crucial for virus infection.

Mol Plant Pathol 2021 Aug 17. Epub 2021 Aug 17.

College of Plant Protection, Northwest Agriculture and Forestry University, Yangling, China.

The Chinese wheat mosaic virus (CWMV) genome consists of two positive-strand RNAs that are required for CWMV replication and translation. The eukaryotic translation elongation factor (eEF1A) is crucial for the elongation of protein translation in eukaryotes. Here, we show that silencing eEF1A expression in Nicotiana benthamiana plants by performing virus-induced gene silencing can greatly reduce the accumulation of CWMV genomic RNAs, whereas overexpression of eEF1A in plants increases the accumulation of CWMV genomic RNAs. In vivo and in vitro assays showed that eEF1A does not interact with CWMV RNA-dependent RNA polymerase. Electrophoretic mobility shift assays revealed that eEF1A can specifically bind to the 3'-untranslated region (UTR) of CWMV genomic RNAs. By performing mutational analyses, we determined that the conserved region in the 3'-UTR of CWMV genomic RNAs is necessary for CWMV replication and translation, and that the sixth stem-loop (SL-6) in the 3'-UTR of CWMV genomic RNAs plays a key role in CWMV infection. We conclude that eEF1A is an essential host factor for CWMV infection. This finding should help us to develop new strategies for managing CWMV infections in host plants.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/mpp.13120DOI Listing
August 2021

Prevalence of vitiligo and associated comorbidities in adults in Shanghai, China: a community-based, cross-sectional survey.

Ann Palliat Med 2021 Jul;10(7):8103-8111

Department of Dermatology, Huashan Hospital Affiliated Fudan University, Shanghai, China.

Background: The prevalence of vitiligo has been reported to range from 0.1% to 8% worldwide, and vitiligo has been linked to some autoimmune and non-autoimmune diseases. This study aimed to estimate the prevalence of vitiligo and associated comorbidities in adults in Shanghai.

Methods: A community-based cross-sectional survey was conducted among 9,114 adults (4,288 males) in a community of Shanghai between October 2009 and January 2010. Face-to-face interviews were conducted at the home of each participant, and all respondents had their skin examined by dermatologists. The risks of comorbidities associated with vitiligo were evaluated by multiple logistic regression analysis.

Results: The estimated prevalence of vitiligo was 0.91%, and the standardized (age-adjusted) prevalence was 0.67%. Prevalence increased with age from 0.20% in 18-30 years to 1.59% in the 71-80 years age group. The presence of vitiligo was associated with increased risks of atopic dermatitis [adjusted odds ratio (aOR) =2.49; 95% confidence interval (95% CI): 1.46-4.23], urticaria (aOR =1.83; 95% CI: 1.11-3.04). and coronary heart disease (aOR =1.88; 95% CI: 1.03-3.41), although the association with coronary heart disease was only identified in subjects who were aged ≥60 years or overweight.

Conclusions: The prevalence of vitiligo in Shanghai was comparable to that seen in previous studies and increased with age. Vitiligo was associated with increased risks of atopic dermatitis, urticaria, and coronary heart disease in adults.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.21037/apm-21-1738DOI Listing
July 2021

Turnip mosaic virus impairs perinuclear chloroplast clustering to facilitate viral infection.

Plant Cell Environ 2021 Jul 30. Epub 2021 Jul 30.

State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-products, Institute of Plant Virology, Ningbo University, Ningbo, China.

Chloroplasts play crucial roles in plant defence against viral infection. We now report that chloroplast NADH dehydrogenase-like (NDH) complex M subunit gene (NdhM) was first up-regulated and then down-regulated in turnip mosaic virus (TuMV)-infected N. benthamiana. NbNdhM-silenced plants were more susceptible to TuMV, whereas overexpression of NbNdhM inhibited TuMV accumulation. Overexpression of NbNdhM significantly induced the clustering of chloroplasts around the nuclei and disturbing this clustering facilitated TuMV infection, suggesting that the clustering mediated by NbNdhM is a defence against TuMV. It was then shown that NbNdhM interacted with TuMV VPg, and that the NdhMs of different plant species interacted with the proteins of different viruses, implying that NdhM may be a common target of viruses. In the presence of TuMV VPg, NbNdhM, which is normally localized in the nucleus, chloroplasts, cell periphery and chloroplast stromules, colocalized with VPg at the nucleus and nucleolus, with significantly increased nuclear accumulation, while NbNdhM-mediated chloroplast clustering was significantly impaired. This study therefore indicates that NbNdhM has a defensive role in TuMV infection probably by inducing the perinuclear clustering of chloroplasts, and that the localization of NbNdhM is altered by its interaction with TuMV VPg in a way that promotes virus infection.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/pce.14157DOI Listing
July 2021

Downregulation of Light-Harvesting Complex II Induces ROS-Mediated Defense Against Turnip Mosaic Virus Infection in .

Front Microbiol 2021 5;12:690988. Epub 2021 Jul 5.

State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-products, Institute of Plant Virology, Ningbo University, Ningbo, China.

The light-harvesting chlorophyll / complex protein 3 (LHCB3) of photosystem II plays important roles distributing the excitation energy and modulating the rate of state transition and stomatal response to abscisic acid. However, the functions of LHCB3 in plant immunity have not been well investigated. Here, we show that the expression of in () was down-regulated by turnip mosaic virus (TuMV) infection. When was silenced by tobacco rattle virus-induced gene silencing, systemic infection of TuMV was inhibited. HO was over-accumulated in -silenced plants. Chemical treatment to inhibit or eliminate reactive oxygen species (ROS) impaired the resistance of the -silenced plants to TuMV infection. Co-silencing of with genes involved in ROS production compromised the resistance of plants to TuMV but co-silencing of with genes in the ROS scavenging pathway increased resistance to the virus. Transgenic plants overexpressing were more susceptible to TuMV. These results indicate that downregulation of is involved in defense against TuMV by inducing ROS production.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fmicb.2021.690988DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8287655PMC
July 2021

Circular RNA circ_001422 promotes the progression and metastasis of osteosarcoma via the miR-195-5p/FGF2/PI3K/Akt axis.

J Exp Clin Cancer Res 2021 Jul 16;40(1):235. Epub 2021 Jul 16.

Department of Joint and Orthopedics, Zhujiang Hospital, Southern Medical University, Guangzhou, 510282, China.

Background: Circular RNAs (circRNAs) are involved in diverse processes that drive cancer development. However, the expression landscape and mechanistic function of circRNAs in osteosarcoma (OS) remain to be studied.

Methods: Bioinformatic analysis and high-throughput RNA sequencing tools were employed to identify differentially expressed circRNAs between OS and adjacent noncancerous tissues. The expression level of circ_001422 in clinical specimens and cell lines was measured using qRT-PCR. The association of circ_001422 expression with the clinicopathologic features of 55 recruited patients with OS was analyzed. Loss- and gain-of-function experiments were conducted to explore the role of circ_001422 in OS cells. RNA immunoprecipitation, fluorescence in situ hybridization, bioinformatics database analysis, RNA pulldown assays, dual-luciferase reporter assays, mRNA sequencing, and rescue experiments were conducted to decipher the competitive endogenous RNA regulatory network controlled by circ_001422.

Results: We characterized a novel and abundant circRNA, circ_001422, that promoted OS progression. Circ_001422 expression was dramatically increased in OS cell lines and tissues compared with noncancerous samples. Higher circ_001422 expression correlated with more advanced clinical stage, larger tumor size, higher incidence of distant metastases and poorer overall survival in OS patients. Circ_001422 knockdown markedly repressed the proliferation and metastasis and promoted the apoptosis of OS cells in vivo and in vitro, whereas circ_001422 overexpression exerted the opposite effects. Mechanistically, competitive interactions between circ_001422 and miR-195-5p elevated FGF2 expression while also initiating PI3K/Akt signaling. These events enhanced the malignant characteristics of OS cells.

Conclusions: Circ_001422 accelerates OS tumorigenesis and metastasis by modulating the miR-195-5p/FGF2/PI3K/Akt axis, implying that circ_001422 can be therapeutically targeted to treat OS.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s13046-021-02027-0DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8283840PMC
July 2021

Tumorigenic risk of Angelica sinensis on ER-positive breast cancer growth through ER-induced stemness in vitro and in vivo.

J Ethnopharmacol 2021 Nov 13;280:114415. Epub 2021 Jul 13.

School of Chinese Medicine, LKS Faculty of Medicine, The University of Hong Kong, 10 Sassoon Road, Pokfulam, Hong Kong; Shenzhen Institute of Research and Innovation, The University of Hong Kong, Shenzhen Virtual University Park, Nanshan, Shenzhen, China; Guangzhou University of Chinese Medicine, Daxuecheng Hongmian Road, Panyu District, Guangzhou, Guangdong Province, China. Electronic address:

Ethnopharmacological Relevance: The root of Angelica sinensis is widely used in traditional Chinese Medicine for relieving gynecological discomforts among the women population. However, its hormone-like effects have raised great attention on whether it is appropriate to use in breast cancer (BC) patients. Hence, this study aimed to investigate the tumorigenic effect of aqueous root extract of Angelica sinensis (AS) on estrogen receptor (ER)-positive BC growth through ER-induced stemness in-vitro and in-vivo.

Materials And Methods: The chemical composition of the AS was characterized by HPLC. Cell viability was detected by MTS assay. The in-vivo effect of AS was investigated by xenograft model, immunohistochemistry, histology, Western blot, and self-renewal ability assay. Target verification was used by shRNA construction and transfection. Mammosphere formation assay was performed by flow cytometry.

Results: AS significantly promoted the proliferation of MCF-7 cells and inhibited the growth of MDA-MB-231 cells. AS significantly induced tumor growth (2.5 mg/kg) in xenograft models and however tamoxifen treatment significantly suppressed the AS-induced tumor growth. AS induced ERα expression in both in-vivo and in-vitro and promoted cancer stem cell activity in ER-positive BC.

Conclusion: AS shows the tumorigenic potential on ER-positive BC growth through ERα induced stemness, suggesting that the usage of AS is not recommended for BC in terms of safety measures.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jep.2021.114415DOI Listing
November 2021

Glycyrrhetinic acid induces oxidative/nitrative stress and drives ferroptosis through activating NADPH oxidases and iNOS, and depriving glutathione in triple-negative breast cancer cells.

Free Radic Biol Med 2021 09 14;173:41-51. Epub 2021 Jul 14.

School of Chinese Medicine, LKS Faculty of Medicine, The University of Hong Kong, Hong Kong, China; Shenzhen Institute of Research and Innovation, The University of Hong Kong, Shenzhen, China. Electronic address:

Reactive oxygen species (ROS)/reactive nitrogen species (RNS)-mediated ferroptosis becomes a novel effective target for anti-cancer treatment. In the present study, we tested the hypothesis that 18-β-glycyrrhetinic acid (GA), an active compound from medicinal herbal Licorice, could induce the production of ROS/RNS, increase lipid peroxidation and trigger ferroptosis in MDA-MB-231 triple negative breast cancer cells. To confirm the GA's anti-cancer effects, we detected cell viability, apoptosis and ferroptosis in the MDA-MB-231 cells. To explore the effects of GA on inducing ferroptosis, we measured mitochrondrial morphology, ROS/RNS production, lipid peroxidation, ferrous ion, glutathione (GSH), System Xc, GPX4, glutathione peroxidases (GPX), NADPH oxidase and iNOS in the MDA-MB-231 cells. The major discoveries are included as below: (1) GA treatment selectively decreased cell viability and induced ferroptosis companied with the increased lipid peroxidation and ferrous ion in the MDA-MB-231 triple negative breast cancer cells. Iron chelator deferoxamine mesylate (DFO) and ferroptosis inhibitor Ferrostatin-1 abolished the effects of GA. (2) GA treatment up-regulated the expression and activity of NADPH oxidase and iNOS, and increased ROS/RNS productions (O, OH, NO and ONOO) in the MDA-MB-231 cells; (3) GA down-regulated the expression of SLC7A11 of System X, decreased glutathione (GSH) level and inhibited GPX activity. Taken together, GA could promote the productions of ROS and RNS via activating NADPH oxidases and iNOS, and decreasing GSH and GPX activity, subsequently aggravating lipid peroxidation and triggering ferroptosis in triple-negative breast cancer cells.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.freeradbiomed.2021.07.019DOI Listing
September 2021

Ultrahigh-cell-density heterotrophic cultivation of the unicellular green alga Chlorella sorokiniana for biomass production.

Biotechnol Bioeng 2021 Oct 26;118(10):4138-4151. Epub 2021 Jul 26.

Center for Microalgal Biotechnology and Biofuels, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China.

Heterotrophic cultivation of Chlorella has achieved commercial success, but the application of Chlorella biomass is still limited due to the high cost of biomass production. In this study, an effective and industrially scalable heterotrphic cultivation technology has been developed for a production strain Chlorella sorokiniana GT-1. Under the optimized culturing conditions, the ultrahigh biomass concentration of 271 and 247 g L was achieved in 7.5 L bench-scale and 1000 L pilot-scale fermenters, respectively. Technoeconomic (TE) analysis indicated that the production cost of C. sorokiniana GT-1 could be reduced to $1601.27 per ton of biomass if the biomass concentration reached 200 g L , which is 24.2% lower than that of the reported highest Chlorella biomass production through fermentation with the same TE model. Under the same growth conditions, the maximum biomass concentration of a low-starch mutant SLM2 was reduced to 93 g L , which was 54% lower than that of the wild type, indicating the capabilities of C. sorokiniana GT-1 cells in accumulating large amounts of starch are essential for achieving the ultrahigh-cell-density under the heterotrophic conditions. In addition, the ultrahigh-cell-density growth potential of C. sorokiniana GT-1 cells was inferred to be related to the intrinsic biological characteristics including the tolerance to low dissolved oxygen and a moderate doubling time under the heterotrophic conditions as well. The breakthrough in cultivation technology is promising for Chlorella industry and would expand its applications in food and feed.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/bit.27890DOI Listing
October 2021

A rice LRR receptor-like protein associates with its adaptor kinase OsSOBIR1 to mediate plant immunity against viral infection.

Plant Biotechnol J 2021 Jul 12. Epub 2021 Jul 12.

State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-products, Key Laboratory of Biotechnology in Plant Protection of Ministry of Agriculture and Zhejiang Province, Institute of Plant Virology, Ningbo University, Ningbo, China.

Plants sense pathogen attacks using a variety of receptors at the cell surface. The LRR receptor-like proteins (RLP) and receptor-like kinases (RLK) are widely reported to participate in plant defence against bacterial and fungal pathogen invasion. However, the role of RLP and RLK in plant antiviral defence has rarely been reported. We employed a high-throughput-sequencing approach, transgenic rice plants and viral inoculation assays to investigate the role of OsRLP1 and OsSOBIR1 proteins in rice immunity against virus infection. The transcript of a rice LRR receptor-like protein, OsRLP1, was markedly up-regulated following infection by RBSDV, a devastating pathogen of rice and maize. Viral inoculation on various OsRLP1 mutants demonstrated that OsRLP1 modulates rice resistance against RBSDV infection. It was also shown that OsRLP1 is involved in the RBSDV-induced defence response by positively regulating the activation of MAPKs and PTI-related gene expression. OsRLP1 interacted with a receptor-like kinase OsSOBIR1, which was shown to regulate the PTI response and rice antiviral defence. Our results offer a novel insight into how a virus-induced receptor-like protein and its adaptor kinase activate the PTI response and antiviral defence in rice.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/pbi.13663DOI Listing
July 2021

Performance of digital servos in an optical frequency transfer network.

Rev Sci Instrum 2021 May;92(5):053709

State Key Laboratory of Advanced Optical Communication Systems and Networks, State Key Laboratory of Advanced Optical Communication Systems and Networks, Shanghai Institute for Advanced Communication and Data Science, Department of Electronic Engineering, Shanghai Jiao Tong University, Shanghai 200240, China.

We demonstrate the use of three kinds of flexible digital servos for the stabilization of the optical fiber link, the interferometer temperature, and the polarization of the transmitted light at the remote site, respectively. The main fiber noise cancellation digital servo provides a large phase detection range (∼2π radians), automatic relock function, and low cycle-slip rate over a 62 km field-deployed fiber link achieved by utilizing a feedback optical actuator of an acousto-optic modulator fed by a voltage-controlled oscillator. The temperature control and polarization control digital servos enable that the temperature of the interferometer can be stabilized at a stability of 0.01 K and the data uptime is enhanced from 85.5% to 99.9% by implementing the polarization controller. The results demonstrate that the performance of the three digital servos is sufficient for high-precision optical frequency transfer applications and indicates comparable performance to existing analog optical frequency control systems. The full digital controlled optical frequency transfer method demonstrated here provides guidance for the development of a low-cost, low-complexity, and high-reliability optical frequency transfer system.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1063/5.0045168DOI Listing
May 2021

Integrated Proteomics and Transcriptomics Analyses Reveal the Transcriptional Slippage of P3N-PIPO in a Bymovirus.

Viruses 2021 06 26;13(7). Epub 2021 Jun 26.

Hunan Provincial Key Laboratory for Biology and Control of Plant Diseases and Insect Pests, College of Plant Protection, Hunan Agricultural University, Changsha 410128, China.

P3N-PIPO (P3 N-terminal fused with Pretty Interesting Potyviridae ORF), the movement protein of potyviruses, is expressed as a translational fusion with the N-terminus of P3 in potyviruses. As reported in previous studies, P3N-PIPO is expressed via transcriptional slippage at a conserved GA slippery site in the genus . However, it is still unknown whether a similar expression mechanism of P3N-PIPO is used in the other genera of the family . Moreover, due to the extremely low expression level of P3N-PIPO in natural virus-infected plants, the peptides spanning the slippery site which provide direct evidence of the slippage at the protein level, have not been identified yet. In this study, a potato virus X (PVX)-based expression vector was utilized to investigate the expression mechanism of P3N-PIPO. A high expression level of the P3N-PIPO(WT) of turnip mosaic virus (TuMV, genus ) was observed based on the PVX expression vector. For the first time, we successfully identified the peptides of P3N-PIPO spanning the slippery site by mass spectrometry. Likewise, the P3N-PIPO(WT) of wheat yellow mosaic virus (WYMV, genus ) was also successfully expressed using the PVX expression vector. Integrated proteome and transcriptome analyses revealed that WYMV P3N-PIPO was expressed at the conserved GA site through transcriptional slippage. Moreover, as revealed by mutagenesis analysis, Hexa-adenosine of the GA site was important for the frameshift expression of P3N-PIPO in WYMV. According to our results, the PVX-based expression vector might be used as an excellent tool to study the expression mechanism of P3N-PIPO in . To the best of our knowledge, this is the first experimental evidence for the expression mechanism of P3N-PIPO in the genus , the only genus comprising bipartite virus species in the family .
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/v13071247DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8310318PMC
June 2021

High-cell-density cultivation of the flagellate alga Poterioochromonas malhamensis for biomanufacturing the water-soluble β-1,3-glucan with multiple biological activities.

Bioresour Technol 2021 Oct 24;337:125447. Epub 2021 Jun 24.

Center for Microalgal Biotechnology and Biofuels, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, PR China; Institute for Advanced Study, Shenzhen University, Shenzhen 518060, PR China; State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, PR China; Key Laboratory for Algal Biology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, PR China; The Innovative Academy of Seed Design, Chinese Academy of Sciences, Beijing 100864, PR China; Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266071, China. Electronic address:

The microalga Poterioochromonas malhamensis was found to be capable of accumulating the storage β-1,3-glucan in soluble form under heterotrophic conditions. In this study, the highest biomass yield of 32.8 g L was achieved by combining the utilization of ammonium chloride as the nitrogen source, simultaneous addition of vitamins B1 and B12 and maintenance of pH at 6.0. Sugar profiling and nuclear magnetic resonance analysis indicated that the P. malhamensis β-1,3-glucan was composed of glucose with the β-(1 → 3) main chain and the β-(1 → 6) side chain. Under the optimal cultivation conditions, the cellular β-1,3-glucan content was up to 55% of the cell dry weight. Moreover, the P. malhamensis β-1,3-glucan could significantly promote the fin regeneration and improve the in vivo antioxidative activity of zebrafish. This study underpins the feasibility of culturing P. malhamensis under heterotrophic conditions for producing the highly water-soluble bioactive β-1,3-glucans for food and pharmaceutical applications.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.biortech.2021.125447DOI Listing
October 2021

Genome-wide identification and characterization of UBP gene family in wheat ( L.).

PeerJ 2021 15;9:e11594. Epub 2021 Jun 15.

State Key Laboratory for Quality and Safety of Agro-products, Institute of Plant Virology, Ningbo University, Ningbo, China.

Ubiquitination is essential for plant growth and development. Deubiquitination cooperates with ubiquitination to regulate the ubiquitination levels of target proteins. The ubiquitin-specific protease (UBP) family is the largest group of deubiquitinases (DUBs), which perform extensive and significant roles in eukaryotic organisms. However, the genes in wheat () are not identified, and the functions of are unknown. The present study identified 97 genes in the whole genome of . . These genes were divided into 15 groups and non-randomly distributed on chromosomes of . . Analyses of evolutionary patterns revealed that mainly underwent purification selection. The studies of -acting regulatory elements indicated that they might be involved in response to hormones. Quantitative real-time PCR (qRT-PCR) results showed that were differentially expressed in different tissues. Besides, several were significantly up-regulated when plants were treated with salicylic acid (SA), implying that these DUBs may play a role in abiotic stress responses in plants and few displayed differential expression after viral infection. Furthermore, () silenced by virus-induced gene silencing (VIGS) facilitates (CWMV) infection in wheat, indicating that may be involved in a defense mechanism against viruses. This study comprehensively analyzed the gene family in wheat and provided a basis for further research of functions in wheat plant response to viral infection.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.7717/peerj.11594DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8212830PMC
June 2021

Fetal growth standards for Chinese twin pregnancies.

BMC Pregnancy Childbirth 2021 Jun 22;21(1):436. Epub 2021 Jun 22.

Department of Fetal Medicine and Prenatal Diagnosis Center, Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine, 2699 West Gaoke Rd, Shanghai, 201204, China.

Background: The common use of singleton fetal growth standard to access twin growth might lead to over-monitoring and treatment. We aimed to develop fetal growth standards for Chinese twins based on ultrasound measurements, and compare it with Zhang's and other twin fetal growth charts.

Methods: A cohort of uncomplicated twin pregnancies were prospectively followed in 2014-2017. Smoothed estimates of fetal growth percentiles for both monochorionic (MC) and dichorionic (DC) twins were obtained using a linear mixed model. We also created growth charts for twins using a model-based approach proposed by Zhang et al. Our twin standards were compared with Hadlock's (singleton) in predicting adverse perinatal outcomes.

Results: A total of 398 twin pregnancies were included, with 214 MC and 582 DC live-born twins. The MC twins were slightly lighter than the DC twins, with small differences throughout the gestation. Our ultrasound-based fetal weight standards were comparable to that using Zhang's method. Compared with previous references/standards from the US, Brazil, Italy and UK, our twins had very similar 50th percentiles, but narrower ranges between the 5th and 95th or 10th and 90th percentiles. Compared with the Hadlock's standard, the risks of neonatal death and adverse perinatal outcomes for small for gestational age (SGA) versus non-SGA were substantially elevated using our standards.

Conclusions: A normal fetal growth standard for Chinese twins was created. The differences between MC and DC twins were clinically insignificant. The 50th weight percentiles of the Chinese twins were identical to those in other races/ethnicities but the ranges were markedly narrower. Our standard performed much better than the Hadlock's in predicting low birth weight infants associated with adverse perinatal outcomes in twin pregnancies. The present study also indicated that Zhang's method is applicable to Chinese twins, and other areas may use Zhang's method to generate their own curves for twins if deemed necessary.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12884-021-03926-yDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8220745PMC
June 2021

Ferredoxin 1 is downregulated by the accumulation of abscisic acid in an ABI5-dependent manner to facilitate rice stripe virus infection in Nicotiana benthamiana and rice.

Plant J 2021 Aug 10;107(4):1183-1197. Epub 2021 Jul 10.

State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products, Key Laboratory of Biotechnology in Plant Protection of MOA of China and Zhejiang Province, Institute of Plant Virology, Ningbo University, Ningbo, 315211, China.

Ferredoxin 1 (FD1) accepts and distributes electrons in the electron transfer chain of plants. Its expression is universally downregulated by viruses and its roles in plant immunity have been brought into focus over the past decade. However, the mechanism by which viruses regulate FD1 remains to be defined. In a previous report, we found that the expression of Nicotiana benthamiana FD1 (NbFD1) was downregulated following infection with potato virus X (PVX) and that NbFD1 regulates callose deposition at plasmodesmata to play a role in defense against PVX infection. We now report that NbFD1 is downregulated by rice stripe virus (RSV) infection and that silencing of NbFD1 also facilitates RSV infection, while viral infection was inhibited in a transgenic line overexpressing NbFD1, indicating that NbFD1 also functions in defense against RSV infection. Next, a RSV-derived small interfering RNA was identified that contributes to the downregulation of FD1 transcripts. Further analysis showed that the abscisic acid (ABA) which accumulates in RSV-infected plants also represses NbFD1 transcription. It does this by stimulating expression of ABA insensitive 5 (ABI5), which binds the ABA response element motifs in the NbFD1 promoter, resulting in negative regulation. Regulation of FD1 by ABA was also confirmed in RSV-infected plants of the natural host rice. The results therefore suggest a mechanism by which virus regulates chloroplast-related genes to suppress their defense roles.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/tpj.15377DOI Listing
August 2021

Retraction Note: A Chinese herbal formula, Jian-Pi-Yi-Shen decoction, improves muscle atrophy via regulating mitochondrial quality control process in 5/6 nephrectomised rats.

Sci Rep 2021 Jun 14;11(1):12831. Epub 2021 Jun 14.

Department of Nephrology, Shenzhen Traditional Chinese Medicine Hospital, Guangzhou University of Chinese Medicine, Shenzhen, 518033, China.

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41598-021-91869-xDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8203609PMC
June 2021

Genome-Wide Identification Reveals That Hypersensitive Response (HR)-Like Lesion Inducing Protein 4 (NbHRLI4) Mediates Cell Death and Salicylic Acid-Dependent Defense Responses to Turnip Mosaic Virus.

Front Plant Sci 2021 25;12:627315. Epub 2021 May 25.

State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products, Key Laboratory of Biotechnology in Plant Protection of Ministry of Agriculture and Zhejiang Province, Institute of Plant Virology, Ningbo University, Ningbo, China.

Hypersensitive response (HR)-like cell death is an important mechanism that mediates the plant response to pathogens. In our previous study, we reported that NbHIR3s regulate HR-like cell death and basal immunity. However, the host genes involved in HR have rarely been studied. Here, we used transcriptome sequencing to identify , an HR-like lesion inducing protein (HRLI) in that was significantly reduced by turnip mosaic virus (TuMV). HRLIs are uncharacterized proteins which may regulate the HR process. We identified all six in and functionally analyzed , named , in response to TuMV. Silencing of increased TuMV accumulation, while overexpression of NbHRLI4 conferred resistance to TuMV. Transient overexpression of NbHRLI4 caused cell death with an increase in the expression of salicylic acid (SA) pathway genes but led to less cell death level and weaker immunity in plants expressing . Thus, we have characterized NbHRLI4 as an inducer of cell death and an antiviral regulator of TuMV infection in a SA-mediated manner.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fpls.2021.627315DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8185164PMC
May 2021

MPDZ as a novel epigenetic silenced tumor suppressor inhibits growth and progression of lung cancer through the Hippo-YAP pathway.

Oncogene 2021 Jul 9;40(26):4468-4485. Epub 2021 Jun 9.

Institute of Toxicology, College of Preventive Medicine, Third Military Medical University (Army Medical University), Chongqing, PR China.

MPDZ also named MUPP1 is involved in signal transduction mediated by the formation of protein complexes. However, the expression regulation, clinical significance, potential function, and mechanism of this gene in lung cancer remain unclear. Methylation status of MPDZ was measured by methylation-specific PCR and bisulfite genomic sequencing. Kaplan-Meier and Cox regression analyses were performed to identify the prognostic value of MPDZ. The tumor suppressing effects of MPDZ were determined in vitro and in vivo. The target molecules and signaling pathway that mediated the function of MPDZ were also identified. MPDZ methylation was identified in 61.2% of primary lung cancer tissues and most lung cancer cell lines but not in normal lung tissues. MPDZ expression was significantly downregulated in lung cancer tissues and negatively associated with DNA hypermethylation, and attenuated MPDZ expression predicted a poor outcome. Furthermore, MPDZ overexpression prominently dampened cell growth, migration, and invasion of tumor cells. Conversely, MPDZ knockdown promoted cell proliferation, migration, and invasion in vitro and in vivo. Moreover, MPDZ deficiency promotes tumor metastasis and reduces the survival of MPDZ knockout mice. Importantly, MPDZ promotes tumor suppressor ability that depends on the Hippo pathway-mediated repression of YAP. MPDZ activates the phosphorylation of YAP (Ser127) and inhibits YAP expression through stabilizing MST1 and interaction with LATS1. We first identified and validated that MPDZ methylation and expression could be a good diagnostic marker and independent prognostic factor for lung cancer. MPDZ functions as a tumor suppressor by inhibiting cell proliferation, migration, and invasion through regulating the Hippo-YAP signaling pathway.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41388-021-01857-8DOI Listing
July 2021

The effects of anticoagulant therapy re-initiation after gastrointestinal bleeding: A systematic review and meta-analysis.

J Clin Pharm Ther 2021 Jun 7. Epub 2021 Jun 7.

Department of Emergency, Dongyang people's Hospital of Zhejiang Province, Dongyang, China.

What Is Known And Objective: Long-term anticoagulant/antithrombotic therapy is widely used for the management of thromboembolic conditions. Gastrointestinal bleeding is a common collateral manifestation of anticoagulant/antithrombotic therapy that complicates its administration. The continuation or discontinuation of anticoagulant/antithrombotic therapy after an episode of gastrointestinal bleeding has been a matter of debate. Despite recent positive reports from retrospective cohort studies suggesting a reduction in morbidity- and mortality-related outcomes with continued administration of anticoagulant/antithrombotic agents (even after gastrointestinal bleeding), no consensus or comparisons about the efficacies of continued or discontinued antithrombotic administration exist. Therefore, we developed this current state-of-evidence analysis evaluating the comparative effects of continuation and discontinuation of anticoagulant/antithrombotic drugs after gastrointestinal bleeding on the overall incidences of gastrointestinal bleeding, thromboembolic events and mortality events.

Methods: We performed a systematic academic literature search according to the PRISMA guidelines across five databases: Web of Science, Embase, CENTRAL, Scopus and MEDLINE. Moreover, we conducted a random effect meta-analysis to compare the effects of continuation and discontinuation of anticoagulant/antithrombotic drugs after an event of gastrointestinal bleeding on the overall incidences of gastrointestinal bleeding, thromboembolic events and mortality events.

Results: We found seven eligible studies (from 1397 candidates) with 2532 participants (mean age, 73.1 ± 4.1 years). Our meta-analysis revealed lower odds of thromboembolic events (OR, -0.21), mortality outcomes (OR, -0.39) and an increase in the incidence of gastrointestinal bleeding (OR, 2.4) in the group with continued anticoagulant/antithrombotic therapy than in the group discontinuing the therapy.

What Is New And Conclusion: We provide an updated evidence on the comparative effects between continuation and discontinuation of anticoagulant/antithrombotic drugs after gastrointestinal bleeding events based on the overall incidences of gastrointestinal bleeding, thromboembolic events and mortality events. This study reports confirm an overall lower incidence of thromboembolic events and mortality outcomes for the continuation group than for the discontinuation group.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/jcpt.13442DOI Listing
June 2021

Comprehensive Proteomic Analysis of Lysine Acetylation in After Sensing CWMV Infection.

Front Microbiol 2021 17;12:672559. Epub 2021 May 17.

State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-products, Key Laboratory of Biotechnology in Plant Protection of Ministry of Agriculture and Zhejiang Province, Institute of Plant Virology, Ningbo University, Ningbo, China.

Protein lysine acetylation (Kac) is an important post-translational modification mechanism in eukaryotes that is involved in cellular regulation. To investigate the role of Kac in virus-infected plants, we characterized the lysine acetylome of plants with or without a Chinese wheat mosaic virus (CWMV) infection. We identified 4,803 acetylated lysine sites on 1,964 proteins. A comparison of the acetylation levels of the CWMV-infected group with those of the uninfected group revealed that 747 sites were upregulated on 422 proteins, including chloroplast localization proteins and histone H3, and 150 sites were downregulated on 102 proteins. Nineteen conserved motifs were extracted and 51 percent of the acetylated proteins located on chloroplast. Nineteen Kac sites were located on histone proteins, including 10 Kac sites on histone 3. Bioinformatics analysis results indicated that lysine acetylation occurs on a large number of proteins involved in biological processes, especially photosynthesis. Furthermore, we found that the acetylation level of chloroplast proteins, histone 3 and some metabolic pathway-related proteins were significantly higher in CWMV-infected plants than in uninfected plants. In summary, our results reveal the regulatory roles of Kac in response to CWMV infection.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fmicb.2021.672559DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8166574PMC
May 2021

Mitomycin C Inhibits Esophageal Fibrosis by Regulating Cell Apoptosis and Autophagy via lncRNA-ATB and miR-200b.

Front Mol Biosci 2021 17;8:675757. Epub 2021 May 17.

Department of Gastroenterology, The Third Affiliated Hospital of Soochow University, Changzhou, China.

Benign esophageal strictures (BESs) frequently results from esophageal fibrosis. The transformation of fibroblasts into fibrocyte is an important cause of fibrosis. The treatment of fibrosis is challenging. Some previous studies have indicated the antifibrotic effect of mitomycin C (MMC). However, the mechanism of action of MMC and its optimal dose for treatment remains unclear. In the present study, the role of MMC in fighting fibrosis and its mechanism was investigated. Human esophageal fibroblast cells (HEFs)were treated without or with MMC, at 2, 5, 10 μg/ml, combining with mimic lncRNA-ATB, miR-200b inhibitor, rapamycin (RAPA), and 3-Methyladenine (3-MA). The cell viability, and cell apoptosis were evaluated. In addition, expression of apoptosis related proteins (caspase8 and caspase3), autophagy related proteins (LC3II and ATG5) and fibrosis related proteins (α-SMA collagen-1 and TGF-β) were also evaluated. Furthermore, autophagosome was observed by transmission electron microscope. Results showed that the expression of lncRNA-ATB was down-regulated and miR-200b was up-regulated after treated with MMC. And MMC induced cell apoptosis and inhibited cell autophagy. On the other hand, RAPA, mimic lncRNA-ATB and miR-200b inhibitor reduced fibrogenic effect of MMC on HEFs. Collectively, this study suggests that MMC inhibited esophageal fibrosis by regulating cell apoptosis and autophagy via downregulating lncRNA-ATB and upregulating miR-200b.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fmolb.2021.675757DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8165251PMC
May 2021

Genetic diversity analysis of Chinese Leishmania isolates and development of L. donovani complex-specific markers by RAPD.

BMC Infect Dis 2021 May 21;21(1):464. Epub 2021 May 21.

Department of Parasitology, West China School of Basic Medical Sciences and Forensic Medicine, Sichuan University, Chengdu, 610041, China.

Background: Leishmaniasis is one of the most neglected tropical diseases in the world and remains endemic in some underdeveloped regions, including western China. The phylogeny and classification of Chinese Leishmania has not been completely clarified to date, especially within the Leishmania (L.) donovani complex, although phylogenetic analyses based on a series of gene markers have been performed. More analytic methods and data are still needed. Random amplified polymorphic DNA (RAPD) technology can sensitively identify slight intraspecific differences, and it is a powerful tool to seek species-specific markers. This work attempted to identify Chinese Leishmania isolates from diverse geographic regions at the genomic level. Meanwhile, specific markers of the L. donovani complex were also developed by RAPD.

Methods: RAPD was applied to 14 Chinese Leishmania isolates from diverse geographic regions and 3 WHO reference strains. The polymorphic sites of amplification were transformed into a data matrix, based on which genetic similarity was calculated, and a UPGMA dendrogram was constructed to analyse the genetic diversity of these Leishmania isolates. Meanwhile, the specific amplification loci of the L. donovani complex were TA-cloned, sequenced and converted into sequence characterized amplified region (SCAR) markers, which were validated preliminarily in 17 available Leishmania strains in this study and analysed by bioinformatics.

Results: The cluster analyses showed that the three Leishmania sp. isolates SC10H2, SD and GL clustered together and apart from others, the strains of the L. donovani complex clearly divided into two clades, and the three isolates Cy, WenChuan and 801 formed a subclade. Three specific SCAR markers of the L. donovani complex, i.e., 1-AD17, 2-A816 and 3-O13, were successfully obtained and validated on 17 available Leishmania strains in this study. Through bioinformatic analyses, Marker 1-AD17 may have more specificity for PCR detection of VL, and Marker 3-O13 has the potential to encode a protein.

Conclusions: The RAPD results verified that the undescribed Leishmania species causing visceral leishmaniasis (VL) in China was a unique clade distinguished from L. donovani and revealed that there was genetic differentiation among Chinese L. donovani. The identification of L. donovani-specific markers may help to provide a foundation for future research attempting to develop new specific diagnostic markers of VL and identify specific gene functions.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s12879-021-06163-yDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8140445PMC
May 2021

Establishment and validation of a predictive model for mortality within 30 days in patients with sepsis-induced blood pressure drop: A retrospective analysis.

PLoS One 2021 20;16(5):e0252009. Epub 2021 May 20.

Affiliated Dongyang Hospital of Wenzhou Medical University, Dongyang, Jinhua, Zhejiang Province, China.

Objectives: To establish and validate an individualized nomogram to predict the probability of death within 30 days in patients with sepsis-induced blood pressure drop would help clinical physicians to pay attention to those with higher risk of death after admission to wards.

Methods: A total of 1023 patients who were admitted to the Dongyang People's Hospital, China, enrolled in this study. They were divided into model group (717 patients) and validation group (306 patients). The study included 13 variables. The independent risk factors leading to death within 30 days were screened by univariate analyses and multivariate logistic regression analyses and used for Nomogram. The discrimination and correction of the prediction model were assessed by the area under the Receiver Operating Characteristic (ROC) curve and the calibration chart. The clinical effectiveness of the prediction model was assessed by the Decision Curve Analysis (DCA).

Results: Seven variables were independent risk factors, included peritonitis, respiratory failure, cardiac insufficiency, consciousness disturbance, tumor history, albumin level, and creatinine level at the time of admission. The area under the ROC curve of the model group and validation group was 0.834 and 0.836. The P value of the two sets of calibration charts was 0.702 and 0.866. The DCA curves of the model group and validation group were above the two extreme (insignificant) curves.

Conclusions: The model described in this study could effectively predict the death of patients with sepsis-induced blood pressure drop.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0252009PLOS
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8136670PMC
May 2021

Corrigendum: Identification of Two New Isolates of From Different Regions in China: Molecular Diversity, Phylogenetic and Recombination Analysis.

Front Microbiol 2021 19;12:670393. Epub 2021 Apr 19.

State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-products, Key Laboratory of Biotechnology in Plant Protection of Ministry of Agriculture and Zhejiang Province, Institute of Plant Virology, Ningbo University, Ningbo, China.

[This corrects the article DOI: 10.3389/fmicb.2020.616171.].
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fmicb.2021.670393DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8089474PMC
April 2021
-->