Publications by authors named "Jesse G Zalatan"

24 Publications

  • Page 1 of 1

Conditional Recruitment to a DNA-Bound CRISPR-Cas Complex Using a Colocalization-Dependent Protein Switch.

ACS Synth Biol 2020 09 20;9(9):2316-2323. Epub 2020 Aug 20.

To spatially control biochemical functions at specific sites within a genome, we have engineered a synthetic switch that activates when bound to its DNA target site. The system uses two CRISPR-Cas complexes to colocalize components of a -designed protein switch (Co-LOCKR) to adjacent sites in the genome. Colocalization triggers a conformational change in the switch from an inactive closed state to an active open state with an exposed functional peptide. We prototype the system in yeast and demonstrate that DNA binding triggers activation of the switch, recruitment of a transcription factor, and expression of a downstream reporter gene. This DNA-triggered Co-LOCKR switch provides a platform to engineer sophisticated functions that should only be executed at a specific target site within the genome, with potential applications in a wide range of synthetic systems including epigenetic regulation, imaging, and genetic logic circuits.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acssynbio.0c00012DOI Listing
September 2020

Challenges and opportunities with CRISPR activation in bacteria for data-driven metabolic engineering.

Curr Opin Biotechnol 2020 08 27;64:190-198. Epub 2020 Jun 27.

Department of Chemical Engineering, University of Washington. Seattle, WA 98195, United States. Electronic address:

Creating CRISPR gene activation (CRISPRa) technologies in industrially promising bacteria could be transformative for accelerating data-driven metabolic engineering and strain design. CRISPRa has been widely used in eukaryotes, but applications in bacterial systems have remained limited. Recent work shows that multiple features of bacterial promoters impose stringent requirements on CRISPRa-mediated gene activation. However, by systematically defining rules for effective bacterial CRISPRa sites and developing new approaches for encoding complex functions in engineered guide RNAs, there are now clear routes to generalize synthetic gene regulation in bacteria. When combined with multi-omics data collection and machine learning, the full development of bacterial CRISPRa will dramatically improve the ability to rapidly engineer bacteria for bioproduction through accelerated design-build-test-learn cycles.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.copbio.2020.04.005DOI Listing
August 2020

The Scaffold Protein Axin Promotes Signaling Specificity within the Wnt Pathway by Suppressing Competing Kinase Reactions.

Cell Syst 2020 06 17;10(6):515-525.e5. Epub 2020 Jun 17.

Department of Chemistry, University of Washington, Seattle, WA 98195, USA. Electronic address:

Scaffold proteins are thought to promote signaling specificity by accelerating reactions between bound kinase and substrate proteins. To test the long-standing hypothesis that the scaffold protein Axin accelerates glycogen synthase kinase 3β (GSK3β)-mediated phosphorylation of β-catenin in the Wnt signaling network, we measured GSK3β reaction rates with multiple substrates in a minimal, biochemically reconstituted system. We observed an unexpectedly small, ∼2-fold Axin-mediated rate increase for the β-catenin reaction when measured in isolation. In contrast, when both β-catenin and non-Wnt pathway substrates are present, Axin accelerates the β-catenin reaction by preventing competition with alternative substrates. At high competitor concentrations, Axin produces >10-fold rate effects. Thus, while Axin alone does not markedly accelerate the β-catenin reaction, in physiological settings where multiple GSK3β substrates are present, Axin may promote signaling specificity by suppressing interactions with competing, non-Wnt pathway targets. This mechanism for scaffold-mediated control of competition enables a shared kinase to perform distinct functions in multiple signaling networks.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.cels.2020.05.002DOI Listing
June 2020

The Relationship between Effective Molarity and Affinity Governs Rate Enhancements in Tethered Kinase-Substrate Reactions.

Biochemistry 2020 06 1;59(23):2182-2193. Epub 2020 Jun 1.

Department of Chemistry, University of Washington, Seattle, Washington 98195, United States.

Scaffold proteins are thought to accelerate protein phosphorylation reactions by tethering kinases and substrates together, but there is little quantitative data on their functional effects. To assess the contribution of tethering to kinase reactivity, we compared intramolecular and intermolecular kinase reactions in a minimal model system. We found that tethering can enhance reaction rates in a flexible tethered kinase system and that the magnitude of the effect is sensitive to the structure of the tether. The largest effective molarity we obtained was ∼0.08 μM, which is much lower than the effects observed in small molecule model systems and other tethered protein reactions. We further demonstrated that the tethered intramolecular reaction only makes a significant contribution to the observed rates when the scaffolded complex assembles at concentrations below the effective molarity. These findings provide a quantitative framework that can be applied to understand endogenous protein scaffolds and engineer synthetic networks.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acs.biochem.0c00205DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7328773PMC
June 2020

Effective CRISPRa-mediated control of gene expression in bacteria must overcome strict target site requirements.

Nat Commun 2020 04 1;11(1):1618. Epub 2020 Apr 1.

Department of Chemistry, University of Washington, Seattle, 98195, WA, USA.

In bacterial systems, CRISPR-Cas transcriptional activation (CRISPRa) has the potential to dramatically expand our ability to regulate gene expression, but we lack predictive rules for designing effective gRNA target sites. Here, we identify multiple features of bacterial promoters that impose stringent requirements on CRISPRa target sites. Notably, we observe narrow, 2-4 base windows of effective sites with a periodicity corresponding to one helical turn of DNA, spanning ~40 bases and centered ~80 bases upstream of the TSS. However, we also identify two features suggesting the potential for broad scope: CRISPRa is effective at a broad range of σ-family promoters, and an expanded PAM dCas9 allows the activation of promoters that cannot be activated by S. pyogenes dCas9. These results provide a roadmap for future engineering efforts to further expand and generalize the scope of bacterial CRISPRa.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41467-020-15454-yDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7113249PMC
April 2020

CRISPR-Cas-Mediated Chemical Control of Transcriptional Dynamics in Yeast.

Chembiochem 2019 06 26;20(12):1519-1523. Epub 2019 Apr 26.

Department of Chemistry, University of Washington, 36 Bagley Hall, Seattle, WA, 98195, USA.

Synthetic CRISPR-Cas transcription factors enable the construction of complex gene-expression programs, and chemically inducible systems allow precise control over the expression dynamics. To provide additional modes of regulatory control, we have constructed a chemically inducible CRISPR activation (CRISPRa) system in yeast that is mediated by recruitment to MS2-functionalized guide RNAs. We use reporter gene assays to systematically map the dose dependence, time dependence, and reversibility of the system. Because the recruitment function is encoded at the level of the guide RNA, it is straightforward to target multiple genes and independently regulate expression dynamics at individual targets. This approach provides a new method to engineer sophisticated, multigene programs with precise control over the dynamics of gene expression.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/cbic.201800823DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6570556PMC
June 2019

Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

Nat Commun 2018 10 15;9(1):4318. Epub 2018 Oct 15.

Department of Chemistry, University of Washington, Seattle, WA, 98195, USA.

In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41467-018-06909-4DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6189203PMC
October 2018

Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

Nat Commun 2018 06 27;9(1):2489. Epub 2018 Jun 27.

Department of Chemistry, University of Washington, Seattle, WA, 98195, USA.

Methods to regulate gene expression programs in bacterial cells are limited by the absence of effective gene activators. To address this challenge, we have developed synthetic bacterial transcriptional activators in E. coli by linking activation domains to programmable CRISPR-Cas DNA binding domains. Effective gene activation requires target sites situated in a narrow region just upstream of the transcription start site, in sharp contrast to the relatively flexible target site requirements for gene activation in eukaryotic cells. Together with existing tools for CRISPRi gene repression, these bacterial activators enable programmable control over multiple genes with simultaneous activation and repression. Further, the entire gene expression program can be switched on by inducing expression of the CRISPR-Cas system. This work will provide a foundation for engineering synthetic bacterial cellular devices with applications including diagnostics, therapeutics, and industrial biosynthesis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41467-018-04901-6DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6021436PMC
June 2018

Prospects for engineering dynamic CRISPR-Cas transcriptional circuits to improve bioproduction.

J Ind Microbiol Biotechnol 2018 Jul 8;45(7):481-490. Epub 2018 May 8.

Molecular Engineering and Sciences Institute and Center for Synthetic Biology, University of Washington, Seattle, WA, 98195, USA.

Dynamic control of gene expression is emerging as an important strategy for controlling flux in metabolic pathways and improving bioproduction of valuable compounds. Integrating dynamic genetic control tools with CRISPR-Cas transcriptional regulation could significantly improve our ability to fine-tune the expression of multiple endogenous and heterologous genes according to the state of the cell. In this mini-review, we combine an analysis of recent literature with examples from our own work to discuss the prospects and challenges of developing dynamically regulated CRISPR-Cas transcriptional control systems for applications in synthetic biology and metabolic engineering.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s10295-018-2039-zDOI Listing
July 2018

Regulated Expression of sgRNAs Tunes CRISPRi in E. coli.

Biotechnol J 2018 Sep 11;13(9):e1800069. Epub 2018 May 11.

Molecular Engineering and Sciences Institute, University of Washington, Seattle, WA, 98195, USA.

Methods for implementing dynamically-controlled multi-gene programs could expand capabilities to engineer metabolism for efficiently producing high-value compounds. This work explores whether CRISPRi repression can be tuned in E. coli through the regulated expression of the CRISPRi machinery. When dCas9 is not limiting, variations in sgRNA expression alone can lead to CRISPRi repression levels ranging from 5- to 300-fold. Titrating sgRNA expression over a 2.5-fold range results in 16-fold changes in reporter gene expression. Many different classes of genetic controllers can generate 2.5-fold differences in transcription, suggesting they may be integrated into dynamically-regulated CRISPRi circuits. Finally, CRISPRi cannot be reversed for up to 12 hours by expressing a competing sgRNA later in the growth phase, indicating that CRISPR-Cas:DNA interactions can be persistent in vivo. Collectively, these results identify genetic architectures for tuning CRISPRi repression through regulated sgRNA expression and suggest that dynamically-regulated CRISPRi systems targeting multiple genes may be within reach.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/biot.201800069DOI Listing
September 2018

Additive Manufacturing of Catalytically Active Living Materials.

ACS Appl Mater Interfaces 2018 Apr 10;10(16):13373-13380. Epub 2018 Apr 10.

Department of Chemistry , University of Washington , Box 351700, Seattle , Washington 98195 , United States.

Living materials, which are composites of living cells residing in a polymeric matrix, are designed to utilize the innate functionalities of the cells to address a broad range of applications such as fermentation and biosensing. Herein, we demonstrate the additive manufacturing of catalytically active living materials (AMCALM) for continuous fermentation. A multi-stimuli-responsive yeast-laden hydrogel ink, based on F127-dimethacrylate, was developed and printed using a direct-write 3D printer. The reversible stimuli-responsive behaviors of the polymer hydrogel inks to temperature and pressure are critical, as they enabled the facile incorporation of yeast cells and subsequent fabrication of 3D lattice constructs. Subsequent photo-cross-linking of the printed polymer hydrogel afforded a robust elastic material. These yeast-laden living materials were metabolically active in the fermentation of glucose into ethanol for 2 weeks in a continuous batch process without significant reduction in efficiency (∼90% yield of ethanol). This cell immobilization platform may potentially be applicable toward other genetically modified yeast strains to produce other high-value chemicals in a continuous biofermentation process.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsami.8b02719DOI Listing
April 2018

CRISPR-Cas RNA Scaffolds for Transcriptional Programming in Yeast.

Authors:
Jesse G Zalatan

Methods Mol Biol 2017 ;1632:341-357

Department of Chemistry, University of Washington, 36 Bagley Hall, Seattle, WA, 98195, USA.

CRISPR scaffold RNAs (scRNAs) provide a modular system for locus-specific transcriptional programming. scRNAs are generated by extending CRISPR guide RNA sequences with domains that recruit RNA-binding proteins, thus physically linking DNA binding and protein recruitment activities. A single scRNA molecule encodes information about the target locus and instructions about what regulatory function to execute at that locus. Sets of scRNA constructs can be used to generate synthetic multigene transcriptional programs in which some genes are activated and others are repressed. Such programs can be executed by inducing expression of the dCas9 protein, which acts as a single master regulatory control point, and this approach has been recently applied to flexibly redirect flux through a complex branched metabolic pathway in yeast. This protocol describes how to construct multi-scRNA transcriptional programs in yeast, including target site selection, cloning strategies, and yeast engineering.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/978-1-4939-7138-1_22DOI Listing
April 2018

Engineering complex synthetic transcriptional programs with CRISPR RNA scaffolds.

Cell 2015 Jan 18;160(1-2):339-50. Epub 2014 Dec 18.

Department of Cellular and Molecular Pharmacology, University of California San Francisco, San Francisco, CA 94158, USA; Howard Hughes Medical Institute, University of California San Francisco, San Francisco, CA 94158, USA; UCSF Center for Systems and Synthetic Biology, University of California San Francisco, San Francisco, CA 94158, USA; California Institute for Quantitative Biomedical Research, San Francisco, CA 94158, USA. Electronic address:

Eukaryotic cells execute complex transcriptional programs in which specific loci throughout the genome are regulated in distinct ways by targeted regulatory assemblies. We have applied this principle to generate synthetic CRISPR-based transcriptional programs in yeast and human cells. By extending guide RNAs to include effector protein recruitment sites, we construct modular scaffold RNAs that encode both target locus and regulatory action. Sets of scaffold RNAs can be used to generate synthetic multigene transcriptional programs in which some genes are activated and others are repressed. We apply this approach to flexibly redirect flux through a complex branched metabolic pathway in yeast. Moreover, these programs can be executed by inducing expression of the dCas9 protein, which acts as a single master regulatory control point. CRISPR-associated RNA scaffolds provide a powerful way to construct synthetic gene expression programs for a wide range of applications, including rewiring cell fates or engineering metabolic pathways.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.cell.2014.11.052DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4297522PMC
January 2015

Probing the origins of catalytic discrimination between phosphate and sulfate monoester hydrolysis: comparative analysis of alkaline phosphatase and protein tyrosine phosphatases.

Biochemistry 2014 Nov 23;53(43):6811-9. Epub 2014 Oct 23.

Department of Chemical and Systems Biology, ‡Department of Chemistry, and §Department of Biochemistry, Stanford University , Stanford, California 94305-5307, United States.

Catalytic promiscuity, the ability of enzymes to catalyze multiple reactions, provides an opportunity to gain a deeper understanding of the origins of catalysis and substrate specificity. Alkaline phosphatase (AP) catalyzes both phosphate and sulfate monoester hydrolysis reactions with a ∼10(10)-fold preference for phosphate monoester hydrolysis, despite the similarity between these reactions. The preponderance of formal positive charge in the AP active site, particularly from three divalent metal ions, was proposed to be responsible for this preference by providing stronger electrostatic interactions with the more negatively charged phosphoryl group versus the sulfuryl group. To test whether positively charged metal ions are required to achieve a high preference for the phosphate monoester hydrolysis reaction, the catalytic preference of three protein tyrosine phosphatases (PTPs), which do not contain metal ions, were measured. Their preferences ranged from 5 × 10(6) to 7 × 10(7), lower than that for AP but still substantial, indicating that metal ions and a high preponderance of formal positive charge within the active site are not required to achieve a strong catalytic preference for phosphate monoester over sulfate monoester hydrolysis. The observed ionic strength dependences of kcat/KM values for phosphate and sulfate monoester hydrolysis are steeper for the more highly charged phosphate ester with both AP and the PTP Stp1, following the dependence expected based on the charge difference of these two substrates. However, the dependences for AP were not greater than those of Stp1 and were rather shallow for both enzymes. These results suggest that overall electrostatics from formal positive charge within the active site is not the major driving force in distinguishing between these reactions and that substantial discrimination can be attained without metal ions. Thus, local properties of the active site, presumably including multiple positioned dipolar hydrogen bond donors within the active site, dominate in defining this reaction specificity.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/bi500765pDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4222534PMC
November 2014

Conformational control of the Ste5 scaffold protein insulates against MAP kinase misactivation.

Science 2012 Sep 9;337(6099):1218-22. Epub 2012 Aug 9.

Department of Cellular and Molecular Pharmacology, University of California, San Francisco, 600 16th Street, San Francisco, CA 94158, USA.

Cells reuse signaling proteins in multiple pathways, raising the potential for improper cross talk. Scaffold proteins are thought to insulate against such miscommunication by sequestering proteins into distinct physical complexes. We show that the scaffold protein Ste5, which organizes the yeast mating mitogen-activated protein kinase (MAPK) pathway, does not use sequestration to prevent misactivation of the mating response. Instead, Ste5 appears to use a conformation mechanism: Under basal conditions, an intramolecular interaction of the pleckstrin homology (PH) domain with the von Willebrand type A (VWA) domain blocks the ability to coactivate the mating-specific MAPK Fus3. Pheromone-induced membrane binding of Ste5 triggers release of this autoinhibition. Thus, in addition to serving as a conduit guiding kinase communication, Ste5 directly receives input information to decide if and when signal can be transmitted to mating output.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1126/science.1220683DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3631425PMC
September 2012

Scaffold proteins: hubs for controlling the flow of cellular information.

Science 2011 May;332(6030):680-6

Department of Cellular and Molecular Pharmacology, University of California, San Francisco, CA 94158, USA.

The spatial and temporal organization of molecules within a cell is critical for coordinating the many distinct activities carried out by the cell. In an increasing number of biological signaling processes, scaffold proteins have been found to play a central role in physically assembling the relevant molecular components. Although most scaffolds use a simple tethering mechanism to increase the efficiency of interaction between individual partner molecules, these proteins can also exert complex allosteric control over their partners and are themselves the target of regulation. Scaffold proteins offer a simple, flexible strategy for regulating selectivity in pathways, shaping output behaviors, and achieving new responses from preexisting signaling components. As a result, scaffold proteins have been exploited by evolution, pathogens, and cellular engineers to reshape cellular behavior.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1126/science.1198701DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3117218PMC
May 2011

Biological phosphoryl-transfer reactions: understanding mechanism and catalysis.

Annu Rev Biochem 2011 ;80:669-702

Department of Biochemistry, Stanford University, Stanford, California 94305, USA.

Phosphoryl-transfer reactions are central to biology. These reactions also have some of the slowest nonenzymatic rates and thus require enormous rate accelerations from biological catalysts. Despite the central importance of phosphoryl transfer and the fascinating catalytic challenges it presents, substantial confusion persists about the properties of these reactions. This confusion exists despite decades of research on the chemical mechanisms underlying these reactions. Here we review phosphoryl-transfer reactions with the goal of providing the reader with the conceptual and experimental background to understand this body of work, to evaluate new results and proposals, and to apply this understanding to enzymes. We describe likely resolutions to some controversies, while emphasizing the limits of our current approaches and understanding. We apply this understanding to enzyme-catalyzed phosphoryl transfer and provide illustrative examples of how this mechanistic background can guide and deepen our understanding of enzymes and their mechanisms of action. Finally, we present important future challenges for this field.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1146/annurev-biochem-060409-092741DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3418923PMC
October 2011

The far reaches of enzymology.

Nat Chem Biol 2009 Aug;5(8):516-20

Department of Cellular and Molecular Pharmacology, University of California, San Francisco, California, USA.

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/nchembio0809-516DOI Listing
August 2009

Comparative enzymology in the alkaline phosphatase superfamily to determine the catalytic role of an active-site metal ion.

J Mol Biol 2008 Dec 2;384(5):1174-89. Epub 2008 Oct 2.

Department of Chemistry, Stanford University, Beckman Center B400, Stanford, CA 94305, USA.

Mechanistic models for biochemical systems are frequently proposed from structural data. Site-directed mutagenesis can be used to test the importance of proposed functional sites, but these data do not necessarily indicate how these sites contribute to function. In this study, we applied an alternative approach to the catalytic mechanism of alkaline phosphatase (AP), a widely studied prototypical bimetallo enzyme. A third metal ion site in AP has been suggested to provide general base catalysis, but comparison of AP with an evolutionarily related enzyme casts doubt on this model. Removal of this metal site from AP has large differential effects on reactions of cognate and promiscuous substrates, and the results are inconsistent with general base catalysis. Instead, these and additional results suggest that the third metal ion stabilizes the transferred phosphoryl group in the transition state. These results establish a new mechanistic model for this prototypical bimetallo enzyme and demonstrate the power of a comparative approach for probing biochemical function.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jmb.2008.09.059DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2622731PMC
December 2008

Arginine coordination in enzymatic phosphoryl transfer: evaluation of the effect of Arg166 mutations in Escherichia coli alkaline phosphatase.

Biochemistry 2008 Jul;47(29):7663-72

Department of Biochemistry, Stanford University, Stanford, California 94305, USA.

Arginine residues are commonly found in the active sites of enzymes catalyzing phosphoryl transfer reactions. Numerous site-directed mutagenesis experiments establish the importance of these residues for efficient catalysis, but their role in catalysis is not clear. To examine the role of arginine residues in the phosphoryl transfer reaction, we have measured the consequences of mutations to arginine 166 in Escherichia coli alkaline phosphatase on hydrolysis of ethyl phosphate, on individual reaction steps in the hydrolysis of the covalent enzyme-phosphoryl intermediate, and on thio substitution effects. The results show that the role of the arginine side chain extends beyond its positive charge, as the Arg166Lys mutant is as compromised in activity as Arg166Ser. Through measurement of individual reaction steps, we construct a free energy profile for the hydrolysis of the enzyme-phosphate intermediate. This analysis indicates that the arginine side chain strengthens binding by approximately 3 kcal/mol and provides an additional 1-2 kcal/mol stabilization of the chemical transition state. A 2.1 A X-ray diffraction structure of Arg166Ser AP is presented, which shows little difference in enzyme structure compared to the wild-type enzyme but shows a significant reorientation of the bound phosphate. Altogether, these results support a model in which the arginine contributes to catalysis through binding interactions and through additional transition state stabilization that may arise from complementarity of the guanidinum group to the geometry of the trigonal bipyramidal transition state.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/bi800545nDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2587100PMC
July 2008

Kinetic isotope effects for alkaline phosphatase reactions: implications for the role of active-site metal ions in catalysis.

J Am Chem Soc 2007 Aug 14;129(31):9789-98. Epub 2007 Jul 14.

Department of Chemistry, Stanford University, Stanford, California 94305, USA.

Enzyme-catalyzed phosphoryl transfer reactions have frequently been suggested to proceed through transition states that are altered from their solution counterparts, with the alterations presumably arising from interactions with active-site functional groups. In particular, the phosphate monoester hydrolysis reaction catalyzed by Escherichia coli alkaline phosphatase (AP) has been the subject of intensive scrutiny. Recent linear free energy relationship (LFER) studies suggest that AP catalyzes phosphate monoester hydrolysis through a loose transition state, similar to that in solution. To gain further insight into the nature of the transition state and active-site interactions, we have determined kinetic isotope effects (KIEs) for AP-catalyzed hydrolysis reactions with several phosphate monoester substrates. The LFER and KIE data together provide a consistent picture for the nature of the transition state for AP-catalyzed phosphate monoester hydrolysis and support previous models suggesting that the enzymatic transition state is similar to that in solution. Moreover, the KIE data provides unique information regarding specific interactions between the transition state and the active-site Zn2+ ions. These results provide strong support for a model in which electrostatic interactions between the bimetallo Zn2+ site and a nonbridging phosphate ester oxygen atom make a significant contribution to the large rate enhancement observed for AP-catalyzed phosphate monoester hydrolysis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/ja072196+DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3171187PMC
August 2007

Probing the origin of the compromised catalysis of E. coli alkaline phosphatase in its promiscuous sulfatase reaction.

J Am Chem Soc 2007 May 6;129(17):5760-5. Epub 2007 Apr 6.

Department of Chemical Engineering, Stanford University, Stanford, California 94305, USA.

The catalytic promiscuity of E. coli alkaline phosphatase (AP) and many other enzymes provides a unique opportunity to dissect the origin of enzymatic rate enhancements via a comparative approach. Here, we use kinetic isotope effects (KIEs) to explore the origin of the 109-fold greater catalytic proficiency by AP for phosphate monoester hydrolysis relative to sulfate monoester hydrolysis. The primary 18O KIEs for the leaving group oxygen atoms in the AP-catalyzed hydrolysis of p-nitrophenyl phosphate (pNPP) and p-nitrophenylsulfate (pNPS) decrease relative to the values observed for nonenzymatic hydrolysis reactions. Prior linear free energy relationship results suggest that the transition states for AP-catalyzed reactions of phosphate and sulfate esters are "loose" and indistinguishable from that in solution, suggesting that the decreased primary KIEs do not reflect a change in the nature of the transition state but rather a strong interaction of the leaving group oxygen atom with an active site Zn2+ ion. Furthermore, the primary KIEs for the two reactions are identical within error, suggesting that the differential catalysis of these reactions cannot be attributed to differential stabilization of the leaving group. In contrast, AP perturbs the KIE for the nonbridging oxygen atoms in the reaction of pNPP but not pNPS, suggesting a differential interaction with the transferred group in the transition state. These and prior results are consistent with a strong electrostatic interaction between the active site bimetallo Zn2+ cluster and one of the nonbridging oxygen atoms on the transferred group. We suggest that the lower charge density of this oxygen atom on a transferred sulfuryl group accounts for a large fraction of the decreased stabilization of the transition state for its reaction relative to phosphoryl transfer.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/ja069111+DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2532492PMC
May 2007

Structural and functional comparisons of nucleotide pyrophosphatase/phosphodiesterase and alkaline phosphatase: implications for mechanism and evolution.

Biochemistry 2006 Aug;45(32):9788-803

Department of Chemistry, Stanford University, Stanford, California 94305-5307, USA.

The rapid expansion of the amount of genomic and structural data has provided many examples of enzymes with evolutionarily related active sites that catalyze different reactions. Functional comparisons of these active sites can provide insight into the origins of the enormous catalytic proficiency of enzymes and the evolutionary changes that can lead to different enzyme activities. The alkaline phosphatase (AP) superfamily is an ideal system to use in making such comparisons given the extensive data available on both nonenzymatic and enzymatic phosphoryl transfer reactions. Some superfamily members, such as AP itself, preferentially hydrolyze phosphate monoesters, whereas others, such as nucleotide pyrophosphatase/phosphodiesterase (NPP), preferentially hydrolyze phosphate diesters. We have measured rate constants for NPP-catalyzed hydrolysis of phosphate diesters and monoesters. NPP preferentially catalyzes diester hydrolysis by factors of 10(2)-10(6), depending on the identity of the diester substrate. To identify features of the NPP active site that could lead to preferential phosphate diester hydrolysis, we have determined the structure of NPP in the absence of ligands and in complexes with vanadate and AMP. Comparisons to existing structures of AP reveal bimetallo cores that are structurally indistinguishable, but there are several distinct structural features outside of the conserved bimetallo site. The structural and functional data together suggest that some of these distinct functional groups provide specific substrate binding interactions, whereas others tune the properties of the bimetallo active site itself to discriminate between phosphate diester and monoester substrates.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/bi060847tDOI Listing
August 2006

Alkaline phosphatase mono- and diesterase reactions: comparative transition state analysis.

J Am Chem Soc 2006 Feb;128(4):1293-303

Department of Chemistry, Stanford University, California 94305, USA.

Enzyme-catalyzed phosphoryl transfer reactions have frequently been suggested to proceed through transition states that are altered from their solution counterparts. Previous work with Escherichia coli alkaline phosphatase (AP), however, suggests that this enzyme catalyzes the hydrolysis of phosphate monoesters through a loose, dissociative transition state, similar to that in solution. AP also exhibits catalytic promiscuity, with a low level of phosphodiesterase activity, despite the tighter, more associative transition state for phosphate diester hydrolysis in solution. Because AP is evolutionarily optimized for phosphate monoester hydrolysis, it is possible that the active site environment alters the transition state for diester hydrolysis to be looser in its bonding to the incoming and outgoing groups. To test this possibility, we have measured the nonenzymatic and AP-catalyzed rate of reaction for a series of substituted methyl phenyl phosphate diesters. The values of beta(lg) and additional data suggest that the transition state for AP-catalyzed phosphate diester hydrolysis is indistinguishable from that in solution. Instead of altering transition state structure, AP catalyzes phosphoryl transfer reactions by recognizing and stabilizing transition states similar to those in aqueous solution. The AP active site therefore has the ability to recognize different transition states, a property that could assist in the evolutionary optimization of promiscuous activities.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/ja056528rDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2538955PMC
February 2006