Publications by authors named "Hua Sun"

365 Publications

Co-evolution of tumor and immune cells during progression of multiple myeloma.

Nat Commun 2021 05 7;12(1):2559. Epub 2021 May 7.

Department of Medicine, Washington University in St. Louis, St. Louis, MO, USA.

Multiple myeloma (MM) is characterized by the uncontrolled proliferation of plasma cells. Despite recent treatment advances, it is still incurable as disease progression is not fully understood. To investigate MM and its immune environment, we apply single cell RNA and linked-read whole genome sequencing to profile 29 longitudinal samples at different disease stages from 14 patients. Here, we collect 17,267 plasma cells and 57,719 immune cells, discovering patient-specific plasma cell profiles and immune cell expression changes. Patients with the same genetic alterations tend to have both plasma cells and immune cells clustered together. By integrating bulk genomics and single cell mapping, we track plasma cell subpopulations across disease stages and find three patterns: stability (from precancer to diagnosis), and gain or loss (from diagnosis to relapse). In multiple patients, we detect "B cell-featured" plasma cell subpopulations that cluster closely with B cells, implicating their cell of origin. We validate AP-1 complex differential expression (JUN and FOS) in plasma cell subpopulations using CyTOF-based protein assays, and integrated analysis of single-cell RNA and CyTOF data reveals AP-1 downstream targets (IL6 and IL1B) potentially leading to inflammation regulation. Our work represents a longitudinal investigation for tumor and microenvironment during MM progression and paves the way for expanding treatment options.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41467-021-22804-xDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8105337PMC
May 2021

New triterpenoid saponins from the leaves of Ilex chinensis and their hepatoprotective activity.

Chin J Nat Med 2021 May;19(5):376-384

State Key Laboratory of Bioactive Substance and Function of Natural Medicines, Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China. Electronic address:

Seven new triterpenoid saponins, including five ursane-type saponins, ilexchinenosides R-V (1-5), and two oleanane-type saponins, ilexchinenosides W-X (6-7), with four known triterpenoid saponins (8-11) were isolated from the leaves of Ilex chinensis. Their structures were elucidated by comprehensive spectroscopic 1D and 2D NMR and HR-ESI-MS data. Their sugar moieties were determined by HPLC analysis compared with standards after hydrolysis and derivatization. Compounds 1, 2, 4, 9 and 10 exhibited potential hepatoprotective activity against N-acetyl-p-aminophenol (APAP)-induced HepG2 cell injury in vitro.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/S1875-5364(21)60036-5DOI Listing
May 2021

Estimating the aboveground biomass of coniferous forest in Northeast China using spectral variables, land surface temperature and soil moisture.

Sci Total Environ 2021 Apr 24;785:147335. Epub 2021 Apr 24.

Research Center of Forestry Remote Sensing and Information Engineering, Central South University of Forestry and Technology, Changsha, China; Key Laboratory of Forestry Remote Sensing Based Big Data and Ecological Security for Hunan Province, Changsha, China; Key Laboratory of National Forestry and Grassland Administration on Forest Resources Management and Monitoring in Southern Area, Changsha, China. Electronic address:

As a crucial indicator of forest growth and quality, estimating aboveground biomass (AGB) plays a key role in monitoring the global carbon cycle and forest health assessments. Novel methods and applications in remote sensing technology can greatly reduce the investigation time and cost and therefore have the potential to efficiently estimate AGB. Random forest (RF), combined with remote sensing images, is a popular machine learning method that has been widely used for AGB estimation. However, the accuracy of the ordinary linear variable selection method in the AGB estimation of coniferous forests is challenging due to the complexity of these forest biomes. In this study, spectral variables (spectral reflectance and vegetation index), land surface temperature (LST) and soil moisture were extracted from the operational land imager (OLI) and thermal infrared sensor (TIRS) of Landsat 8, and optimized RF regressions were established to estimate the AGB of coniferous forests in the Wangyedian forest farm, Inner Mongolia, Northeast China. We applied one linear (Pearson correlation coefficient (PC)) and four nonlinear (Kendall's τ coefficient (KC), Spearman coefficient (SC), distance correlation coefficient (DC) and the importance index) indices to select variables and establish optimized RF regressions for AGB estimation. The results showed that all the nonlinear indices provided significantly lower estimation errors than the linear index, in which the minimum root mean square error (RMSE) of 40.92 Mg/ha was obtained by the importance index in the nonlinear indices. In addition, the inclusion of LST and soil moisture significantly improved AGB estimation. The RMSE of the models constructed through the five indices decreased by 12.93%, 7.31%, 8.33%, 6.28% and 10.78%, respectively, following the application of the LST variable. In particular, when LST and soil moisture were both added into the model, the RMSE decreased by 31.47%. This study demonstrates that combining the nonlinear variable selection method with optimized RF regression can improve the efficiency of AGB estimation to support regional forest resource management and monitoring.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.scitotenv.2021.147335DOI Listing
April 2021

A Multicarbohydrase and Phytase Complex Is Able to Compensate a Nutrient-Deficiency in Growing-Finishing Pigs.

Animals (Basel) 2021 Apr 15;11(4). Epub 2021 Apr 15.

Department of Animal Nutrition and Feed Science, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, China.

The objective of this study was to evaluate the efficacy of supplementing a corn-wheat-soybean meal-based diet with a multicarbohydrase and phytase complex (MCPC) on growth performance, apparent total tract digestibility (ATTD) of nutrients, carcass traits, and meat quality in growing-finishing pigs. A total of 300 pigs (Duroc × Large White × Landrace; body weight = 25.3 ± 0.7 kg) were randomly allotted to three groups with 10 replicates of 10 pigs each. Pigs from three groups were fed positive control (PC) or negative control (NC), without or with MCPC diets, respectively. The MCPC supplied at least 1800, 1244, 6600, and 1000 units of xylanase, β-glucanase, α-arabinofuranosidase, and phytase per kilogram of diet, respectively. The NC diet was the PC diet but reduced in net energy (NE), digestible amino acids (dig. AA), digestible P (dig. P), and Ca by 74 kcal/kg, 7.0%, 0.134, and 0.119 percentage points, respectively. The diets were fed in 4 growth phases based on body weight (BW): phase 1: 25-50 kg, phase 2: 50-75 kg, phase 3: 75-100 kg, and phase 4: 100-135 kg. Compared to the PC, the NC diet decreased ( < 0.05) body weight gain, feed intake, and(or) feed to gain ratio during the growing/finishing phases 1, 2, 3, and 4. It also reduced ( < 0.05) the ATTD of crude protein, crude fat, P, and Ca of pigs. MCPC supplementation improved ( < 0.05) the body weight gain, feed intake, and(or) feed to gain ratio in phases 2, 3, and 4 and the ATTD of crude protein, crude fat, ash, P, and Ca for the NC diet. Additionally, dietary treatment had no effects on carcass traits and meat quality with the exception that the loin eye area in the NC plus MCPC diet was higher ( < 0.05) than the NC diet. In conclusion, the addition of MCPC to a corn-soybean meal-wheat-based diet reduced in energy and nutrients improved the growth performance and nutrient digestibility but had little effect on carcass traits and meat quality in growing-finishing pigs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/ani11041129DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8071171PMC
April 2021

Association between Vitamin D Levels and the Risk of Metabolic Syndrome in a Rural Chinese Population.

Biomed Environ Sci 2021 Apr;34(4):330-333

Department of Nutrition and Food Hygiene, College of Public Health of Zhengzhou University, Zhengzhou 450001, Henan, China.

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3967/bes2021.043DOI Listing
April 2021

Random sperm DNA fragmentation index is not associated with clinical outcomes in day-3 frozen embryo transfer.

Asian J Androl 2021 Apr 6. Epub 2021 Apr 6.

Center of Reproductive Medicine, the Affiliated Hospital of Nantong University, Nantong 226001, China.

Damage to sperm DNA was proposed to play an important role in embryonic development. Previous studies focused on outcomes after fresh embryo transfer, whereas this study investigated the influence of sperm DNA fragmentation index (DFI) on laboratory and clinical outcomes after frozen embryo transfer (FET). This retrospective study examined 381 couples using cleavage-stage FET. Sperm used for intracytoplasmic sperm injection (ICSI) or in vitro fertilization (IVF) underwent density gradient centrifugation and swim up processing. Sperm DFI had a negative correlation with sperm motility (r = -0.640, P < 0.01), sperm concentration (r = -0.289, P < 0.01), and fertilization rate of IVF cycles (r = -0.247, P < 0.01). Sperm DFI examined before and after density gradient centrifugation/swim up processing was markedly decreased after processing (17.1% vs 2.4%, P < 0.01; 65 randomly picked couples). Sperm progressive motility was significantly reduced in high DFI group compared with low DFI group for both IVF and ICSI (IVF: 46.9% ± 12.4% vs 38.5% ± 12.6%, respectively; ICSI: 37.6% ± 14.1% vs 22.3% ± 17.8%, respectively; both P < 0.01). The fertilization rate was significantly lower in high (≥25%) DFI group compared with low (<25%) DFI group using IVF (73.3% ± 23.9% vs 53.2% ± 33.6%, respectively; P < 0.01) but was equivalent in high and low DFI groups using ICSI. Embryonic development and clinical outcomes after FET were equivalent for low and high DFI groups using ICSI or IVF. In this study, sperm DFI did not provide sufficient information regarding embryo development or clinical outcomes for infertile couples using FET.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4103/aja.aja_17_21DOI Listing
April 2021

Genomic and neoantigen evolution from primary tumor to first metastases in head and neck squamous cell carcinoma.

Oncotarget 2021 Mar 16;12(6):534-548. Epub 2021 Mar 16.

Division of Medical Oncology, Washington University in St. Louis, St. Louis, MO, USA.

Head and neck cell squamous-cell carcinomas (HNSCC) are a group of common cancers typically associated with tobacco use and human papilloma virus infection. Up to half of all cases will suffer a recurrence after primary treatment. As such, new therapies are needed, including therapies which promote the anti-tumor immune response. Prior work has characterized changes in the mutation burden between primary and recurrent tumors; however, little work has characterized the changes in neoantigen evolution. We characterized genomic and neoantigen changes between 23 paired primary and recurrent HNSCC tumors. Twenty-three biopsies from patients originally diagnosed with locally advanced disease were identified from the Washington University tumor bank. Whole exosome sequencing, RNA-seq, and immunohistochemistry was performed on the primary and recurrent tumors. Within these tumors, we identified 6 genes which have predicted neoantigens in 4 or more patients. Interestingly, patients with neoantigens in these shared genes had increased CD3+ CD8+ T cell infiltration and duration of survival with disease. Within HNSCC tumors examined here, there are neoantigens in shared genes by a subset of patients. The presence of neoantigens in these shared genes may promote an anti-tumor immune response which controls tumor progression.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18632/oncotarget.27907DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7984826PMC
March 2021

Prediction Method of Gestational Diabetes Based on Electronic Medical Record Data.

J Healthc Eng 2021 8;2021:6672072. Epub 2021 Mar 8.

Department of Endocrine, Affiliated Hospital of Beihua University, Jilin 132012, China.

At present, the secondary application of electronic medical records is focused on auxiliary medical diagnosis to improve the accuracy of clinical diagnosis. The main research in this article is the prediction method of gestational diabetes based on electronic medical record data. In the original data, the ID number of the medical examiner did not match the medical examination record. In order to ensure the accuracy of the data, this part of the record was removed. First, the preparation stage before building the model is to determine the baseline accuracy of the original data, test the effectiveness of the machine learning algorithm, and then balance the target data set to solve the bias caused by the imbalance between data classes and the illusion of excessive model prediction results. Then, the disease prediction model is constructed by dividing the data set, selecting parameters and algorithms, and visualizing the model. Finally, the effect of predictive model construction is comprehensively judged based on multiple evaluation indicators and control experimental models. In this paper, the RF model can be used to rank the importance of the feature importance of the output feature on the importance of the classification result of the input feature. In order to test the accuracy of regression prediction, the experiment uses absolute mean error and root mean square error to evaluate the accuracy of fasting blood glucose prediction. A logistic regression model is constructed through the training set, and the test set data are brought into the prediction model for prediction. Experimental data show that when the features filtered by WBFS are used, the accuracy, 1 value, and AUC value of logistic regression are 0.809, 0.881, and 0.825, respectively, which is an increase of about 12% compared with when the feature is not used. The results show that the electronic medical record data drive can effectively improve the accuracy of predicting gestational diabetes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2021/6672072DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7963898PMC
March 2021

Phenotypic and biochemical characteristics and molecular basis in 36 Chinese patients with androgen receptor variants.

Orphanet J Rare Dis 2021 03 9;16(1):122. Epub 2021 Mar 9.

Department of Endocrinology, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 200011, China.

Background: Androgen insensitive syndrome (AIS) is a rare genetic disease resulting from androgen receptor (AR) mutations and one of the causes of 46, XY disorder of sexual development (DSD). This study aimed to describe the clinical features and molecular defects of 36 Chinese patients with AR variants and investigate the functional alterations of novel variants in vitro.

Material And Methods: Subjects with AR variants were identified from 150 Chinese 46, XY DSD patients using targeted next-generation sequencing. In-silico and functional assays were performed to evaluate the transcriptional activity and nuclear localization of novel AR variants.

Results: Eight novel and fifteen reported AR variants were identified. 30.6% (11/36) of patients harbored additional variants other than AR. Mutations in the Arg841 residue were found in 7 unrelated patients. Postpubertal serum gonadotropin levels were significantly elevated in patients with complete AIS (CAIS) compared with those in patients with partial AIS (PAIS) (P < 0.05). All the novel variants initially predicted to be uncertain significance by in-silico analyses were reclassified as likely pathogenic for defective AR transcriptional activity in vitro, except p.L295P, which was found in an atypical patient with oligogenic mutations and reclassified as likely benign. c.368_369 ins T was observed to interfere with nuclear translocation.

Conclusions: Compared with PAIS patients, postpubertal CAIS patients had higher gonadotropin levels. Arg841 was disclosed as the location of recurrent mutations in Chinese AIS patients. Functional assays are important for reclassifying the novel AR variants and re-examining the diagnosis of AIS in specific patients with oligogenic mutations, instead of in-silico analysis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s13023-021-01765-wDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7942007PMC
March 2021

Treatment Effect of Type 2 Diabetes Patients in Outpatient Department Based on Blockchain Electronic Mobile Medical App.

J Healthc Eng 2021 1;2021:6693810. Epub 2021 Mar 1.

Department of Endocrine, Affiliated Hospital of Beihua University, Jilin 132012, China.

As the pace of people's lives accelerates, there are more and more diabetic patients. This research mainly explores the treatment effect of type 2 diabetic patients based on blockchain electronic mobile medical app. Considering that it is more realistic to adopt an off-chain storage solution, the blockchain-based medical data sharing platform in this study adopts an off-chain storage solution. Only key information is stored in the blockchain network, and all medical data will be in the cloud space. For storage, cloud storage uses Aliyun's OSS storage service, which can be expanded infinitely. The cloud operation module is responsible for all operations that interact with cloud storage. The chain code can call the cloud operation module to upload the user's encrypted medical data and user ID to Alibaba Cloud's OSS. The chain code will return the storage address of the medical data and the authorized access address is sent to the blockchain network for consensus on the chain. The message processing module provides information processing functions such as chat information processing, APP use reminders, and health tips. The indicator recording module includes indicator recording functions including 6 indicators of blood sugar, medication, diet, weight, exercise, and sleep. The main function of the indicator analysis module is to display the curve trends of the 6 indicators recorded by the patient in three days, one week, and one month. Comparing the change range of the mean value of glycosylated hemoglobin at the beginning and end of the two groups of patients, it can be found that the change range of glycosylated hemoglobin in the intervention group is -6.04%, while the change range of the control group is only -3.26%. The impact of the mobile medical app designed in this study will indeed be reflected in the patient's blood sugar control and help patients to better control blood sugar.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2021/6693810DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7939747PMC
March 2021

First Report of Root Rot Caused by on Maize in Hebei Province.

Plant Dis 2021 Mar 9. Epub 2021 Mar 9.

Plant Protection Institute of Hebei Academy of Agricultural and Forestry Sciences, IPM Centre of Hebei Province, Key Laboratory of IPM on Crops in Northern Region of North China, Ministry of Agriculture and Rural Affairs, Baoding, China;

Maize ( L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as (G.L. Stout) Shoemaker (teleomorph = R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of (GenBank Accession MH864760). The sequence of gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was . Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of . Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch's postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of on maize root. mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-01-21-0060-PDNDOI Listing
March 2021

Tunneling Nanotubes: A Novel Pharmacological Target for Neurodegenerative Diseases?

Pharmacol Res 2021 Mar 9:105541. Epub 2021 Mar 9.

State Key Laboratory of Bioactive Substances and Functions of Natural Medicines, Institute of Materia Medica& Neuroscience Center, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China. Electronic address:

Diversiform ways of intercellular communication are vital links in maintaining homeostasis and disseminating physiological states. Among intercellular bridges, tunneling nanotubes (TNTs) discovered in 2004 were recognized as potential pharmacology targets related to the pathogenesis of common or infrequent neurodegenerative disorders. The neurotoxic aggregates in neurodegenerative diseases including scrapie prion protein (PrPSc), mutant tau protein, amyloid-beta (Aβ) protein, alpha-synuclein (α-syn) as well as mutant Huntington (mHTT) protein could promote TNT formation via certain physiological mechanisms, in turn, mediating the intercellular transmission of neurotoxicity. In this review, we described in detail the skeleton, the formation, the physicochemical properties, and the functions of TNTs, while paying particular attention to the key role of TNTs in the transport of pathological proteins during neurodegeneration.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.phrs.2021.105541DOI Listing
March 2021

New kid on the block: NOS1AP is a newly recognized genetic cause of steroid-resistant nephrotic syndrome in infants.

Authors:
Hua Sun

Kidney Int 2021 Mar 5. Epub 2021 Mar 5.

Division of Nephrology, Dialysis and Transplantation/Department of Pediatrics, University of Iowa Stead Family Children's Hospital, Iowa City, Iowa, USA. Electronic address:

View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.kint.2021.02.036DOI Listing
March 2021

HPLC-MS/MS-Mediated Analysis of the Pharmacokinetics, Bioavailability, and Tissue Distribution of Schisandrol B in Rats.

Int J Anal Chem 2021 24;2021:8862291. Epub 2021 Feb 24.

Anhui Provincial Center for Drug Clinical Evaluation, Yijishan Hospital of Wannan Medical College, Wuhu 241001, Anhui, China.

Schisandrol B, a lignan isolated from dried fruits, has been shown to exhibit hepatoprotective, cardioprotective, renoprotective, and memory-enhancing properties. This study sought to design a sensitive and efficient HPLC-MS/MS approach to measuring Schisandrol B levels in rat plasma and tissues in order to assess the pharmacokinetics, oral bioavailability, and tissue distributions of this compound . For this analysis, bifendate was chosen as an internal standard (IS). A liquid-liquid extraction (LLE) approach was employed for the preparation of samples that were subsequently separated with an Agilent ZORBAX Eclipse XDB-C (4.6 × 150 mm, 5 m) column with an isocratic mobile phase consisting of methanol and water containing 5 mM ammonium acetate and 0.1% formic acid (90 : 10, v/v). A linear calibration curve was obtained over the 5-2000 ng/mL and 1-1000 ng/mL ranges for plasma samples and tissue homogenates, respectively. This established method was then successfully applied to investigate the pharmacokinetics, oral bioavailability, and tissue distributions of Schisandrol B in Sprague-Dawley (SD) rats that were intravenously administered 2 mg/kg of Schisandrol B monomer, intragastrically administered Schisandrol B monomer (10 mg/kg), or intragastrically administered 6 mL/kg SCE (equivalent to 15 mg/kg Schisandrol B monomer). The oral absolute bioavailability of Schisandrol B following intragastric Schisandrol B monomer and SCE administration was approximately 18.73% and 68.12%, respectively. Tissue distribution studies revealed that Schisandrol B was distributed throughout several tested tissues, with particular accumulation in the liver and kidneys. Our data represent a valuable foundation for future studies of the pharmacologic and biological characteristics of Schisandrol B.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2021/8862291DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7929678PMC
February 2021

Synthesis of Rottlerone Analogues and Evaluation of Their α-Glucosidase and DPP-4 Dual Inhibitory and Glucose Consumption-Promoting Activity.

Molecules 2021 Feb 15;26(4). Epub 2021 Feb 15.

China International Science and Technology Cooperation Base of Food Nutrition/Safety and Medicinal Chemistry, College of Biotechnology, Tianjin University of Science & Technology, Tianjin 300457, China.

Our previous study found that desmethylxanthohumol () inhibited α-glucosidase in vitro. Recently, further investigations revealed that dehydrocyclodesmethylxanthohumol () and its dimer analogue rottlerone () exhibited more potent α-glucosidase inhibitory activity than . The aim of this study was to synthesize a series of rottlerone analogues and evaluate their α-glucosidase and DPP-4 dual inhibitory activity. The results showed that compounds and irreversibly and potently inhibited α-glucosidase (IC = 0.22 and 0.12 μM) and moderately inhibited DPP-4 (IC = 23.59 and 26.19 μM), respectively. In addition, compounds and significantly promoted glucose consumption, with the activity of at 0.2 μM being comparable to that of metformin at a concentration of 1 mM.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/molecules26041024DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7919492PMC
February 2021

Hepatoprotective Glucosyloxybenzyl 2-Hydroxy-2-isobutylsuccinates from .

J Nat Prod 2021 03 19;84(3):738-749. Epub 2021 Feb 19.

Department of Drug Discovery and Biomedical Sciences, College of Pharmacy, Medical University of South Carolina, Charleston, South Carolina 29425, United States.

Nine new glucosyloxybenzyl 2-hydroxy-2-isobutylsuccinates, pleionosides M-U (-), and 12 known compounds (-) were isolated from the pseudobulbs of . Their structures and absolute configurations were established through a combination of HRESIMS and NMR data and supported by physical and chemical methods. Compounds , , , and showed significant in vitro hepatoprotective activity against d-galactosamine (d-GalN)-induced toxicity in HL-7702 cells with increasing cell viability by 27%, 22%, 19%, and 31% compared to the model group (cf. bicyclol, 14%) at 10 μM, respectively. Compounds , , and exhibited moderate hepatoprotective activity against -acetyl--aminophenol (APAP)-induced toxicity in HepG2 cells with increasing cell viability by 9%, 16%, and 12% compared to the model group (cf. bicyclol, 9%) at 10 μM, respectively.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acs.jnatprod.0c01117DOI Listing
March 2021

In situ rotation surgery for correction of growing, inversely impacted maxillary central incisors.

Am J Orthod Dentofacial Orthop 2021 Apr 7;159(4):536-544. Epub 2021 Feb 7.

State Key Laboratory of Military Stomatology and National Clinical Research Center for Oral Diseases, Department of Pediatric Dentistry, School of Stomatology, Fourth Military Medical University, Xi'an, Shaanxi, China. Electronic address:

Treatment of an impacted incisor with a dilacerated root is challenging for clinicians because of the position of the impacted incisor, the abnormality of the root, unfavorable prognosis, and, especially, the long treatment duration. We report on 2 young patients who had inversely impacted maxillary central incisors with developing labially dilacerated roots. Both patients were treated by a novel surgical approach, in situ rotation, by which the crowns of the inversely impacted incisors were carefully rotated to a relatively normal position, whereas the apical location remained relatively unchanged. About 2 weeks after surgery, spontaneous eruption of the treated incisors was observed. Three months later, the postoperative central incisors were further aligned into the maxillary arch with a fixed orthodontic appliance. Follow-up visits 2 or 3 years after surgery indicated that the positions of the dilacerated incisors maintained stability with good gingival esthetics, and the pulpal vitality was favorable. The roots grew further in a relatively normal direction of the incisor's longitudinal axis, which was different from the initial curvature angle. Moreover, with the in situ rotation surgery, treatment time was greatly reduced and resulted in a favorable prognosis compared with conventional treatment.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ajodo.2020.10.023DOI Listing
April 2021

Two new polycyclic polyprenylated acylphloroglucinols derivatives from .

J Asian Nat Prod Res 2021 Feb 10:1-10. Epub 2021 Feb 10.

School of Pharmacy, Shenyang Medical College, Shenyang 110034, China.

Polycyclic polyprenylated acylphloroglucinols (PPAPs) were mainly obtained from the plants of genus of Guttiferae family, and possessed intriguing chemical structures and appealing biological activities. Two new PPAPs derivatives, hyperacmosin C () and hyperacmosin D () were isolated from . Their structures were established by NMR, HREIMS, and experimental electronic circular dichroism spectra. Besides, compound showed significant hepatoprotective activity at 10 µM against paracetamol-induced HepG2 cell damage and compound could moderately increase the relative glucose consumption.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/10286020.2021.1880395DOI Listing
February 2021

Characterization of Formononetin Sulfonation in SULT1A3 Overexpressing HKE293 Cells: Involvement of Multidrug Resistance-Associated Protein 4 in Excretion of Sulfate.

Front Pharmacol 2020 11;11:614756. Epub 2021 Jan 11.

Institute for Innovative Drug Design and Evaluation, School of Pharmacy, Henan University, Kaifeng, China.

Formononetin is one of the main active compounds of traditional Chinese herbal medicine . However, disposition of formononetin via sulfonation pathway remains undefined. Here, expression-activity correlation was performed to identify the contributing of SULT1A3 to formononetin metabolism. Then the sulfonation of formononetin and excretion of its sulfate were investigated in SULT1A3 overexpressing human embryonic kidney 293 cells (or HKE-SULT1A3 cells) with significant expression of breast cancer resistance protein (BCRP) and multidrug resistance-associated protein 4 (MRP4). As a result, formononetin sulfonation was significantly correlated with SULT1A3 protein levels (r = 0.728; < 0.05) in a bank of individual human intestine S9 fractions (n = 9). HEK-SULT1A3 cells catalyzed formononetin formation of a monosulfate metabolite. Sulfate formation of formononetin in HEK-SULT1A3 cell lysate followed the Michaelis-Menten kinetics (V = 13.94 pmol/min/mg and K = 6.17 μM). Reduced activity of MRP4 by MK-571 caused significant decrease in the excretion rate (79.1%-94.6%) and efflux clearance (85.3%-98.0%) of formononetin sulfate, whereas the BCRP specific inhibitor Ko143 had no effect. Furthermore, silencing of MRP4 led to obvious decrease in sulfate excretion rates (>32.8%) and efflux clearance (>50.6%). It was worth noting that the fraction of dose metabolized (f), an indicator of the extent of drug sulfonation, was also decreased (maximal 26.7%) with the knockdown of MRP4. In conclusion, SULT1A3 was of great significance in determining sulfonation of formononetin. HEK-SULT1A3 cells catalyzed formononetin formation of a monosulfate. MRP4 mainly contributed to cellular excretion of formononetin sulfate and further mediated the intracellular sulfonation of formononetin.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fphar.2020.614756DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7836013PMC
January 2021

Minor triterpenes from an aqueous extract of the hook-bearing stem of .

J Asian Nat Prod Res 2021 Apr 28;23(4):307-317. Epub 2021 Jan 28.

State Key Laboratory of Bioactive Substance and Function of Natural Medicines, Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China.

Six new triterpenes, uncarinic acids KP (), along with 24 known analogues, were isolated as minor constituents of an aqueous decoction of the hook-bearing stems of (Gou-teng). By comprehensive spectroscopic data analysis, their structures were elucidated as derivatives of olean-12-en-28-oic acid and urs-12-en-28-oic acid with different oxidized forms at C-3, C-6, and/or C-23, respectively. Cell-based preliminary bioassay showed that the ()-/()-coumaroyloxy and ()-/()-feruloyloxy units at C-27 of olean-12-en-28-oic acid and urs-12-en-28-oic acid played roles in their bioactivities.[Formula: see text].
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/10286020.2020.1870961DOI Listing
April 2021

Dysregulated Dynein-Mediated Trafficking of Nephrin Causes INF2-related Podocytopathy.

J Am Soc Nephrol 2021 Feb 22;32(2):307-322. Epub 2020 Dec 22.

Division of Nephrology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts

Background: FSGS caused by mutations in is characterized by a podocytopathy with mistrafficked nephrin, an essential component of the slit diaphragm. Because INF2 is a formin-type actin nucleator, research has focused on its actin-regulating function, providing an important but incomplete insight into how these mutations lead to podocytopathy. A yeast two-hybridization screen identified the interaction between INF2 and the dynein transport complex, suggesting a newly recognized role of INF2 in regulating dynein-mediated vesicular trafficking in podocytes.

Methods: Live cell and quantitative imaging, fluorescent and surface biotinylation-based trafficking assays in cultured podocytes, and a new puromycin aminoglycoside nephropathy model of transgenic mice were used to demonstrate altered dynein-mediated trafficking of nephrin in INF2 associated podocytopathy.

Results: Pathogenic mutations disrupt an interaction of INF2 with dynein light chain 1, a key dynein component. The best-studied mutation, R218Q, diverts dynein-mediated postendocytic sorting of nephrin from recycling endosomes to lysosomes for degradation. Antagonizing dynein-mediated transport can rescue this effect. Augmented dynein-mediated trafficking and degradation of nephrin underlies puromycin aminoglycoside-induced podocytopathy and FSGS .

Conclusions: mutations enhance dynein-mediated trafficking of nephrin to proteolytic pathways, diminishing its recycling required for maintaining slit diaphragm integrity. The recognition that dysregulated dynein-mediated transport of nephrin in R218Q knockin podocytes opens an avenue for developing targeted therapy for INF2-mediated FSGS.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1681/ASN.2020081109DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8054882PMC
February 2021

Conservation of copy number profiles during engraftment and passaging of patient-derived cancer xenografts.

Nat Genet 2021 01 7;53(1):86-99. Epub 2021 Jan 7.

Center for Cancer Biology, VIB, Leuven, Belgium.

Patient-derived xenografts (PDXs) are resected human tumors engrafted into mice for preclinical studies and therapeutic testing. It has been proposed that the mouse host affects tumor evolution during PDX engraftment and propagation, affecting the accuracy of PDX modeling of human cancer. Here, we exhaustively analyze copy number alterations (CNAs) in 1,451 PDX and matched patient tumor (PT) samples from 509 PDX models. CNA inferences based on DNA sequencing and microarray data displayed substantially higher resolution and dynamic range than gene expression-based inferences, and they also showed strong CNA conservation from PTs through late-passage PDXs. CNA recurrence analysis of 130 colorectal and breast PT/PDX-early/PDX-late trios confirmed high-resolution CNA retention. We observed no significant enrichment of cancer-related genes in PDX-specific CNAs across models. Moreover, CNA differences between patient and PDX tumors were comparable to variations in multiregion samples within patients. Our study demonstrates the lack of systematic copy number evolution driven by the PDX mouse host.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41588-020-00750-6DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7808565PMC
January 2021

Cache-Aided General Linear Function Retrieval.

Entropy (Basel) 2020 Dec 26;23(1). Epub 2020 Dec 26.

Electrical Engineering and Computer Science Department, Technische Universität Berlin, 10587 Berlin, Germany.

Coded Caching, proposed by Maddah-Ali and Niesen (MAN), has the potential to reduce network traffic by pre-storing content in the users' local memories when the network is underutilized and transmitting coded multicast messages that simultaneously benefit many users at once during peak-hour times. This paper considers the linear function retrieval version of the original coded caching setting, where users are interested in retrieving a number of linear combinations of the data points stored at the server, as opposed to a single file. This extends the scope of the authors' past work that only considered the class of linear functions that operate element-wise over the files. On observing that the existing cache-aided scalar linear function retrieval scheme does not work in the proposed setting, this paper designs a novel coded caching scheme that outperforms uncoded caching schemes that either use unicast transmissions or let each user recover all files in the library.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/e23010025DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7824256PMC
December 2020

Proteomic Resistance Biomarkers for PI3K Inhibitor in Triple Negative Breast Cancer Patient-Derived Xenograft Models.

Cancers (Basel) 2020 Dec 21;12(12). Epub 2020 Dec 21.

Division of Oncology, Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110, USA.

PI3K pathway activation is frequently observed in triple negative breast cancer (TNBC). However, single agent PI3K inhibitors have shown limited anti-tumor activity. To investigate biomarkers of response and resistance mechanisms, we tested 17 TNBC patient-derived xenograft (PDX) models representing diverse genomic backgrounds and varying degrees of PI3K pathway signaling activities for their tumor growth response to the pan-PI3K inhibitor, BKM120. Baseline and post-treatment PDX tumors were subjected to reverse phase protein array (RPPA) to identify protein markers associated with tumor growth response. While BKM120 consistently reduced PI3K pathway activity, as demonstrated by reduced levels of phosphorylated AKT, percentage tumor growth inhibition (%TGI) ranged from 35% in the least sensitive to 84% in the most sensitive model. Several biomarkers showed significant association with resistance, including elevated baseline levels of growth factor receptors (EGFR, pHER3 Y1197), PI3Kp85 regulatory subunit, anti-apoptotic protein BclXL, EMT (Vimentin, MMP9, IntegrinaV), NFKB pathway (IkappaB, RANKL), and intracellular signaling molecules including Caveolin, CBP, and KLF4, as well as treatment-induced increases in the levels of phosphorylated forms of Aurora kinases. Interestingly, increased AKT phosphorylation or PTEN loss at baseline were not significantly correlated to %TGI. These results provide important insights into biomarker development for PI3K inhibitors in TNBC.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/cancers12123857DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7765949PMC
December 2020

Estimating the Growing Stem Volume of Coniferous Plantations Based on Random Forest Using an Optimized Variable Selection Method.

Sensors (Basel) 2020 Dec 17;20(24). Epub 2020 Dec 17.

Research Center of Forestry Remote Sensing and Information Engineering, Central South University of Forestry and Technology, Changsha 410004, China.

Forest growing stem volume (GSV) reflects the richness of forest resources as well as the quality of forest ecosystems. Remote sensing technology enables robust and efficient GSV estimation as it greatly reduces the survey time and cost while facilitating periodic monitoring. Given its red edge bands and a short revisit time period, Sentinel-2 images were selected for the GSV estimation in Wangyedian forest farm, Inner Mongolia, China. The variable combination was shown to significantly affect the accuracy of the estimation model. After extracting spectral variables, texture features, and topographic factors, a stepwise random forest (SRF) method was proposed to select variable combinations and establish random forest regressions (RFR) for GSV estimation. The linear stepwise regression (LSR), Boruta, Variable Selection Using Random Forests (VSURF), and random forest (RF) methods were then used as references for comparison with the proposed SRF for selection of predictors and GSV estimation. Combined with the observed GSV data and the Sentinel-2 images, the distributions of GSV were generated by the RFR models with the variable combinations determined by the LSR, RF, Boruta, VSURF, and SRF. The results show that the texture features of Sentinel-2's red edge bands can significantly improve the accuracy of GSV estimation. The SRF method can effectively select the optimal variable combination, and the SRF-based model results in the highest estimation accuracy with the decreases of relative root mean square error by 16.4%, 14.4%, 16.3%, and 10.6% compared with those from the LSR-, RF-, Boruta-, and VSURF-based models, respectively. The GSV distribution generated by the SRF-based model matched that of the field observations well. The results of this study are expected to provide a reference for GSV estimation of coniferous plantations.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/s20247248DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7766647PMC
December 2020

Comparative HPLC-MS/MS-based pharmacokinetic studies of multiple diterpenoid alkaloids following the administration of Zhenwu Tang and Radix Aconiti Lateralis Praeparata extracts to rats.

Xenobiotica 2021 Mar 5;51(3):345-354. Epub 2021 Jan 5.

Anhui Provincial Center for Drug Clinical Evaluation, Yijishan Hospital of Wannan Medical College, Wuhu, Anhui, China.

Abstracts Zhenwu Tang (ZWT) is a traditional Chinese medicine that is primarily composed of Radix Aconiti Lateralis Praeparata (FZ) and diterpenoid alkaloids are believed to be the pharmacologically active compounds of ZWT. In this study, the pharmacokinetic profiles of hypaconitine, mesaconitine, aconitine, benzoylmesaconitine, benzoylaconitine, and benzoylhypacoitine were assessed in rats following intragastric ZWT administration. Furthermore, differences in the pharmacokinetic profiles of these six alkaloids were assessed as a function of rat sex and the administration of ZWT or FZ extracts to these animals. Plasma levels of these alkaloids were quantified via HPLC-MS/MS. Significant differences in key pharmacokinetic parameters were observed when comparing rats administered FZ or ZWT. Relative to FZ extract treatment, ZWT administration was associated with C and AUC values of benzoylmesaconitine that were about 3.5 and 5.5 times higher. Considerable variations in hypaconitine pharmacokinetic parameters were also revealed between female and male rats. The C and AUC of hypaconitine were about 2.5- and 2.7-fold elevated in female rats in comparison with male rats. These results suggested that the other compounds within ZWT can enhance the absorption of benzoylmesaconitine, while hypaconitine exhibits higher bioavailability in female rats, as compared with male rats.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/00498254.2020.1866229DOI Listing
March 2021

A comparative evaluation of three common airway humidification methods for patients with severe traumatic brain injury.

Ann Palliat Med 2020 Nov;9(6):4137-4145

The Department of Neurosurgery, Center for Critical Medicine, The Forth People's Hospital of Changzhou, Changzhou, China; The Department of Neurosurgery, Center for Critical Medicine, Changzhou Tumor Hospital, Changzhou, China; The Department of Neurosurgery, Center for Critical Medicine, Changzhou Tumor Hospital Affiliated to Soochow University, Changzhou, China.

Background: Airway humidification methods are commonly used in clinical practice, but no clear consensus exists on which particular method is best suited for specific clinical conditions.

Methods: In this retrospective study, we carried out a quantitative evaluation of three methods commonly used for patients with severe traumatic brain injury (STBI). We recruited 150 patients who received airway humidification after tracheotomy. Subjects were divided into three groups according to the humidification method they received which included oxygen atomizer (OA) group, heat and moisture exchangers (HMEs) group, and heated humidifiers (HHs) group. Variables including phlegm viscosity, humidification effects, phlegm formation rates, daily sputum inhalation times, airway spasm, secondary lung infections, daily nursing load, and evaluation of nurse job satisfaction levels were documented.

Results: Results indicated that the OA tended to cause either insufficient or excessive humidification, whereas phlegm scab formation was significantly reduced in HHs. HMEs and HHs displayed equal humidification effects, and a similar daily sputum induction and consequent nursing load. Airway spasm was a frequent occurrence in OA. The severity, but not the infection ratio, of secondary infection decreased significantly in HHs by the 30th day. The OA significantly reduced nursing load, but demonstrated the worst humidification effects.

Conclusions: Overall results suggested that the HHs is more suitable for airway nursing of STBI patients who are bedridden for extended periods.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.21037/apm-20-2135DOI Listing
November 2020

[Dynamic change and prediction of vegetation cover in Shenzhen, China from 2000 to 2018].

Ying Yong Sheng Tai Xue Bao 2020 Nov;31(11):3777-3785

Research Center of Forestry Remote Sensing & Information Engineering, Central South University of Forestry and Technology, Changsha 410004, China.

With landsat-series multi-temporal image data, percentage of vegetation cover (PVC) was estimated by pixel dichotomy. The linear regression analysis and center of gravity migration methods were used to explore the characteristics of the spatiotemporal changes of vegetation cover in Shenzhen from 2000 to 2018. The CA-Markov model was combined to predict future land cover in Shenzhen. The results showed that the PVC in Shenzhen demonstrated obvious regional differentiation characteristics from 2000 to 2018. The eastern region occupied larger proportion than the wes-tern part, while the southern region was larger than the north part. This feature exhibited good consistency with regional topographic effect. The spatial migration characteristic of the center of gravity of PVC was from northwest to southeast, and then from southeast to northwest, with a migration rate of 551.2 m·a. This process was closely related to urbanization in Shenzhen. The PVC in Shen-zhen tended to be generally improved from 2000-2018, with a improvement rate of 0.005·a. The percentage of significantly improved and degraded PVC area was 30.8% and 12.8%, respectively. The CA-Markov method was used to predict the land cover/use pattern of Shenzhen in 2024 under two scenarios, theoretical scenario and natural scenario. There was no significant difference in proportion of the area of the land cover/use patterns obtained by the two kinds of prediction method, with the difference threshold being 0-1.2%. Compared with the data before 2018, the proportion of arbor forests and arable land converted into construction land in Shenzhen would be significantly reduced in 2024, whereas the contradiction between supply and demand would be still tense.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.13287/j.1001-9332.202011.012DOI Listing
November 2020

Ultrasound Controlled Anti-Inflammatory Polarization of Platelet Decorated Microglia for Targeted Ischemic Stroke Therapy.

Angew Chem Int Ed Engl 2021 03 22;60(10):5083-5090. Epub 2021 Jan 22.

Department of Chemistry, Key Laboratory of Bioorganic Phosphorus Chemistry & Chemical Biology, Tsinghua University, Beijing, 100084, P. R. China.

Stroke is a lethal cerebral disease with severe sequelae and high mortality. Microglia, the main immune cell in the cerebrum, possess therapeutic potential for strokes as its specific anti-inflammatory phenotype can reduce inflammation and promote neuron regeneration. However, the on-demand anti-inflammatory polarization of microglia at the stroke site is uncontrollable for therapeutic application. Here, we develop a platelet hybrid microglia platform which can specifically polarize to the anti-inflammatory phenotype by ultrasound irradiation for targeted cerebrum repair after stroke. The engineered microglia have strong adherence to the injured cerebral vessels with platelet membrane fusion and realize on-demand anti-inflammatory polarization with ultrasound-responsive IL-4 liposome decoration. The intravenously injected microglia platform showed anti-inflammatory polarization at the stroke site with insonation, and accelerated the M2-type polarization of endogenous microglia for long-term stroke recovery. Satisfied prognoses were achieved with reduced apoptosis, promoted neurogenesis, and functional recovery, indicating the implications of the microglia platform for stroke therapy.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/anie.202010391DOI Listing
March 2021