Publications by authors named "Hongxia Ma"

335 Publications

Phenotypic Antimicrobial Susceptibility and Genotypic Characterization of Clinical Isolates Circulating in Shanghai, China.

Front Microbiol 2021 8;12:724935. Epub 2021 Oct 8.

Department of Clinical Laboratory, Zhabei Central Hospital of Jing'an District, Shanghai, China.

There is a growing global concern regarding the rise of antimicrobial resistance among spp. isolates. However, studies on the antimicrobial susceptibility profiles, resistance mechanisms, and clonality of spp. clinical isolates are still limited and cover only some geographic regions. Firstly, species from the urogenital tracts of patients in Shanghai, China, were isolated by using the culture medium (A8 and 10B broth), and identified the genotype by polymerase chain reaction (PCR). Secondly, the antimicrobial susceptibility tests were determined by using broth microdilution assay. Then, the resistance genetic determinants to fluoroquinolones (FQs), macrolides, and tetracyclines were investigated through PCR/DNA sequencing. Finally, the molecular epidemiology of species was studied by multilocus sequence typing (MLST). Among 258 isolates, (UPA) and (UUR) were found in 226 (87.60%) and 32 (12.40%) isolates, respectively. The minimum inhibitory concentrations (MICs) of 258 spp. strains ranged from 0.015 to 64μg/ml for all 11 kinds of antimicrobials. Regardless of species, the isolates were most sensitive to AZI (1.94%), JOS (3.49%), and CLA (4.23%). Among them, there were 39 (15.12%) multidrug-resistant (MDR) strains, including 32 UPA isolates. The resistance rates of UPA to CIP (91.59%), and ROX (36.28%) were significantly higher than those of UUR. Twenty six FQ-resistant isolates had amino acid substitutions in and in (Ser83Leu). Mutations were detected in genes encoding ribosomal proteins L4 (Thr84Ile) and L22 (Ser81Pro) in macrolide-resistant isolates. (M) was found in four UPA isolates. These mutations were mainly found in UPA isolates. Sequence type 1 (ST1) was the predominant ST, which contained 18 isolates. In conclusion, this study showed a higher resistance rate (especially to ROX and CIP), higher substitution rate, and higher MDR rate among UPA strains. The most active antimicrobial agents were AZI, JOS, and CLA. Identifying UPA or UUR in clinical isolates could help clinicians to choose appropriate drugs for treatment. The main resistance mechanisms may involve gene substitution of Ser83Leu in and Ser81Pro in L22. ST1 was the predominant ST of isolates with MDR to FQs and macrolides in Shanghai, China.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fmicb.2021.724935DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8531517PMC
October 2021

Polycystic ovary syndrome is an independent risk factor for hypertensive disorders of pregnancy: A systematic review, meta-analysis, and meta-regression.

Endocrine 2021 Oct 16. Epub 2021 Oct 16.

Department of Traditional Chinese Medicine, the First Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, 510240, China.

Purpose: The risk of hypertensive disorders of pregnancy (HDP) in women with polycystic ovary syndrome (PCOS) is inconsistent in some studies. The aim of this meta-analysis was to examine the evidence regarding the strength of the association between PCOS and HDP.

Methods: PubMed, Web of Science, Embase, and the Cochrane Library were systematically searched to identify observational studies investigating HDP in patients with PCOS. The primary outcome was the pooled odds ratio (OR) of HDP, including pregnancy-induced hypertension (PIH) and pre-eclampsia (PE), in women with PCOS compared with the non-PCOS population.

Results: A total of 30 studies were eligible for meta-analysis. PCOS was associated with a higher risk of HDP (OR 2.02, 95CI% 1.83-2.22), including PIH (OR 1.94, 95CI% 1.70-2.21), and PE (OR 2.07, 95CI% 1.91-2.24). The association remained significant after adjusting for age, body mass index (BMI), and nulliparity (HDP: OR 1.48, 95CI% 1.48-1.60; PIH: OR 1.42, 95%CI 1.29-1.57; PE: OR 2.07, and 95%CI 1.91-2.24). The increased risk of HDP for the PCOS group remained significant in subgroups of BMI, Age, singleton pregnancy, multiple pregnancy, gestational diabetes mellitus (GDM), hyperandrogenism, and nulliparity, while the finding was not observed in subgroups of nonhyperandrogenic and non-GDM. In the meta-regression, BMI contributed significantly to the heterogeneity in the prevalence of HDP.

Conclusions: PCOS is independently associated with a significantly increased risk of HDP. To prevent HDP during pregnancy, our findings highlight the importance of establishing supervision guidelines for PCOS patients, especially in the population with hyperandrogenism and GDM.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s12020-021-02886-9DOI Listing
October 2021

Diet and Risk of Incident Lung Cancer: A Large Prospective Cohort Study in UK Biobank.

Am J Clin Nutr 2021 Sep 28. Epub 2021 Sep 28.

Department of Epidemiology, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing, China.

Background: Epidemiological evidence remains conflicting regarding diet and risk of lung cancer.

Objectives: We sought to systematically investigate whether dietary factors are associated with the risk of incident lung cancer in the UK Biobank.

Methods: A total of 416,588 participants (54% women) from the UK Biobank were included in the present study. Based on baseline data from FFQs, 3 main dietary patterns were identified by using principal component analysis. Cox proportional hazards models were used to investigate the association of individual food groups and dietary patterns with lung cancer risk.

Results: During a median follow-up of 7.13 y, 1782 incident lung cancer cases were documented. The association analysis showed high intake of red meat and processed meat was associated with an increased risk of lung cancer (HRper 50 g/d: 1.36; 95% CI: 1.13, 1.65 for red meat; HRper 25 g/d: 1.30; 95% CI: 1.10, 1.53 for processed meat). However, the consumption of fruits (HRper 100 g/d: 0.90; 95% CI: 0.84, 0.95), vegetables (HRper 100 g/d: 0.89; 95% CI: 0.81, 0.99), breakfast cereals (HRper 50 g/d: 0.81; 95% CI: 0.74, 0.89), and dietary fiber (HRper 5 g/d: 0.76; 95% CI: 0.69, 0.84) was inversely associated with the risk of lung cancer. For the dietary pattern analysis [quartile (Q) comparison], high adherence to the Prudent pattern (HRQ4 compared with Q1: 0.84; 95% CI: 0.73, 0.96) was associated with a lower risk of lung cancer, whereas the Western pattern (HRQ4 compared with Q1: 1.27; 95% CI: 1.11, 1.46) was associated with a higher risk of lung cancer.

Conclusions: Our study indicated that a diet characterized by high intake of fruits, vegetables, breakfast cereals, and dietary fiber, as well as low intake of red meat and processed meat, was associated with a lower risk of lung cancer.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/ajcn/nqab298DOI Listing
September 2021

Investigation of Causal Effect of Type 2 Diabetes Mellitus on Lung Cancer: A Mendelian Randomization Study.

Front Genet 2021 31;12:673687. Epub 2021 Aug 31.

Department of Epidemiology, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing, China.

Background: Although several observational studies have attempted to investigate the association between type 2 diabetes mellitus (T2DM) and lung cancer risk, the results are controversial. Here, we intend to examine whether there is a causal association between T2DM and lung cancer risk.

Materials And Methods: We conducted a Mendelian randomization (MR) study to systematically investigate the effect of T2DM on lung cancer among 13,327 cases and 13,328 controls. A weighted genetic risk score (wGRS) was constructed as a proxy instrument by using 82 previously reported T2DM-related single nucleotide polymorphisms (SNPs). The logistic regression model was utilized to estimate associations of T2DM-related SNPs and wGRS with lung cancer risk. Sensitivity analyses were also performed to assess the robustness of the observed associations.

Results: We found no evidence for a causal relationship between T2DM and lung cancer risk (odds ratio, OR = 0.96, 95% confidence interval: 0.91-1.01, = 0.96), and the association did not vary among populations of different age, sex, smoking status, and histological type. Sensitivity analyses (e.g., MR-Egger test) suggest that pleiotropic effects did not bias the result.

Conclusion: In this MR study with a large number of lung cancer cases, we found no evidence to support the causal role of T2DM in lung cancer risk. Further large-scale prospective studies are warranted to replicate our findings.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fgene.2021.673687DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8439278PMC
August 2021

Pharmacological Interventions for REM Sleep Behavior Disorder in Parkinson's Disease: A Systematic Review.

Front Aging Neurosci 2021 13;13:709878. Epub 2021 Aug 13.

Key Laboratory of Neuromolecular Biology, The First Affiliated Hospital of Henan University of Science and Technology, Luoyang, China.

To review the therapeutic effects of drugs on REM sleep behavior disorder (RBD) in Parkinson's disease (PD) by searching the MEDLINE/PubMed, Embase, Cochrane, and CBM databases. According to the inclusion and exclusion criteria, studies were included after excluding duplicate data. We evaluated the safety and efficacy of pharmacological intervention to improve RBD in patients with Parkinson's disease (PD-RBD). This systematic review mainly describes the drugs that can be used to treat PD-RBD patients. The results have shown that melatonin can be used as the first-line drug for PD-RBD, and clonazepam provides significant improvement on PD-RBD, androtigotine can be used as an alternative drug. However, further large-scale clinical trial studies are still needed to provide the best guidelines for the pharmacological treatment of PD-RBD.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fnagi.2021.709878DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8415017PMC
August 2021

Diagnostic Value of Fractional Exhaled Nitric Oxide and Small Airway Function in Differentiating Cough-Variant Asthma from Typical Asthma.

Can Respir J 2021 20;2021:9954411. Epub 2021 Aug 20.

Department of Respiratory and Critical Care Medicine, The First Hospital of Shanxi Medical University, Taiyuan, Shanxi 030001, China.

Purpose: To explore the diagnostic value of fractional exhaled nitric oxide (FeNO), small airway function, and a combined of both in differentiating cough-variant asthma (CVA) from typical asthma (TA).

Methods: A total of 206 asthma subjects, including 104 CVA and 102 TA, were tested for pulmonary function, bronchial provocation test and FeNO. The correlation between FeNO, small airway function and other pulmonary indicators was analyzed by single correlation and multiple regression analysis. The receiver operating characteristic (ROC) curve was established to evaluate the diagnostic efficiency of FeNO, small airway function, and their combination and to predict the optimal cut-off point.

Results: All the respiratory function parameters and small airway function indicators in TA group were significantly different from those in CVA group, and FeNO value was significantly higher than that in CVA group. In addition, the area under the ROC curve (AUC) was estimated to be 0.660 for FeNO, 0.895 for MMEF, 0.873 for FEF, 0.898 for FEF, 0.695 for Fres, 0.650 for R5-R20, and 0.645 for X5. The optimal cut-off points of FeNO, MMEF, FEF, FEF, Fres, R5-R20 and X5, were 48.50 ppb, 60.02%, 63.46%, 45.26%, 16.63 Hz, 0.38 kPa·L·s, and -1.32, respectively. And the AUC of FeNO combined with small airway function indexes FEF, Fres, R5-R20, and X5 were prior than single indicators.

Conclusion: FeNO and small airway function indexes might have great diagnostic value for differentiating CVA from TA. The combination of FeNO and FEF, Fres, R5-R20, and X5 provided a significantly better prediction than either alone.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2021/9954411DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8397554PMC
August 2021

Circulating C-reactive protein increases lung cancer risk: Results from a prospective cohort of UK Biobank.

Int J Cancer 2021 Aug 27. Epub 2021 Aug 27.

Department of Epidemiology, School of Public Health, Southeast University, Nanjing, China.

Chronic inflammation has been associated with the development of lung cancer. In this study, we examined the association between C-reactive protein (CRP) and lung cancer in a prospective cohort study and used Mendelian randomization (MR) to clarify the causality. We included 420 977 participants from the UK Biobank (UKB) in the analyses; 1892 thereof were diagnosed with lung cancer during the follow-up. Hazards ratios (HRs) of CRP concentrations were estimated by Cox proportional hazard models and two approaches of MR analysis were performed. Besides, we added CRP concentrations to epidemiological model of lung cancer to evaluate its prediagnostic role through time-dependent receiver operating characteristic curve analysis. Elevated CRP levels were associated with a 22% increased lung cancer risk per 1 SD increase (HR = 1.22, 95% confidence interval [CI] = 1.18-1.26). Positive associations were observed in small cell lung cancer (HR = 1.21, 95% CI = 1.10-1.33), lung adenocarcinoma (HR = 1.17, 95% CI = 1.11-1.23) and lung squamous cell carcinoma (HR = 1.22, 95% CI = 1.14-1.31). No genetical association of circulating CRP levels and lung cancer risk was observed in MR analysis. When added to a risk model of lung cancer, CRP improved the performance of model as long as 8 years among current smokers (basic model: C-statistic = 0.78 [95% CI = 0.75-0.80]; CRP model: C-statistic = 0.79 [95% CI = 0.76-0.81]; P  = .003, P  = .014). Our results did not support the causal association of circulating CRP with lung cancer risk. However, circulating CRP could be a prediagnostic marker of lung cancer as long as 8 years in advance for current smokers.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/ijc.33780DOI Listing
August 2021

Isovitexin is a direct inhibitor of coagulase.

J Microbiol Biotechnol 2021 Aug 12;31(10). Epub 2021 Aug 12.

College of Animal Medicine, Jilin Agricultural University, Changchun 130118, China.

(S. aureus) is a major pathogen that causes human pneumonia, leading to significant morbidity and mortality. coagulase (Coa) triggers the polymerization of fibrin by activating host prothrombin, which then converts fibrinogen to fibrin and contributes to pathogenesis and persistent infection. In our research, we demonstrate that isovitexin, an active traditional Chinese medicine component, can inhibit the coagulase activity of Coa but does not interfere with the growth of . Furthermore, we show through thermal shift and fluorescence quenching assays that isovitexin directly binds to Coa. Dynamic simulation and structure-activity relationship analyses suggest that V191 and P268 are key amino acid residues responsible for the binding of isovitexin to Coa. Taken together, these data indicate that isovitexin is a direct Coa inhibitor and a promising candidate for drug development against infection.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4014/jmb.2105.05013DOI Listing
August 2021

Application of a decision tree model in the early identification of severe patients with severe fever with thrombocytopenia syndrome.

PLoS One 2021 30;16(7):e0255033. Epub 2021 Jul 30.

College of Public Health, Zhengzhou University, Zhengzhou, China.

Background: Severe fever with thrombocytopenia syndrome (SFTS) is a serious infectious disease with a fatality of up to 30%. To identify the severity of SFTS precisely and quickly is important in clinical practice.

Methods: From June to July 2020, 71 patients admitted to the Infectious Department of Joint Logistics Support Force No. 990 Hospital were enrolled in this study. The most frequently observed symptoms and laboratory parameters on admission were collected by investigating patients' electronic records. Decision trees were built to identify the severity of SFTS. Accuracy and Youden's index were calculated to evaluate the identification capacity of the models.

Results: Clinical characteristics, including body temperature (p = 0.011), the size of the lymphadenectasis (p = 0.021), and cough (p = 0.017), and neurologic symptoms, including lassitude (p<0.001), limb tremor (p<0.001), hypersomnia (p = 0.009), coma (p = 0.018) and dysphoria (p = 0.008), were significantly different between the mild and severe groups. As for laboratory parameters, PLT (p = 0.006), AST (p<0.001), LDH (p<0.001), and CK (p = 0.003) were significantly different between the mild and severe groups of SFTS patients. A decision tree based on laboratory parameters and one based on demographic and clinical characteristics were built. Comparing with the decision tree based on demographic and clinical characteristics, the decision tree based on laboratory parameters had a stronger prediction capacity because of its higher accuracy and Youden's index.

Conclusion: Decision trees can be applied to predict the severity of SFTS.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0255033PLOS
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8324211PMC
July 2021

Assisted reproductive technology and birth defects in a Chinese birth cohort study.

Lancet Reg Health West Pac 2021 Feb 22;7:100090. Epub 2021 Jan 22.

State Key Laboratory of Reproductive Medicine, Centre for Global Health, School of Public Health, Nanjing Medical University, Nanjing 211166, China.

Background: It has been consistently shown in several meta-analyses that infants born after ART have an excess of birth defects compared with those after spontaneous conception, however, the prevalence of birth defects among ART offspring in China is incompletely studied. Moreover, it is unclear to what extent the risk of birth defects is associated with parental infertility characteristics, specific ART procedures and twinning.

Methods: In the prospective cohort study, we included women who participated in the cohort, and had pregnancies of at least 20 gestational weeks between August 2016 and May 2019, and followed them until their children reached 1 year of age. Exposures of interest were ART, as well as infertility-related characteristics, certain ART procedures and specific medication usage. The primary outcome was birth defects including both major and minor defects, which we analysed with logistic generalized estimating equations to investigate the association with ART and certain ART characteristics.

Findings: A total of 1,825 women with ART-pregnancy and 3,483 women with spontaneous-pregnancy were included in the analysis. The prevalence of any defects was significantly higher among ART-births than their non-ART counterparts at each follow-up, specifically at prenatal screening (2•2% vs. 1•2%), at delivery (4•9% vs. 2•9%), at 6 months (10•4% vs. 5•3%) and 1 year of age (13•9% vs. 7•0%), and the associations between ART and increased risk of birth defects at each follow-up were similarly robust. Among ART-births, GnRH antagonist regimen for ovulation induction in women was associated with an increased risk of birth defects in their offspring after taking into account potential influencing factors (Multivariable model: adjusted risk ratio [aRR] 1•47, 1•04-2•07). Additionally, mediation through twinning accounted for 31•1% of the risk of ART-associated birth defects.

Interpretation: The results suggest that ART confers an increased risk for birth defects in offspring. The risk is partly attributable to infertility characteristics, certain ovulation induction regimen, and to some extent mediated by twinning. Our findings highlight the importance of long-term follow-up of children conceived via ART for health conditions.

Funding: National Key Research and Development Program of China, National Natural Science Foundation of China and Natural Science Foundation of Jiangsu Province.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.lanwpc.2020.100090DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8315325PMC
February 2021

Genetic Risk for Overall Cancer and the Benefit of Adherence to a Healthy Lifestyle.

Cancer Res 2021 Sep 28;81(17):4618-4627. Epub 2021 Jul 28.

Department of Epidemiology, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing, China.

Cancer site-specific polygenic risk scores (PRS) effectively identify individuals at high risk of individual cancers, but the effectiveness of PRS on overall cancer risk assessment and the extent to which a high genetic risk of overall cancer can be offset by a healthy lifestyle remain unclear. Here, we constructed an incidence-weighted overall cancer polygenic risk score (CPRS) based on 20 cancer site-specific PRSs. Lifestyle was determined according to smoking, alcohol consumption, physical activity, body mass index, and diet. Cox regression by sex was used to analyze associations of genetic and lifestyle factors with cancer incidence using UK Biobank data ( = 442,501). Compared with participants at low genetic risk (bottom quintile of CPRS), those at intermediate (quintiles 2 to 4) or high (top quintile) genetic risk had HRs of 1.27 (95% confidence interval, 1.21-1.34) or 1.91 (1.81-2.02) for overall cancer, respectively, for men, and 1.21 (1.16-1.27) or 1.62 (1.54-1.71), respectively, for women. A joint effect of genetic and lifestyle factors on overall cancer risk was observed, with HRs reaching 2.99 (2.45-3.64) for men and 2.38 (2.05-2.76) for women with high genetic risk and unfavorable lifestyle compared with those with low genetic risk and favorable lifestyle. Among participants at high genetic risk, the standardized 5-year cancer incidence was significantly reduced from 7.23% to 5.51% for men and from 5.77% to 3.69% for women having a favorable lifestyle. In summary, individuals at high genetic risk of overall cancer can be identified by CPRS, and risk can be attenuated by adopting a healthy lifestyle. SIGNIFICANCE: A new indicator of cancer polygenic risk score measures genetic risk for overall cancer, which could identify individuals with high cancer risk to facilitate decision-making about lifestyle modifications for personalized prevention.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1158/0008-5472.CAN-21-0836DOI Listing
September 2021

Effect of cardiopulmonary rehabilitation nursing on exercise endurance and quality of life of stable COPD patients.

Am J Transl Res 2021 15;13(6):7356-7362. Epub 2021 Jun 15.

Department II of Respiratory and Critical Care Medicine, Cangzhou Central Hospital Cangzhou, China.

Objective: To investigate the effect of cardiopulmonary rehabilitation nursing on exercise endurance and quality of life (QOL) of patients with stable chronic obstructive pulmonary disease (COPD).

Methods: This randomized trial was conducted on 84 subjects with stable COPD recruited in our hospital from March 2018 to December 2019 and they were divied into the observation group (n=42) and the control group (n=42) based on nursing methods. The control group adopted conventional nursing, and the observation group received cardiopulmonary rehabilitation nursing in addition to conventional method. The exercise endurance, cardiopulmonary function, psychological state, QOL and nursing satisfaction were compared at pre- and post-nursing care.

Results: Before nursing, no notable difference was observed in 6 min walking distance (6MWD), deep inspiratory volume (IC), left ventricular ejection fraction (LVEF), forced vital capacity (FVC), Forced expiratory volume in one second (FEV1), FEV1/FVC, Self-Rating Anxiety Scale (SAS), Self-rating Depression Scale (SDS) score, QOL, scores of symptoms, activities and impact in these two groups (P>0.05). After nursing, 6MWD and IC of observation group were remarkably higher (P<0.05); LVEF, FVC, FEV1 and FEV1/FVC in the observation group were remarkably higher (P<0.05); SAS and SDS scores of two groups decreased, and the observation group was notably lower (P<0.05); the QOL scores of symptoms, activities and effects of two groups were notably reduced, and the observation group was remarkably lower (P<0.05). The nursing satisfaction of the observation group was considerably higher than the control group (95.23% vs 76.19%) (P<0.05).

Conclusion: Cardiopulmonary rehabilitation nursing has a remarkable effect on COPD patients in stable stage, which can enhance patients' exercise endurance and lung function, reduce adverse emotions, and improve patients' QOL and nursing satisfaction.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8290647PMC
June 2021

Genome-wide gene-smoking interaction study identified novel susceptibility loci for non-small cell lung cancer in Chinese populations.

Carcinogenesis 2021 Oct;42(9):1154-1161

Department of Epidemiology, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing 211166, China.

Gene-smoking interactions play important roles in the development of non-small cell lung cancer (NSCLC). To identify single-nucleotide polymorphisms (SNPs) that modify the association of smoking behavior with NSCLC risk, we conducted a genome-wide gene-smoking interaction study in Chinese populations. The genome-wide interaction analysis between SNPs and smoking status (ever- versus never-smokers) was carried out using genome-wide association studies of NSCLC, which included 13 327 cases and 13 328 controls. Stratified analysis by histological subtypes was also conducted. We used a genome-wide significance threshold of 5 × 10-8 for identifying significant gene-smoking interactions and 1 × 10-6 for identifying suggestive results. Functional annotation was performed to identify potential functional SNPs and target genes. We identified three novel loci with significant or suggestive gene-smoking interaction. For NSCLC, the interaction between rs2746087 (20q11.23) and smoking status reached genome-wide significance threshold [odds ratio (OR) = 0.63, 95% confidence interval (CI): 0.54-0.74, P = 3.31 × 10-8], and the interaction between rs11912498 (22q12.1) and smoking status reached suggestive significance threshold (OR = 0.72, 95% CI: 0.63-0.82, P = 8.10 × 10-7). Stratified analysis by histological subtypes identified suggestive interactions between rs459724 (5q11.2) and smoking status (OR = 0.61, 95% CI: 0.51-0.73, P = 7.55 × 10-8) in the risk of lung squamous cell carcinoma. Functional annotation indicated that both classic and novel biological processes, including nicotine addiction and airway clearance, may modulate the susceptibility to NSCLC. These novel loci provide new insights into the biological mechanisms underlying NSCLC risk. Independent replication in large-scale studies is needed and experimental studies are warranted to functionally validate these associations.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/carcin/bgab064DOI Listing
October 2021

First Report of Maize Ear Rot Caused by Exserohilum rostratum in Hainan Province in Southern China.

Plant Dis 2021 Jul 20. Epub 2021 Jul 20.

Plant Protection Institute of Hebei Academy of Agricultural and Forestry Sciences, Dongguan street NO.437, Baoding, Hebei, China, +8613930861039.

Maize (Zea mays L.) is one of three major grain crops in China, with production reaching 261 million tons in 2019(NBS, 2020). Some fungi cause maize ear rot which lead to significant yield and quality losses. In 2016, about 5% of maize ears were dark brown and covered with a white mould in seed production fields in Lingshui, Hainan Province, China. These ears were brought back to the laboratory for analysis. Molded kernels were surface sterilized in 75% ethanol for 3 min and in 10% sodium hypochlorite for 3 min, subsequently rinsed three times in sterile-distilled water, placed onto potato dextrose agar (PDA), and incubated at 28°C in the dark for 3 days. mycelia tips grown from kernels were transferred into fresh PDA plates. Seven fungal isolates with similar morphology characteristics were obtained, and three of them were identified by morphology and molecular identification. The colonies grew rapidly. The aerial mycelia turned white to black with age. Conidia were straight to slightly curved, oval, pyriform or geniculate, brown to dark brown, and had 2 to 7 septa, with both basal and caudal septa thicker and darker than others, 39.47 to 78.66 ×13.96 to 22.78 μm, with a distinctly protruding hilum swelled from the basal cell. Conidiophores were dark brown, with geniculate tip and many septa. For molecular identification, genomic DNA of isolate was extracted from mycelia. The internal transcribed spacer (ITS), 1,3,8-trihydroxynaphthalene reductase (Brn) and glyceraldehyde-3-phosphate dehydrogenase-like (Gpd) genes were amplified with primers ITS1/ITS4 (White et al. 1990), Brn01/Brn02 (Shimizu et al. 1998) and gpd1/gpd 2 (Berbee et al. 1999) , respectively. BLASTn analysis showed that high identities with Exserohilum rostratum (ITS, LT837845.1, 100%; Brn, AY621165.1, 99.87%; Gpd, LT882543.1, 99.75%). Sequences of ITS, Brn and Gpd were deposited in GenBank with accession numbers MW362495, MW363953 and MW363954, respectively. Based on morphological characteristics and molecular analysis, the isolate was identified as E. rostratum (Hernández-Restrepo et al. 2018). Koch's postulates were completed by using ears of maize inbred line Huangzaosi and Chang7-2 growing in the experimental field of Baoding, Hebei Province. Three days post-silk emergence, each of the four maize ears was injected with 2 ml conidial suspension (1×106 conidia/ml) of isolate ZBSF005 through the silk channel. In the control groups, three ears were inoculated with an equal amount of sterile-distilled water. The inoculated ears grew under natural conditions for 30 days, the diseased kernels and ear tips were black brown and the surface covered with white or gray black mildew layer. The kernels with severe infection were wizened. But the bract could not be infected by the pathogen. Meanwhile, the control remained asymptomatic. The same fungus was successfully re-isolated from the inoculated kernels, and its identity was confirmed by morphological and molecular biology approaches, thus fulfilling Koch's postulates. E. rostratum has been reported to cause leaf spots in a wide range of hosts, such as Calathea picturata, Lagenaria siceraria, Saccharum officinarum, Ananas comosus, Hevea brasiliensis, Zea mays and so on (Chern et al. 2011; Ahmadpour et al. 2013; Choudhary et al. 2018), and it was also reported to cause root rot in Lactuca saliva (Saad et al. 2019). To our knowledge, this is the first report of E. rostratum causing maize ear rot in China. The pathogen was simultaneously inoculated to 8 maize inbred lines in Hebei province, but the disease only occurred in some varieties and the incidence area was large. Therefore, attention should be paid to the prevention and treatment of ear rot caused by this pathogen in the breeding process.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-01-21-0044-PDNDOI Listing
July 2021

Comprehensive analysis of circRNA expression pattern and circRNA-miRNA-mRNA network in oral squamous cell carcinoma.

Oral Oncol 2021 Oct 13;121:105437. Epub 2021 Jul 13.

Department of Epidemiology, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing, China; Jiangsu Key Lab of Cancer Biomarkers, Prevention and Treatment, Collaborative Innovation Center for Cancer Personalized Medicine, Nanjing Medical University, Nanjing, China. Electronic address:

Objective: CircRNAs are critical gene modulators in tumor initiation and progression. However, the expression pattern and molecular pathogenesis of circRNAs in oral squamous cell carcinoma (OSCC) are still poorly characterized.

Methods: RNA sequencing with CIRCexplorer2 pipeline was performed to identify circRNAs in 46 tumor-normal paired tissues from OSCC patients. Another set of 48 head and neck squamous cell carcinoma samples from the MiOncoCirc database were utilized as an independent validation.

Results: Of the 1276 identified high-confidence circRNAs, 154 were differentially expressed between tumor and normal tissues (log|Fold Change|≥1 and false discovery rate < 0.05). CircRNAs expression was globally down-regulated in tumors compared to normal tissues (P = 9.44 × 10). Correlation analysis demonstrated that the global expression of circRNAs was positively related to tumor infiltrating lymphocyte (P = 1.10 × 10) and stromal signature (P = 2.70 × 10) whereas negatively associated with cell proliferation markers (P = 4.32 × 10). CircRNAs-miRNAs-mRNAs regulatory network revealed 6574 interactions, and the target genes were enriched in extracellular matrix and immune-related pathways. Survival analysis were performed on target genes in immune-related pathways, and 20 genes were significantly associated with the prognostic status of OSCC in The Cancer Genome Atlas cohort. The risk model constructed with above 20 genes was associated with the prognosis status of OSCC (HR = 3.28, P = 5.06 × 10), and the result was validated in an independent study (GSE41613) (HR = 2.06, P = 1.73 × 10).

Conclusion: CircRNAs showed a global down-regulation pattern in OSCC tissues, and genes regulated by circRNAs primarily involved in immune and extracellular matrix pathways, which could also affect the OSCC prognosis, indicating that they may serve as potential prognostic biomarkers.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.oraloncology.2021.105437DOI Listing
October 2021

Air Pollution, Genetic Factors, and the Risk of Lung Cancer: A Prospective Study in the UK Biobank.

Am J Respir Crit Care Med 2021 10;204(7):817-825

Department of Epidemiology, Center for Global Health, School of Public Health, and.

Both genetic and environmental factors contribute to lung cancer, but the degree to which air pollution modifies the impact of genetic susceptibility on lung cancer remains unknown. To investigate whether air pollution and genetic factors jointly contribute to incident lung cancer. We analyzed data from 455,974 participants (53% women) without previous cancer at baseline in the UK Biobank. The concentrations of particulate matter (PM) (PM ⩽2.5 μm in aerodynamic diameter [PM], coarse PM between 2.5 μm and 10 μm in aerodynamic diameter [PM], and PM ⩽10 μm in aerodynamic diameter [PM]), nitrogen dioxide (NO), and nitrogen oxides (NO) were estimated by using land-use regression models, and the association between air pollutants and incident lung cancer was investigated by using a Cox proportional hazard model. Furthermore, we constructed a polygenic risk score and evaluated whether air pollutants modified the effect of genetic susceptibility on the development of lung cancer. The results showed significant associations between the risk of lung cancer and PM (hazard ratio [HR], 1.63; 95% confidence interval [CI], 1.33-2.01; per 5 μg/m), PM (HR, 1.53; 95% CI, 1.20-1.96; per 10 μg/m), NO (HR, 1.10; 95% CI, 1.05-1.15; per 10 μg/m), and NO (HR, 1.13; 95% CI, 1.07-1.18; per 20 μg/m). There were additive interactions between air pollutants and the genetic risk. Compared with participants with low genetic risk and low air pollution exposure, those with high air pollution exposure and high genetic risk had the highest risk of lung cancer (PM: HR, 1.71; 95% CI, 1.45-2.02; PM: HR, 1.77; 95% CI, 1.50-2.10; NO: HR, 1.77; 95% CI, 1.42-2.22; NO: HR, 1.67; 95% CI, 1.43-1.95). Long-term exposure to air pollution may increase the risk of lung cancer, especially in those with high genetic risk.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1164/rccm.202011-4063OCDOI Listing
October 2021

, a novel causal agent of maize ear rot and its sensitivity to fungicides.

Plant Dis 2021 Jun 22. Epub 2021 Jun 22.

Plant Protection Institute, Hebei Academy of Agricultural and Forestry Sciences, Baoding, China.

Ear rot is one of the most prevalent and destructive diseases on maize. During field surveys in recent years, it was found that a Penicillium ear rot broke out in some areas of Shanxi, Shaanxi, Hebei and Tianjin in China, with an incidence of 3%-90%. A sp. was isolated from diseased kernels covered with greyish green mold, and three isolates were identified by morphological and molecular characteristics. The pathogenicity of isolate ZBS205 to maize ears was further determined by artificial inoculation in a field. Furthermore, the sensitivity of isolate ZBS205 against six commonly-used fungicides was also evaluated. According to macro- and micro-morphological characteristics, isolate ZBS205 was generally identical to (teleomorph of ). The partial gene sequences of the nuclear ribosomal ITS1-5.8S-ITS2 (ITS) region, , putative ribosome biogenesis protein () and the second largest subunit of the RNA polymerase II () from isolates ZBS205, D49-1 and S73-1 showed the highest nucleotide identity to strain X33, and the phylogenetic analysis conducted by neighbor-joining method with the combined data of the four genes demonstrated that these three isolates clustered with strain X33. These results suggested that the fungus isolated from diseased maize kernels was . Pathogenicity testing showed that the isolate ZBS205 was pathogenic to maize ears, which showed symptoms of rotted cob and deteriorated kernels. This is the first report of as the definitive pathogen causing maize ear rot. The result of fungal sensitivity against fungicides showed that pyraclostrobin exhibited the highest toxicity to mycelial growth and could be used as a candidate agent for the prevention and control of ear rot. Results of the present study provide a basis for understanding ear rot caused by , and should play an important role in disease management.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-04-21-0686-REDOI Listing
June 2021

, a novel causal agent of maize ear rot and its sensitivity to fungicides.

Plant Dis 2021 Jun 22. Epub 2021 Jun 22.

Plant Protection Institute, Hebei Academy of Agricultural and Forestry Sciences, Baoding, China.

Ear rot is one of the most prevalent and destructive diseases on maize. During field surveys in recent years, it was found that a Penicillium ear rot broke out in some areas of Shanxi, Shaanxi, Hebei and Tianjin in China, with an incidence of 3%-90%. A sp. was isolated from diseased kernels covered with greyish green mold, and three isolates were identified by morphological and molecular characteristics. The pathogenicity of isolate ZBS205 to maize ears was further determined by artificial inoculation in a field. Furthermore, the sensitivity of isolate ZBS205 against six commonly-used fungicides was also evaluated. According to macro- and micro-morphological characteristics, isolate ZBS205 was generally identical to (teleomorph of ). The partial gene sequences of the nuclear ribosomal ITS1-5.8S-ITS2 (ITS) region, , putative ribosome biogenesis protein () and the second largest subunit of the RNA polymerase II () from isolates ZBS205, D49-1 and S73-1 showed the highest nucleotide identity to strain X33, and the phylogenetic analysis conducted by neighbor-joining method with the combined data of the four genes demonstrated that these three isolates clustered with strain X33. These results suggested that the fungus isolated from diseased maize kernels was . Pathogenicity testing showed that the isolate ZBS205 was pathogenic to maize ears, which showed symptoms of rotted cob and deteriorated kernels. This is the first report of as the definitive pathogen causing maize ear rot. The result of fungal sensitivity against fungicides showed that pyraclostrobin exhibited the highest toxicity to mycelial growth and could be used as a candidate agent for the prevention and control of ear rot. Results of the present study provide a basis for understanding ear rot caused by , and should play an important role in disease management.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-04-21-0686-REDOI Listing
June 2021

Association of assisted reproductive technology, germline de novo mutations and congenital heart defects in a prospective birth cohort study.

Cell Res 2021 Aug 9;31(8):919-928. Epub 2021 Jun 9.

State Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing, Jiangsu, China.

Emerging evidence suggests that children conceived through assisted reproductive technology (ART) have a higher risk of congenital heart defects (CHDs) even when there is no family history. De novo mutation (DNM) is a well-known cause of sporadic congenital diseases; however, whether ART procedures increase the number of germline DNM (gDNM) has not yet been well studied. Here, we performed whole-genome sequencing of 1137 individuals from 160 families conceived through ART and 205 families conceived spontaneously. Children conceived via ART carried 4.59 more gDNMs than children conceived spontaneously, including 3.32 paternal and 1.26 maternal DNMs, after correcting for parental age at conception, cigarette smoking, alcohol drinking, and exercise behaviors. Paternal DNMs in offspring conceived via ART are characterized by C>T substitutions at CpG sites, which potentially affect protein-coding genes and are significantly associated with the increased risk of CHD. In addition, the accumulation of non-coding functional mutations was independently associated with CHD and 87.9% of the mutations were originated from the father. Among ART offspring, infertility of the father was associated with elevated paternal DNMs; usage of both recombinant and urinary follicle-stimulating hormone and high-dosage human chorionic gonadotropin trigger was associated with an increase of maternal DNMs. In sum, the increased gDNMs in offspring conceived by ART were primarily originated from fathers, indicating that ART itself may not be a major reason for the accumulation of gDNMs. Our findings emphasize the importance of evaluating the germline status of the fathers in families with the use of ART.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41422-021-00521-wDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8324888PMC
August 2021

Adolescents experienced more treatment failure than children with chronic myeloid leukemia receiving imatinib as frontline therapy: a retrospective multicenter study.

Ann Hematol 2021 Sep 5;100(9):2215-2228. Epub 2021 Jun 5.

Peking University People's Hospital, Peking University Institute of Hematology, National Clinical Research Center for Hematologic Disease, Beijing Key Laboratory of Hematopoietic Stem Cell Transplantation, Beijing, China.

To explore the differences in the clinical features, treatment responses, and outcomes among children, adolescents, and adults with chronic myeloid leukemia in the chronic phase (CML-CP) receiving imatinib as first-line therapy. Data from children (0-8 years for girls and 0-10 years for boys), adolescents (9-19 years for girls and 11-19 years for boys), and adults (age ≥ 20 years) with newly diagnosed CML-CP receiving imatinib as first-line therapy between 2006 and 2019 were retrospectively reviewed. In total, 135 children (cohort 1), 189 adolescents (cohort 2), and 658 adults (cohort 3: age 20-39 years, n = 305; cohort 4: age 40-59 years, n = 270; and cohort 5: age 60-83 years, n = 83) were included in this study. When compared with children, adolescents showed a significantly higher white blood cell count (P = 0.033) and basophil percentage in peripheral blood (P = 0.002) and a significantly higher prevalence of splenomegaly (P = 0.004). Both children and adolescents presented with more aggressive clinical features than adults. During median follow-ups of 28 months (range, 3-161 months) in children, 33 months (range, 3-152 months) in adolescents, and 48 months (range, 3-157 months) in adults, multivariate analysis showed that children and adolescents had higher probabilities of achieving complete cytogenetic response, major molecular response, and molecular response. Notably, compared with not only adults (cohort 3 vs. cohort 1: HR = 2.03 [1.03, 3.98], P = 0.040; cohort 4 vs. cohort 1: HR = 2.15 [1.07, 4.33], P = 0.033; cohort 5 vs. cohort 1: HR = 4.22 [1.94, 9.15], P < 0.001) but also adolescents (cohort 2 vs. cohort 1: HR = 2.36 [1.18, 4.72], P = 0.015), children had significantly longer failure-free survival. Age was not associated with progression-free survival or overall survival. Although they exhibited more aggressive clinical features at diagnosis, both children and adolescents achieved superior treatment responses than adults. Adolescents showed even more adverse features and a poor FFS than children.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00277-021-04544-6DOI Listing
September 2021

Genetic variants associated with expression of contribute to the risk of head and neck cancer in Chinese population.

J Med Genet 2021 Mar 5. Epub 2021 Mar 5.

Department of Epidemiology, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing, China

Background: Squamous cell carcinoma of the head and neck (SCCHN) is one of the most common cancers worldwide and includes cancers arising from the oral cavity, pharynx and larynx. Genome-wide association studies have found several genetic variants related to the risk of SCCHN; however, they could only explain a small fraction of the heritability. Thus, more susceptibility loci associated with SCCHN need to be identified.

Methods: An association study was conducted by genotyping 555 patients with SCCHN and 1367 controls in a Chinese population. Single-variant association analysis was conducted on 63 373 SNPs, and the promising variants were then confirmed by a two-stage validation with 1875 SCCHN cases and 4637 controls. Bioinformatics analysis and functional assays were applied to uncover the potential pathogenic mechanism of the promising variants and genes associated with SCCHN.

Results: We first identified three novel genetic variants significantly associated with the risk of SCCHN (p=7.45×10 for rs2517611 at 6p22.1, p=1.76×10 for rs2524182 at 6p21.33 and p=2.17×10 for rs3131018 at 6p21.33). Further analysis and biochemical assays showed that rs3094187, which was in a region in high linkage disequilibrium with rs3131018, could modify expression by regulating the binding affinity of the transcription factor to the promoter of . In addition, experiments revealed that the inhibition of may affect several important pathways involved in tumourigenesis and attenuate the cell proliferation and migration of SCCHN.

Conclusion: These findings offer important evidence that functional genetic variants could contribute to development of SCCHN and that may function as a putative susceptibility gene for SCCHN.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1136/jmedgenet-2020-107410DOI Listing
March 2021

Identification of A-to-I RNA editing profiles and their clinical relevance in lung adenocarcinoma.

Sci China Life Sci 2021 May 27. Epub 2021 May 27.

Department of Epidemiology, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing, 211166, China.

Adenosine-to-inosine (A-to-I) RNA editing is a widespread posttranscriptional modification that has been shown to play an important role in tumorigenesis. Here, we evaluated a total of 19,316 RNA editing sites in the tissues of 80 lung adenocarcinoma (LUAD) patients from our Nanjing Lung Cancer Cohort (NJLCC) and 486 LUAD patients from the TCGA database. The global RNA editing level was significantly increased in tumor tissues and was highly heterogeneous across patients. The high RNA editing level in tumors was attributed to both RNA (ADAR1 expression) and DNA alterations (mutation load). Consensus clustering on RNA editing sites revealed a new molecular subtype (EC3) that was associated with the poorest prognosis of LUAD patients. Importantly, the new classification was independent of classic molecular subtypes based on gene expression or DNA methylation. We further proposed a simplified model including eight RNA editing sites to accurately distinguish the EC3 subtype in our patients. The model was further validated in the TCGA dataset and had an area under the curve (AUC) of the receiver operating characteristic curve of 0.93 (95%CI: 0.91-0.95). In addition, we found that LUAD cell lines with the EC3 subtype were sensitive to four chemotherapy drugs. These findings highlighted the importance of RNA editing events in the tumorigenesis of LUAD and provided insight into the application of RNA editing in the molecular subtyping and clinical treatment of cancer.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s11427-020-1928-0DOI Listing
May 2021

Potential functional variants of KIAA genes are associated with breast cancer risk in a case control study.

Ann Transl Med 2021 Apr;9(7):549

Department of Epidemiology, International Joint Research Center on Environment and Human Health, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing, China.

Background: KIAA genes identified in the Kazusa cDNA-sequencing project may play important roles in biological processes and are involved in carcinogenesis of many cancers. Genetic variants of KIAA genes are implicated in the abnormal expression of these genes and are linked to susceptibility of several human complex diseases.

Methods: The differentially expressed KIAA genes were screened and identified in The Cancer Genome Atlas (TCGA) database of breast cancer. A total of 48 variants located in the 28 KIAA genes were selected to investigate the associations between polymorphism and breast cancer in 1,032 cases and 1,063 cancer-free controls in a Chinese population.

Results: Two coding variants, which included a SNP rs2306369 in and a SNP rs1205434 in , were identified to be associated with the incidences of breast cancer. Logistic regression analysis showed that the SNP rs2306369 G allele was associated with a decreased risk of breast cancer (additive model: OR =0.81, 95% CI: 0.66-0.99, P=0.038), whereas the SNP rs1205434 A allele was involved with a higher risk of breast cancer (additive model: OR =1.19, 95% CI: 1.02-1.38, P= 0.025). Further stratified analysis revealed that the SNP rs1205434 showed a significant difference for age at menarche strata (heterogeneity test P=0.009). Multiplicative interaction analysis indicated that there was positive multiplicative interaction between the SNP rs1205434 and menarche age (OR =1.09, 95% CI: 1.01-1.17, P=0.036). Additionally, expression quantitative trait loci analysis revealed that the SNP rs1205434 A allele could decrease the expression in the Genotype-Tissue Expression (GTEx) database (P=0.002). The Kaplan-Meier plotter showed that breast cancer patients with high expression have significantly better outcomes than those with low levels of expression (HR =0.84, 95% CI: 0.72-0.99, P=0.033).

Conclusions: The results indicate that the genetic variants (rs2306369 and rs1205434) in the coding region of and respectively may affect Chinese females' breast cancer susceptibility and act as potential predictive biomarkers for breast cancer.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.21037/atm-20-6108DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8105804PMC
April 2021

Classification of non-acute bronchial asthma according to allergy and eosinophil characteristics: a retrospective study.

Allergy Asthma Clin Immunol 2021 May 3;17(1):45. Epub 2021 May 3.

Department of Respiratory and Critical Care Medicine, The First Hospital of Shanxi Medical University, Taiyuan, Shanxi, China.

Background: Investigating the endotypes of the different asthma phenotypes would help disease monitoring, prognosis determination, and improving asthma management standardization. This study aimed to classify asthma into four endotypes according to the allergic and eosinophilic characteristics and explore the phenotypes (clinical characteristics, pulmonary functions, and fractional expired nitric oxide (FeNO)) of each endotype.

Methods: This retrospective study included non-acute asthma patients treated at the First Hospital of Shanxi Medical University (05/2016-01/2018). The patients were classified into the eosinophilic allergic, eosinophilic non-allergic, non-eosinophilic allergic, and non-eosinophilic non-allergic asthma endotypes. Serum sIgE, lung function, FeNO, and induced sputum cytology were tested and compared among groups.

Results: Of the 171 included patients, 22 had eosinophilic allergic asthma, 17 had eosinophilic non-allergic asthma, 66 had non-eosinophilic allergic asthma, and 66 had non-eosinophilic non-allergic asthma. Lung function measurements (FEV1%, FEF25%, FEF50%, FEF75%, and FEF25-75%) showed that airway dysfunction was worse in eosinophilic non-allergic asthma than in the other three endotypes (all P < 0.001). In allergic asthma patients, eosinophilic asthma had worse airway dysfunction than non-eosinophilic asthma (all P < 0.05). Similar results were found in non-allergic asthma (all P < 0.01). The FeNO levels in eosinophilic allergic asthma were higher than in eosinophilic non-allergic and non-eosinophilic non-allergic asthma (both P = 0.001).

Conclusions: FeNO can objectively reflect eosinophilic airway inflammation in asthma. Endotypic classification of asthma patients regarding the allergic and eosinophilic characteristics is conducive to the effective management of patients with asthma.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1186/s13223-021-00546-1DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8091754PMC
May 2021

A cross-tissue transcriptome-wide association study identifies novel susceptibility genes for lung cancer in Chinese populations.

Hum Mol Genet 2021 Aug;30(17):1666-1676

Department of Epidemiology, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing 211166, China.

Although dozens of susceptibility loci have been identified for lung cancer in genome-wide association studies (GWASs), the susceptibility genes and underlying mechanisms remain unclear. In this study, we conducted a cross-tissue transcriptome-wide association study (TWAS) with UTMOST based on summary statistics from 13 327 lung cancer cases and 13 328 controls and the genetic-expression matrix over 44 human tissues in the Genotype-Tissue Expression (GTEx) project. After further evaluating the associations in each tissue, we revealed 6 susceptibility genes in known loci and identified 12 novel ones. Among those, five novel genes, including DCAF16 (Pcross-tissue = 2.57 × 10-5, PLung = 2.89 × 10-5), CBL (Pcross-tissue = 5.08 × 10-7, PLung = 1.82 × 10-4), ATR (Pcross-tissue = 1.45 × 10-5, PLung = 9.68 × 10-5), GYPE (Pcross-tissue = 1.45 × 10-5, PLung = 2.17 × 10-3) and PARD3 (Pcross-tissue = 5.79 × 10-6, PLung = 4.05 × 10-3), were significantly associated with the risk of lung cancer in both cross-tissue and lung tissue models. Further colocalization analysis indicated that rs7667864 (C > A) and rs2298650 (G > T) drove the GWAS association signals at 4p15.31-32 (OR = 1.09, 95%CI: 1.04-1.12, PGWAS = 5.54 × 10-5) and 11q23.3 (OR = 1.08, 95%CI: 1.04-1.13, PGWAS = 5.55 × 10-5), as well as the expression of DCAF16 (βGTEx = 0.24, PGTEx = 9.81 × 10-15; βNJLCC = 0.29, PNJLCC = 3.84 × 10-8) and CBL (βGTEx = -0.17, PGTEx = 2.82 × 10-8; βNJLCC = -0.32, PNJLCC = 2.61 × 10-7) in lung tissue. Functional annotations and phenotype assays supported the carcinogenic effect of these novel susceptibility genes in lung carcinogenesis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/hmg/ddab119DOI Listing
August 2021

Mutations in the sodium channel genes SCN1A, SCN3A, and SCN9A in children with epilepsy with febrile seizures plus(EFS+).

Seizure 2021 May 9;88:146-152. Epub 2021 Apr 9.

The Second School of Clinical Medicine, Southern Medical University, Guangzhou, Guangdong Province, China; Department of Pediatrics, Guangdong Provincial People's Hospital, Guangdong Academy of Medical Sciences, Guangzhou, Guangdong Province, China. Electronic address:

Purpose: To explore disease-causing gene mutations of epilepsy with febrile seizures plus (EFS+) in Southern Chinese Han population.

Methods: Blood samples and clinical data were collected from 49 Southern Han Chinese patients with EFS+. Gene screening was performed using whole-exome sequencing and panel sequencing for 485 epilepsy-related genes. The pathogenicity of variants was evaluated based on ACMG scoring and assessment of clinical concordance.

Results: We identified 10 putatively causative sodium channel gene variants in 49 patients with EFS+, including 8 variants in SCN1A (R500Q appeared twice), one in SCN3A and one in SCN9A. All these missense mutations were inherited from maternal or paternal and were evaluated to be of uncertain significance according to ACMG. The clinical features of patients were in concordance with the EFS+ phenotype of the mutated SCN1A, SCN3A and SCN9A gene. The clinical phenotypes of 11 probands with these gene variants included febrile seizures plus (FS+, n=7), Dravet Syndrome (n=3), FS+ with focal seizures (n=1). Three probands with SCN1A variants (R500Q located in the non-voltage areas, or G1711D in the pore-forming domain) developed severe Dravet syndrome. The affected individuals with the other 6 SCN1A variants located outside the pore-forming domain showed mild phenotypes. Novel SCN3A variant ((D1688Y) and SCN9A variant (R185H) were identified in two probands respectively and both of the probands had FS+.

Conclusion: The SCN1A, SCN3A, and SCN9A gene mutations might be a pathogenic cause of EFS+ in Southern Chinese Han population.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.seizure.2021.04.006DOI Listing
May 2021

The Effect of Acupuncture on Glucose Metabolism and Lipid Profiles in Patients with PCOS: A Systematic Review and Meta-Analysis of Randomized Controlled Trials.

Evid Based Complement Alternat Med 2021 22;2021:5555028. Epub 2021 Mar 22.

Department of Traditional Chinese Medicine, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou, China.

Objective: To evaluate the effectiveness of acupuncture on glucose metabolism and lipid profiles in patients with polycystic ovary syndrome (PCOS).

Methods: Databases, including the China National Knowledge Infrastructure (CNKI), the China Science and Technology Journal Database (VIP), Wanfang, PubMed, and the Cochrane Library were searched for the relevant literature, with the retrieval deadline being February 2020. Two reviewers independently screened, selected, and extracted the data and validated the results. The methodological quality of the included studies was evaluated with the risk of bias tool, and the meta-analysis was performed using the RevMan 5.3.5 software.

Results: A total of 737 patients with PCOS from 10 randomized controlled trials were included in the meta-analysis. A pooled analysis showed significant decreases in body mass index (mean difference (MD) = -1.47, 95% CI -2.35 to -0.58,  < 0.001) and waist-to-hip ratio (MD = -0.04, 95% CI [-0.06, -0.02],  < 0.001) in the acupuncture group along with significant improvements in fasting plasma glucose (MD = -0.38, 95% CI [-0.70, -0.07],  = 0.02), homeostasis model assessment of insulin resistance (MD = -0.22, 95% CI [-0.41, -0.02],  = 0.03), and triglycerides (MD = -0.26, 95% CI [-0.48, -0.04],  = 0.02). No significant differences were observed in the Ferriman-Gallwey score, 2 h fasting plasma glucose, fasting insulin, 2 h fasting insulin, serum total cholesterol, low-density lipoprotein cholesterol, or high-density lipoprotein cholesterol.

Conclusion: Acupuncture is relatively effective and safe in improving glucose metabolism and insulin sensitivity in patients with PCOS. The included studies were generally of not bad methodological quality, but further large-scale, long-term randomized controlled trials with rigorous methodological standards are still warranted.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2021/5555028DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8007365PMC
March 2021

Relationships between sleep traits and lung cancer risk: a prospective cohort study in UK Biobank.

Sleep 2021 Sep;44(9)

Department of Epidemiology, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing, China.

Study Objectives: To prospectively investigate the association between sleep traits and lung cancer risk, accounting for the interactions with genetic predisposition of lung cancer.

Methods: We included 469 691 individuals free of lung cancer at recruitment from UK Biobank, measuring sleep behaviors with a standardized questionnaire and identifying incident lung cancer cases through linkage to national cancer and death registries. We estimated multivariable-adjusted hazard ratios (HRs) for lung cancer (2177 incident cases) across four sleep traits (sleep duration, chronotype, insomnia, and snoring) and examined the interaction and joint effects with a lung cancer polygenic risk score.

Results: A U-shaped association was observed for sleep duration and lung cancer risk, with an 18% higher risk (95% confidence interval [CI]: 1.07 to 1.30) for short sleepers and a 17% higher risk (95% CI: 1.02 to 1.34) for long sleepers compared with normal sleepers (7-8 h/day). Evening preference was associated with elevated lung cancer risk compared with morning preference (HR: 1.25; 95% CI: 1.07 to 1.46), but no association was found for insomnia or snoring. Compared with participants with favorable sleep traits and low genetic risk, those with both unfavorable sleep duration (<7 hours or >8 hours) or evening preference and high genetic risk showed the greatest lung cancer risk (HRsleep duration: 1.83; 95% CI: 1.47 to 2.27; HRchronotype: 1.85; 95% CI: 1.34 to 2.56).

Conclusions: Both unfavorable sleep duration and evening chronotype were associated with increased lung cancer incidence, especially for those with low to moderate genetic risk. These results indicate that sleep behaviors as modifiable risk factors may have potential implications for lung cancer risk.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/sleep/zsab089DOI Listing
September 2021

First Report of Root Rot Caused by on Maize in Hebei Province.

Plant Dis 2021 Mar 9. Epub 2021 Mar 9.

Plant Protection Institute of Hebei Academy of Agricultural and Forestry Sciences, IPM Centre of Hebei Province, Key Laboratory of IPM on Crops in Northern Region of North China, Ministry of Agriculture and Rural Affairs, Baoding, China;

Maize ( L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as (G.L. Stout) Shoemaker (teleomorph = R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of (GenBank Accession MH864760). The sequence of gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was . Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of . Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch's postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of on maize root. mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS-01-21-0060-PDNDOI Listing
March 2021

Sex-specific associations of circulating testosterone levels with all-cause and cause-specific mortality.

Eur J Endocrinol 2021 May;184(5):723-732

Department of Epidemiology and Biostatistics, International Joint Research Center on Environment and Human Health, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing, China.

Objective: Testosterone is a critical determinant of health in both genders. However, the relationship between circulating levels of testosterone and mortality remains undetermined.

Methods: We examined the associations of serum total testosterone (TT) and free testosterone (FT) with all-cause and cause-specific mortality in 154 965 men and 93 314 postmenopausal women from UK Biobank. Cox regression models were used to calculate the hazard ratios (HR) and 95% CIs. Given multiple testing, P < 0.005 was considered statistically significant.

Results: Over a median follow-up of 8.9 (inter-quartile range: 8.3-9.5) years, we documented 5754 deaths in men, including 1243 (21.6%) from CVD and 2987 (51.9%) from cancer. In postmenopausal women, 2435 deaths occurred, including 346 (14.2%) from CVD and 1583 (65.0%) from cancer. TT and FT concentrations were inversely associated with all-cause mortality in men, with the multivariable HR of 0.82 (95% CI: 0.75-0.91) and 0.80 (95% CI: 0.73-0.87) for the highest (Q5) vs the lowest quintile (Q1), respectively. In postmenopausal women, TT concentrations showed a positive association with all-cause mortality (HR for Q5 vs Q1 = 1.20, 95% CI: 1.06-1.37). Furthermore, higher TT and FT concentrations were associated with a lower risk of cancer mortality in men (both P for trend = 0.001), whereas TT concentrations were suggestively associated with a higher risk of cancer mortality in postmenopausal women (P for trend = 0.03).

Conclusions: Our findings suggest that high levels of circulating testosterone may be beneficial for all-cause and cancer mortality in men but detrimental in postmenopausal women.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1530/EJE-20-1253DOI Listing
May 2021
-->