Publications by authors named "Hamideh Sabbaghi"

38 Publications

New criteria for evaluation of electroretinogram in patients with retinitis pigmentosa.

Doc Ophthalmol 2021 Jun 30. Epub 2021 Jun 30.

Ophthalmic Research Center, Research Institute for Ophthalmology and Vision Science, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Background: Electroretinogram (ERG) plays an essential role in the diagnosis of retinal disease. Choosing appropriate methods could extract valuable information from ERG. In this study, a new criterion based on time-frequency domain analysis was proposed to investigate the retina in retinitis pigmentosa (RP) patients.

Materials And Methods: The total number of 16 eyes from eight RP patients and 20 eyes from age-matched healthy subjects were assessed. The signals included photopic and scotopic ERGs. Continuous wavelet transform was applied to ERGs. Dominant frequencies were extracted, and the contours related to these dominant frequencies were selected. As a new criterion, the areas related to dominant frequency contours were considered a feature to differentiate the RP and normal groups. To better evaluate the proposed criterion results, the time-domain analysis characteristics of ERG were also considered.

Results: The results showed an increase in implicit time and reduced amplitude in RP patients (P < 0.05). A significant decrease of dominant frequencies and increasing their occurrence time were seen in ERG of RP patients. Also, in RP patients, the third dominant frequency was disappeared from the three main frequencies observed in photopic ERGs of normal subjects. The area criterion showed a significant decrease in RP groups (P < 0.05).

Conclusion: RP can cause changes in the time and time-frequency components of the ERG. The area index could represent a new view of the characteristics of the ERG in the time-frequency domain. This criterion can help the ophthalmologist to have a better evaluation of retinal disease.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s10633-021-09843-xDOI Listing
June 2021

Unraveling the genetic complexities of combined retinal dystrophy and hearing impairment.

Hum Genet 2021 Jun 20. Epub 2021 Jun 20.

Institute of Human Genetics, Julius Maximilians University Würzburg, 97074, Würzburg, Germany.

Usher syndrome, the most prevalent cause of combined hereditary vision and hearing impairment, is clinically and genetically heterogeneous. Moreover, several conditions with phenotypes overlapping Usher syndrome have been described. This makes the molecular diagnosis of hereditary deaf-blindness challenging. Here, we performed exome sequencing and analysis on 7 Mexican and 52 Iranian probands with combined retinal degeneration and hearing impairment (without intellectual disability). Clinical assessment involved ophthalmological examination and hearing loss questionnaire. Usher syndrome, most frequently due to biallelic variants in MYO7A (USH1B in 16 probands), USH2A (17 probands), and ADGRV1 (USH2C in 7 probands), was diagnosed in 44 of 59 (75%) unrelated probands. Almost half of the identified variants were novel. Nine of 59 (15%) probands displayed other genetic entities with dual sensory impairment, including Alström syndrome (3 patients), cone-rod dystrophy and hearing loss 1 (2 probands), and Heimler syndrome (1 patient). Unexpected findings included one proband each with Scheie syndrome, coenzyme Q10 deficiency, and pseudoxanthoma elasticum. In four probands, including three Usher cases, dual sensory impairment was either modified/aggravated or caused by variants in distinct genes associated with retinal degeneration and/or hearing loss. The overall diagnostic yield of whole exome analysis in our deaf-blind cohort was 92%. Two (3%) probands were partially solved and only 3 (5%) remained without any molecular diagnosis. In many cases, the molecular diagnosis is important to guide genetic counseling, to support prognostic outcomes and decisions with currently available and evolving treatment modalities.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00439-021-02303-1DOI Listing
June 2021

Virtual Reality Game Playing in Amblyopia Therapy: A Randomized Clinical Trial.

J Pediatr Ophthalmol Strabismus 2021 May-Jun;58(3):154-160. Epub 2021 May 1.

Purpose: To compare the visual outcome of occlusion therapy with virtual reality game playing as a new therapy for children with amblyopia.

Methods: This randomized clinical trial was performed on 50 children between 4 and 10 years old who had unilateral amblyopia. They were randomly divided into virtual reality and patching groups (n = 25 in each). The virtual reality group was trained binocularly using the virtual reality games through a head set for 1 hour per day 5 days a week for 4 weeks. Patients in the patching group occluded their non-amblyopic eyes 2, 4, and 6 hours for mild (best corrected visual acuity [BCVA] 0.2 to 0.3 logarithm of the minimum angle of resolution [logMAR]), moderate (0.3 to 0.6 logMAR), and severe (worse than 0.6 logMAR) amblyopia, respectively.

Results: The mean BCVA based on logMAR units improved significantly in both groups ( < .0001), but the difference between the two groups was not significant ( = .59). BCVA based on the responded letters improved in both groups (virtual reality: = .0001, patching: = .001), and change in BCVA in the virtual reality group was higher than in the patching group ( = .002).

Conclusions: Virtual reality game playing was equal or superior to patching in an analysis of linear and letter BCVA, respectively. Therefore, applying this new amblyopia therapy is recommended. .
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3928/01913913-20210108-02DOI Listing
May 2021

Autosomal Recessive Bestrophinopathy: Clinical and Genetic Characteristics of Twenty-Four Cases.

J Ophthalmol 2021 30;2021:6674290. Epub 2021 Apr 30.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Background: To describe ocular manifestations, imaging characteristics, and genetic test results of autosomal recessive bestrophinopathy (ARB). The study design is an observational case series.

Methods: Forty-eight eyes of 24 patients diagnosed with ARB underwent complete ophthalmic examinations including refraction, anterior and posterior segment examination, enhanced depth imaging optical coherence tomography (EDI-OCT), fluorescein angiography (FA), electroretinography (ERG), and electrooculography (EOG). Optical coherence tomography angiography (OCTA) and BEST1 gene sequencing were performed in selected patients.

Results: The age at onset was 4-35 years (mean: 18.6 years). The male-to-female ratio was 0.45. All patients were hyperopic, except one with less than one diopter myopia. EOG was abnormal in 18 cases with near-normal ERGs. Six patients did not undergo EOG due to their young age. Eighteen patients (75%) had a thick choroid on EDI-OCT, of which three had advanced angle-closure glaucoma, 15 patients were hyperopic, and eight of them had more than four diopters hyperopia in both eyes. Macular retinoschisis was observed in 46 eyes of 23 patients (95%) with cysts mostly located in the inner nuclear layer (INL) to the outer nuclear layer (ONL). Of the 18 patients who underwent FA, mild peripheral leakage was seen in eight eyes of four patients (22%). Subfoveal choroidal neovascularization (CNV) was seen in three eyes of two patients (6%) that responded well to intravitreal bevacizumab (IVB). Seven mutations of the bestrophin-1 (BEST1) gene were found in this study; however, only two of them (p.Gly34 = and p.Leu319Pro) had been previously reported as the cause of ARB based on ClinVar and other literature studies.

Conclusions: ARB can be presented with a wide spectrum of ocular abnormalities that may not be easily diagnosed. Pachychoroid can occur alongside retinal schisis and may be the underlying cause of angle-closure glaucoma in ARB. Our study also expands the pathogenic mutation spectrum of the BEST1 gene associated with ARB.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2021/6674290DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8105111PMC
April 2021

Lateral rectus resection versus lateral rectus plication in patients with residual Esotropia.

Strabismus 2020 12 21;28(4):194-200. Epub 2020 Oct 21.

Basir Eye Health Research Center, Basir Eye Clinic , Tehran.

This study was aimed to compare the surgical outcomes of lateral rectus plication and resection techniques on patients with residual esotropia. In this randomized clinical trial, a total of 57 patients with residual esotropia (31 females) who were candidates for lateral rectus resection were randomized into plication (n = 27) and resection (n = 30) groups. The inclusion criteria were residual Esotropia after uni- or bilateral medial rectus recession. Subjects with a history of prematurity, lack of central fixation, extraocular muscle palsy, systemic, ocular disorders, history of lateral rectus operation, or follow up less than 3 months were excluded. Ophthalmic examinations were conducted preoperatively and at 1, 3-, and 6-month follow-ups. Surgical success rate was considered postoperative eso- or exotropia ≤10 pd. Based on the study results, there was no statistically significant difference between the two groups regarding the pre- (plication: 27.9 ± 9.8 pd and resection: 26.4 ± 7.6 pd; P = .52) and postoperative mean angle of deviation at far distance in month 3 (plication: 5.1 ± 7.1 pd and resection: 5.4 ± 3.2 pd; P = .82). Postoperative success rate also showed similarity between these two groups at all postoperative follow-ups of months 1, 3, and 6.There was no statistically significant difference between dose responses of these groups in uni- or bilateral operations. In conclusion, lateral rectus plication and resection showed statistically similar results. Each surgical method could be selected according to surgeon's skill and comfort. We recommend plication method for patients with postoperative probability of anterior segment ischemia.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/09273972.2020.1832544DOI Listing
December 2020

Comparison of medial rectus resection and plication in exotropic patients.

Int Ophthalmol 2021 Jan 18;41(1):11-19. Epub 2020 Oct 18.

Department of Optometry, School of Rehabilitation, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To compare the surgical outcomes of the plication technique with the resection method to treat exotropic patients.

Methods: In this prospective randomized clinical trial, a total of 52 exotropic patients (27 females and 25 males) who were candidates for medial rectus resection were randomly classified into the plication (n = 24) and resection (n = 28) groups. Comprehensive ophthalmic examination included cyclorefraction, assessment of the best corrected visual acuity (BCVA), evaluation of the extraocular muscle, ocular deviation measurement and stereopsis measured using a Titmus test. Ocular anterior and posterior segments were examined using slit-lamp and indirect ophthalmoscopy. Patients were randomly divided to medial rectus plication and medial rectus resection groups. The plication technique was the same as for resection, but in the last step the muscle was folded. Examinations were repeated at the 1- and 3-day as well as 1-, 2-, 3- and 6-month follow-ups. If the postoperative ocular deviation was in the range of 5 PD esotropia to 10 PD exotropia, it was considered a successful surgical outcome.

Results: Results show that there was no statistically significant difference between the two groups regarding near and far deviations (P = 0.298, P = 0.103), surgical dose response (P = 0.904) and postoperative success rate (plication, 87% and resection, 89.3%, P > 0.99). Reoperation was needed in 13% and 10.7% of the plication and resection groups, respectively (P > 0.05).

Conclusions: Medial rectus plication is an effective and appropriate alternative option for medial rectus resection in exotropic patients.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s10792-020-01546-7DOI Listing
January 2021

Choroidal Thickness in Different Types of Inherited Retinal Dystrophies.

J Ophthalmic Vis Res 2020 Jul-Sep;15(3):351-361. Epub 2020 Aug 6.

Ocular Tissue Engineering Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To compare the choroidal thickness among eyes with retinitis pigmentosa (RP), Stargardt disease, Usher syndrome, cone-rod dystrophy, and healthy eyes of sex- and age-matched individuals.

Methods: In this comparative study, 503 eyes with RP ( = 264), cone-rod dystrophy ( = 109), Stargardt disease ( = 76), and Usher syndrome ( = 54) were included. To validate the data, 109 healthy eyes of 56 sex- and age-matched individuals were studied as controls. Choroidal imaging was performed using enhanced depth imaging-optical coherence tomography. Choroidal thickness was measured manually using MATLAB software at 13 points in nasal and temporal directions from the foveal center with the interval of 500 µm and the choroidal area encompassing the measured points was calculated automatically.

Results: The mean age was 36.33 13.07 years (range, 5 to 72 years). The mean choroidal thickness at 13 points of the control eyes was statistically significantly higher than that in eyes with RP ( 0.001) and Usher syndrome ( 0.05), but not significantly different from that in eyes with Stargardt disease and cone-rod dystrophy. Among different inherited retinal dystrophies (IRDs), the choroidal thickness was the lowest in eyes with RP ( 0.001). Choroidal thickness in the subfoveal area correlated negatively with best-corrected visual acuity ( = 0.264, 0.001) and the duration of ocular symptoms ( = 0.341, 0.001) in all studied IRDs. No significant correlation was observed between the subfoveal choroidal thickness and central macular thickness ( = 0.24, = 0.576).

Conclusion: Choroidal thinning in four different types of IRDs does not follow a similar pattern and depends on the type of IRD and the duration of ocular symptoms. A larger cohort is required to verify these findings.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18502/jovr.v15i3.7454DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7431727PMC
August 2020

The First Inherited Retinal Disease Registry in Iran: Research Protocol and Results of a Pilot Study.

Arch Iran Med 2020 07 1;23(7):445-454. Epub 2020 Jul 1.

Ophthalmic Research Center, Research Institute for Ophthalmology and Vision Science, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Background: To describe the protocol for developing a national inherited retinal disease (IRD) registry in Iran and present its initial report.

Methods: This community-based participatory research was approved by the Ministry of Health and Medical Education of Iran in 2016. To provide the minimum data set (MDS), several focus group meetings were held. The final MDS was handed over to an engineering team to develop a web-based software. In the pilot phase, the software was set up in two referral centers in Iran. Final IRD diagnosis was made based on clinical manifestations and genetic findings. Ultimately, patient registration was done based on all clinical and non-clinical manifestations.

Results: Initially, a total of 151 data elements were approved with Delphi technique. The registry software went live at www. IRDReg.org based on DHIS2 open source license agreement since February 2016. So far, a total of 1001 patients have been registered with a mean age of 32.41±15.60 years (range, 3 months to 74 years). The majority of the registered patients had retinitis pigmentosa (42%, 95% CI: 38.9% to 45%). Genetic testing was done for approximately 20% of the registered individuals.

Conclusion: Our study shows successful web-based software design and data collection as a proof of concept for the first IRD registry in Iran. Multicenter integration of the IRD registry in medical centers throughout the country is well underway as planned. These data will assist researchers to rapidly access information about the distribution and genetic patterns of this disease.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.34172/aim.2020.41DOI Listing
July 2020

Time-Frequency Analysis of Photopic Negative Response in CRVO Patients.

Semin Ophthalmol 2020 Apr 25;35(3):187-193. Epub 2020 Jun 25.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: The PhNR is driven by retinal ganglion cells (RGCs). Therefore, the function of RGCs could be objectively evaluated by analyzing the PhNR. The aim of this article is to determine the effect of central retinal vein occlusion (CRVO) on PhNR and RGCs performances.

Methods: Seventeen patients with CRVO were included. Full-field photopic ERGs, including PhNR, were recorded and compared with the fellow normal eyes. ERG signals were analyzed based on the standard time-domain analyses of the PhNR as well as a continuous wavelet transform (CWT) to extract time-frequency components that correspond to the PhNR using MATLAB. We obtained the main frequencies and their occurrence time from CWT.

Results: All a-wave, b-wave, and PhNR amplitudes of CRVO eyes showed a significant reduction compared to those of the fellow eyes ( < .01, < .001, and < .001, respectively). The peak times of a-wave, b-wave, and PhNR were increased significantly in the CRVO eyes ( = .04, = .04, and = .003, respectively). The dominant f frequency, which corresponds to the PhNR in CRVO patients, showed a more significant decrease ( < .001) compared to other dominant frequencies (f, f, and f). The occurrence time of f (t) was significantly higher in the CRVO eyes ( < .001). Time-domain of the PhNR was also affected in CRVO patients ( < .001).

Conclusion: CWT allows quantifications of ERG responses, especially for PhNR. The PhNR was severely affected in CRVO eyes implicating loss of RGCs. CWT might demonstrate the severity of CRVO more precisely and identify diagnostically significant changes of ERG waveforms that are not resolved when the analysis is only limited to the time-domain measurements.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/08820538.2020.1781905DOI Listing
April 2020

Eye Care Utilization in A Community-oriented Mobile Screening Programme for Improving Eye Health in Iran: A Cluster Randomized Trial.

Ophthalmic Epidemiol 2020 12 24;27(6):417-428. Epub 2020 May 24.

Centre for Global Health, Department of Public Health, Aarhus University , Aarhus, Denmark.

Purpose: To evaluate the effect of a mobile-based screening programme on eye care utilization in Iran.

Method: In this cluster randomized community trial, a representative sample of residents aged≥50 years from urban and rural areas in four districts in Tehran province were enrolled. The clusters were randomly assigned to one of the three parallel arms; the mHealth arm with digital data collection, vision screening test and retina evaluation using an integrated mobile application, the conventional arm with manual data collection and screening tests using Snellen chart and Fundus photography at the local primary healthcare facility, and the control arm with manual data collection without screening tests. The main outcome measure was eye care utilization which was defined as at least one visit to an optometrist or ophthalmologist.

Results: Of 3312 eligible individuals, 2520 (76.1%) participated. In the first 3 months after the screening programme, eye care utilization was higher among those who were referred by the mHealth method (35.6% 95%CI: 31.1-40.4%) compared to those referred by the conventional method (32.7%, 95%CI: 27.5-38.2%) and to those observed in the control arm (4.5%, 95%CI: 3.2-6.0). Eye care utilization improved (OR = 1.5, 95%CI: 1.2-1.9) among the referred people after the screening programme compared to the utilization before this programme; however, this improvement was significantly higher in the mHealth method (OR: 1.7, 95%CI: 1.2-2.4) compared to the conventional method (OR: 1.2, 95%CI: 0.8-1.8).

Conclusion And Relevance: The mobile-based screening programme can significantly improve eye care utilization at the community level.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/09286586.2020.1768552DOI Listing
December 2020

Motor and Sensory Outcomes of Infantile Exotropia: A 10-Year Study (2008-2017).

Korean J Ophthalmol 2020 04;34(2):143-149

Basir Eye Safety Research Center, Basir Eye Clinic, Tehran, Iran.

Purpose: We aimed to determine the long-term motor and sensory outcomes of patients with infantile exotropia.

Methods: In this longitudinal retrospective (historical cohort) study, the records of 76 patients with infantile exotropia were Studied. Subjects with constant exotropia manifesting before the age of 1 year who were at least 5 years old at recruitment time between 2008 and 2017 were included.

Results: The medical records of 26 patients were excluded due to not participating in follow-up examinations or having incomplete records. In total, 54 infantile exotropic patients (51.9% male) with a mean age of 11.1 ± 6.8 years and follow-up of 4.99 ± 3.58 years were studied. Postoperative sensory outcomes (central stereopsis [<60 sec/arc], peripheral fusion [60-3,000 sec/arc], and non-stereopsis [>3,000 sec/arc]) were observed in 38.9%, 38.9%, and 21.2% of patients, respectively. In terms of postoperative motor outcomes, 69%, 24%, and 7% were achieved as orthophoria, residual exotropia, and consecutive esotropia, respectively. Patients with a higher surgical age ( = 0.022) and better visual acuity ( = 0.004) had significantly better sensory outcomes, while higher preoperative deviation resulted in more suppression ( = 0.039, rs = 0.218).

Conclusions: With rates of 69% for motor success and 78.8% for sensory success, surgical outcomes of infantile exotropic patients seems to be favorable. Further studies are recommended to verify our findings.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3341/kjo.2019.0090DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7105794PMC
April 2020

A Population-based Study on the Prevalence and Associated Factors of Age-related Macular Degeneration in Northern Iran .

Ophthalmic Epidemiol 2020 06 21;27(3):209-218. Epub 2020 Jan 21.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

: To estimate the prevalence and associated factors of AMD in an Iranian population in 2014.: In this population-based cross-sectional study, a total of 2975 Iranian residents (age: ≥50 years) from the urban and rural areas of Gilan province were included. The prevalence of different grades of AMD was determined using the International Age-Related Maculopathy Epidemiological Study Group grading system.: Of 2975 eligible individuals, 2587 (87.0%) subjects participated and 2275 (76.5%) subjects (62.6 ± 8.8 years old) had gradable fundus photographs. Age- and sex-standardized prevalence of early and late AMD based on the 2016 Iran census were 13.2% (95% confidence interval [CI], 10.6-16.2) and 0.7% (95% CI, 0.4-1.3), respectively. In multivariate analysis, each decade increase in age was associated with the adjusted odds of any (adjusted odds ratio [AOR] = 1.31, 95% CI, 1.09-1.56; = .0031), early (AOR = 1.27, 95% CI, 1.06-1.53; = .012) and late AMD (AOR = 2.39, 95% CI, 1.08-5.28; = .031). Hyperopia was identified to be less frequent in late AMD (AOR = 0.20, 95% CI, 0.04-0.80; = .024). No significant association was found between AMD and sex, smoking, outdoor working, diabetes, hypertension, pseudophakia, hyperlipidemia and myopia.: Gilan Eye Study demonstrated the first estimate of age-specific AMD prevalence in Iran being compatible with other WHO regions. With the expected increase in the life expectancy and aging of Iranians, the number of people affected by AMD will be increasing in future. Healthcare policy makers should be advised to provide more efficient eye care services and preventive strategies in this regard.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/09286586.2020.1716379DOI Listing
June 2020

Slanted versus Augmented Recession for Horizontal Strabismus.

J Ophthalmic Vis Res 2019 Oct-Dec;14(4):465-473. Epub 2019 Oct 24.

Department of Optometry, School of Rehabilitation, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To compare the surgical outcomes of slanted versus augmented recession in patients with horizontal strabismus.

Methods: In this randomized clinical trial, a total of 100 esotropic (ET) and exotropic (XT) patients with a high AC/A ratio which was defined as a difference of 10 prism diopters (pd) between the distance and near deviations were included if the patients had a distance deviation 15 pd. Patients were randomly assigned into the slanted ( = 26 in ET and = 24 in XT group) and augmented recession groups ( = 25 in ET and = 25 in XT group). In the slanted group, recession was performed on the superior and inferior poles of the muscle based on the distance and near deviations, respectively, while in the augmented recession group, the muscles were recessed 1.00 or 1.50 mm more than the standard amount according to the distance and near difference between 10 and 20 pd or 20 pd, respectively.

Results: The mean age was 9.8 9.6 years and 63% were female. There was a significant postoperative reduction of difference in convergence excess in ET cases compared to patients who underwent the augmented recession procedure (12.65 6.16 vs 8.64 6.1 pd, = 0.014). Among our XT groups, there was no significant difference in postoperative reduction in the XT angle in the slanted group compared with the augmented group ( 0.05).

Conclusion: Slanted recession is recommended in convergence excess ET patients. In XT patients, either slanted or augmented recession may be chosen according to the priority and experience of the surgeon.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18502/jovr.v14i4.5453DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6825697PMC
October 2019

Comparison between patching and interactive binocular treatment in amblyopia: A randomized clinical trial.

J Curr Ophthalmol 2019 Dec 14;31(4):426-431. Epub 2019 Aug 14.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To compare the effect of amblyopia therapy on cases who received interactive binocular treatment (I-BiT™) with those who received standard patching of the dominant eye with placebo I-BiT™.

Methods: In this randomized clinical trial, 38 unilateral amblyopic children (3-10 years old) were studied. All unilateral amblyopic children who had best corrected visual acuity (BCVA) worse than 0.30 logMAR or a difference of two Snellen lines of BCVA between their two eyes were included, and children who did not complete at least 75% of amblyopia treatment were excluded from this study. Eventually, a total of 19 and 21 subjects were included in case and control groups, respectively. Cases played I-BiT™ games, while controls had standard patch therapy and played with placebo I-BiT™ games, both for one month. All subjects were examined at baseline and after one-month therapy.

Results: BCVA improved significantly in both groups after one-month treatment (case:  = 0.003, control:  < 0.001), while in comparison with each other, there was not any difference between them ( = 0.52). Although stereopsis improved in the case ( < 0.001) and control ( < 0.001), there was no significant difference between them pre and post-therapy. Our children played games for about 6 h total during one month in both groups, and their compliance was 87.5% and 76% in cases and controls, respectively. Two children were excluded due to their lower compliance of playing I-BiT™ games (n = 38).

Conclusions: I-BiT™ game and patching with placebo game had similar BCVA improvement in amblyopic children after one-month treatment. It is suggested to conduct further randomized clinical trials with a larger sample size and longer duration of study and assessment of its recurrence.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.joco.2019.07.004DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6896467PMC
December 2019

mutation as the cause of various clinical manifestations in a family affected with inherited retinal dystrophy.

Ophthalmic Genet 2019 10 16;40(5):436-442. Epub 2019 Oct 16.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

: To reveal the underlying genetic defect in a complex family affected with different clinical features of inherited retinal dystrophy, we carried out whole exome sequencing followed by confirmatory molecular tests.: Complete ophthalmic examinations were performed for available affected family members. Whole exome sequencing, bioinformatics analysis, Sanger sequencing confirmation, and segregation analysis were done to identify the causative mutation.: Clinical findings suggested fundus flavimaculatus as an early clinical feature progressing to an extensive chorioretinal atrophy involving the macula and mid-periphery of the fundus in one parent and central areolar chorioretinal dystrophy (CACD) as the most probable clinical diagnosis in another parent. Macular pattern dystrophy for one of their daughters and a Leber congenital amaurosis (LCA) like phenotype for the daughter with an early onset retinal dystrophy (EORD) phenotype was suggested. We found a known pathogenic nonsense variation in the gene (NM_000322: p.Gln239Ter). The parents with end stage fundus flavimaculatus and CACD diagnosis and their daughter with macular pattern dystrophy were heterozygous for the identified variant. The daughter affected with EORD/LCA like retinal dystrophy was homozygous for the same variation.: In this family, the same pathogenic variant in gene showed a wide range of clinical features of extensive chorioretinal macular atrophy with flecks as fundus falvimaculatus to CACD and macular pattern dystrophy in the heterozygous inheritance pattern and early onset/LCA like retinal dystrophy in the patient who was homozygous for the causative variant.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/13816810.2019.1678178DOI Listing
October 2019

The effect of inferior oblique muscle weakening on horizontal alignment.

J Curr Ophthalmol 2019 Sep 18;31(3):298-304. Epub 2019 Mar 18.

Department of Ophthalmology, Torfeh Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To determine the postoperative horizontal alignment changes following different inferior oblique (IO) weakening procedures on cases with IO overaction (IOOA).

Methods: A total of 40 patients undergoing IO weakening surgery participated in this prospective interventional case series. A comprehensive ophthalmic examination was performed on all patients. The grade of IOOA was assessed based on the muscle function in the gaze of elevation in adduction. All study subjects were operated on by one of the IO weakening procedures including recession, myectomy, or anteriorization, and all were followed up for at least three months after the surgery. Postoperative change of the horizontal alignment in primary position was the main outcome measure.

Results: Our findings showed that all types of IO weakening surgeries improved the postoperative muscle function, hypertopia, and V-pattern significantly ( = 0.001). Generally, IO weakening surgeries had no effect on the postoperative horizontal alignment, and mean exoshift of 0.44 ± 6.2 prism diopters (PD) was observed in all study subjects, specifically. It was found that 70% of cases had no postoperative horizontal changes, 15% showed improvement toward orthophoria, and 15% shifted away from orthophoria.

Conclusions: Based on our findings, no horizontal alignment change would be expected in the majority of cases undergoing weakening procedures of overacted IO. Most of our cases did not show any change while a few of them presented eso- or exoshift less than 5 pd which can be clinically ignored.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.joco.2019.02.001DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6742622PMC
September 2019

Incomplete penetrance of gene for autosomal dominant form of cone-rod dystrophy.

Ophthalmic Genet 2019 06 19;40(3):259-266. Epub 2019 Jun 19.

b Ophthalmic Research Center , Shahid Beheshti University of Medical Sciences , Tehran , Iran.

: Cone-rod dystrophy (CRD) is an inherited retinal dystrophy that is transmitted via different modes of inheritance. Mutations in more than 30 genes have been identified to cause the disease. We aimed to investigate the genetic agents of two unrelated cone-rod dystrophy affected Iranian families with autosomal recessive inheritance patterns. : Whole-exome sequencing (WES) was performed for identification of the disease-causing mutations in the probands of both families. The candidate mutations were further confirmed by Sanger sequencing. Samples from five available members of each family were then sequenced for the mutations present in the probands. Comprehensive ocular examinations for all members of the families carrying the mutations were completed by ophthalmologists. : We identified a novel premature stop codon c.310C>T in gene in heterozygote form in two symptomatic and two non-symptomatic members of one family (family-A), and a known mutation c.122G>A in homozygote form in another (family B). c.122G>A has been reported to cause late-onset autosomal dominant form of the disease in previous studies. However, the middle-aged heterozygous carriers of the mutation in this family showed normal phenotype. : The gene has been previously linked to the autosomal dominant form of cone-rod dystrophy. We report incomplete penetrance of gene for autosomal dominant form of the disease. Incomplete penetrance of the mutations may be partly caused by the influence of other genes in the complex genetic network underlying retinal regulation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/13816810.2019.1622023DOI Listing
June 2019

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment.

Ophthalmic Genet 2019 04 15;40(2):146-149. Epub 2019 Apr 15.

c Ophthalmic Research Center , Shahid Beheshti University of Medical Sciences , Tehran , Iran.

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/13816810.2019.1597374DOI Listing
April 2019

Designing a Screening Program for Prevention of Avoidable Blindness in Iran through a Participatory Action Approach.

J Ophthalmic Vis Res 2019 Jan-Mar;14(1):52-61

Centre for Global Health, Department of Public Health, Aarhus University, Aarhus, Denmark.

Purpose: To design a screening program for prevention of blindness at the community level in Iran.

Methods: In this qualitative study, the components and properties of the screening program were identified using a participatory action research method with focus group meetings (FGMs) with relevant health care providers and authorities. A content analysis approach was used for data analysis.

Results: In total, 18 stakeholders including six ophthalmologists with different sub-specialties participated in the five FGMs. The screening program aims to discover vision-threatening eye conditions in people aged 50 years and over. Primary health care workers deliver the program including vision tests and fundus imaging with the support of an ophthalmic technician. Retina specialists perform decision-making. Referral plans are interacted through an automated digital program. The screening environment, feedback, ethics and medical legal issues are other main components of the program.

Conclusion: This study presents the initial concepts and components of a screening program for prevention of blindness in the adult population in Iran. The program has the potential to improve eye health at the community level and may potentially be replicated as a model for similar settings elsewhere.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4103/jovr.jovr_43_18DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6388524PMC
March 2019

Using mHealth to improve eye care in remote areas of Iran.

Community Eye Health 2019 17;32(107):65-66. Epub 2019 Dec 17.

Centre for Global Health, Department of Public Health, Aarhus University, Aarhus, Denmark.

View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7041833PMC
December 2019

The Effect of Intravitreal Bevacizumab on Central Serous Chorioretinopathy.

Med Hypothesis Discov Innov Ophthalmol 2018 ;7(4):176-182

Department of Epidemiology and Biostatistics, Tehran University of Medical Sciences, Tehran, Iran.

The aim of this study was to investigate the efficacy of Intravitreal Injection of Bevacizumab (IVB) in patients with Central Serous Chorioretinopathy (CSC) compared to the control group, after four months of injection. In this study, 30 eyes of 30 patients with CSC, who were in the age range of 23 to 50 years old (70% male subject) were included. Eligible patients were randomly allocated to the intervention (n = 15) and control groups (n = 15). Patients in the intervention group received a single dose injection of bevacizumab (1.25 mg in 0.05 mL), while patients in the control group were followed-up during the same time interval, without any medical interventions. Corrected Distance Visual Acuity (CDVA) and Central Macular Thickness (CMT) were evaluated as the primary outcome measures at the four-month follow-up. There was no statistically significant difference between the intervention and control groups regarding their baseline characteristics. Corrected Distance Visual Acuity was improved significantly in the intervention group (P < 0.001), while this improvement was not observed in the control group. Furthermore, greater improvement of CDVA was detected in the IVB group compared to the patients without injection (P = 0.018). The CMT findings were in line with CDVA changes in both groups, revealing a significant reduction of CMT only in the intervention group (P < 0.001). Also, thinner central retina was found in the intervention group compared to the comparison group, at the four-month follow-up (P < 0.001). Based on the findings, bevacizumab could be effective for improvement of both anatomical and functional outcomes in patients with CSC.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6229672PMC
January 2018

Reoperation in Horizontal Strabismus and its Related Risk Factors.

Med Hypothesis Discov Innov Ophthalmol 2018 ;7(2):73-82

Department of Ophthalmology, Torfeh Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

This study was performed to determine the surgical outcomes and the related risk factors of second operation in patients with residual horizontal deviations. In this interventional case series study, a total of 119 patients with a history of reoperation were included (39 exotropia and 80 esotropia). Cases with consecutive strabismus, muscular palsy, systemic disease, lack of ocular fixation, and those, who had vertical deviation and Dissociated Vertical Deviation (DVD)>5 Prism Diopters (pd) were excluded. Medial Rectus (MR) resection in residual Exotropia (XT) and Lateral Rectus (LR) resection in residual Esotropia (ET) were performed. Unilateral or bilateral operations were considered if the preoperative residual deviation was < 20 pd or > 20 pd, respectively. Success of the reoperation was considered if the postoperative angle of deviation was ≤ 10 pd. Unilateral and bilateral MR resection was performed in 26% and 74% of patients with XT, respectively, with greater dose response in unilateral cases (2.8 versus 2.6 mm/pd). Successful surgical outcomes were observed in 94.9% of patients with XT. Unilateral and bilateral LR resection was also performed in patients with residual ET, each in 50% of patients. Unilateral cases showed greater dose-response compared to bilateral ones (2.6 versus 2 mm/pd) and successful surgical outcomes were observed in 83.8% of patients with ET. No variable was found as a risk factor of reoperation in both groups. In conclusion, both LR and MR resection are easy and predictable surgical approaches with high success rate in patients with residual ET and XT. Generally, MR resection is more effective than LR resection. Unilateral operation is less recommended in the residual exotropic group, due to its lower success compared to the bilateral operation. Unfortunately, none of the mentioned variables were found to be the risk factor of reoperation in the sampled patients.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6146237PMC
January 2018

Intravitreal injection of a Rho-kinase inhibitor (fasudil) combined with bevacizumab versus bevacizumab monotherapy for diabetic macular oedema: a pilot randomised clinical trial.

Br J Ophthalmol 2019 07 27;103(7):922-927. Epub 2018 Aug 27.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Click here to listen to the Podcast BACKGROUND/AIMS: To compare the efficacy of combined intravitreal injection of bevacizumab and a Rho-kinase inhibitor, fasudil (intravitreal bevacizumab (IVB)/intravitreal fasudil (IVF)), with IVB alone for centre-involving diabetic macular oedema (DME).

Methods: In this prospective randomised clinical trial, 44 eyes with centre-involving DME were randomised into two groups. The combined group received three consecutive injections of IVB (1.25 mg) and IVF (50 µM/L) monthly, while the monotherapy group received only one IVB (1.25 mg) injection per month for 3 months. Changes in best-corrected visual acuity (BCVA) and central macular thickness (CMT) were compared between the two groups at months 3 and 6. The primary outcome measure was the mean change in BCVA at month 6.

Results: Mean BCVA was significantly improved in both groups at month 3 (P<0.001), but it persisted up to month 6 only in the IVB/IVF group. Improvement of BCVA was greater in the IVB/IVF group at both time points (P=0.008, P<0.001). In the IVB/IVF and IVB groups, 54.5% versus 10% of the eyes gained≥15 ETDRS letters at month 6 (P=0.026). Between months 3 and 6, mean BCVA significantly decreased by 5±7 ETDRS letters in the IVB group (P=0.002), while no significant deterioration was observed in the IVB/IVF group. Corresponding with the BCVA changes, CMT was significantly reduced in both groups at month 3 (p=0.006, p<0.001) but this reduction sustained only in the IVB/IVF group up to month 6 (p<0.001).

Conclusion: Adjunctive intravitreal injection of a Rho-kinase inhibitor may enhance and prolong the therapeutic effects of anti-vascular endothelial growth factor drugs for centre- involving DME.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1136/bjophthalmol-2018-312244DOI Listing
July 2019

Macular Thickness in Moderate to Severe Amblyopia.

Korean J Ophthalmol 2018 08;32(4):312-318

Department of Ophthalmology, Torfeh Eye Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To compare the macular retinal thickness of moderately to severely amblyopic eyes with non-amblyopic eyes as controls.

Methods: This case control study was conducted on 56 children aged 4 to 10 years old (64.3% female subjects). Twenty-eight children had unilateral amblyopia (28 amblyopic eyes as cases and 28 normal fellow eyes as internal controls) and 28 children had normal visual acuity in both eyes and were considered as external controls (n = 56 eyes). Among our cases, 14 had strabismic amblyopia and 14 had anisometropic amblyopia. Macular retinal thickness was measured using optical coherence tomography at the center and in 1-, 3-, and 6-mm rings.

Results: Best-corrected visual acuity of the amblyopic eyes was less than that of the internal and external controls, and the best-corrected visual acuity of their fellow eyes was also less than that of the external controls. Thickness of the central macula and a 1-mm ring area in the amblyopic eyes was higher than that of both internal and external controls. Difference of central macular thickness ≥20 μm between two eyes of the amblyopic children was significantly more than non-amblyopic subjects.

Conclusions: Based on the results of this study, the macular retinal thickness was significantly higher in moderate to severe amblyopic eyes compared to their fellow eyes and external controls. This might be due to macular developmental disorders in amblyopic eyes. Therefore, optical coherence tomography imaging is recommended if subtle macular abnormalities are suspected in moderate to severe amblyopic eyes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3341/kjo.2017.0101DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6085182PMC
August 2018

Intravitreal Injection of Anti-vascular Endothelial Growth Factor Agents for Ocular Vascular Diseases: Clinical Practice Guideline.

J Ophthalmic Vis Res 2018 Apr-Jun;13(2):158-169

Standardization and CPG Development Office, Deputy of Curative Affairs, Ministry of Health and Medical Education, Tehran, Iran.

Purpose: To provide the clinical recommendations for the administration of intravitreal anti-vascular endothelial growth factor (VEGF) drugs especially bavacizumab for ocular vascular diseases including diabetic macular edema, neovascular age-related macular degeneration, myopic choroidal neovascularization, retinal vein occlusion and central serous chorioretinopathy.

Methods: Twenty clinical questions were developed by the guideline technical committee. Relevant websites and databases were searched to find out the pertinent clinical practice guidelines to answer the questions. The technical committee provided possible answers (scenarios) according to the available evidences for each question. All scenarios along with their levels of evidence and the supported articles were sent to the experts for external review. If the experts did not agree on any of the scenarios for one particular clinical question, the technical committee reviewed all scenarios and their pertinent evidences and made the necessary decision. After that, the experts were asked to score them again. All confirmed scenarios were gathered as the final recommendations.

Results: All the experts agreed on at least one of the scenarios. The technical committee extracted the agreed scenario for each clinical question as the final recommendation. Finally, 56 recommendations were developed for the procedure of intravitreal anti-VEGF injection and their applications in the management of ocular vascular diseases.

Conclusion: The implementation of this guideline can standardize the management of the common ocular vascular diseases by intravitreal injection of anti-VEGF agents. It can lead to better policy-making and evidence-based clinical decision by ophthalmologists and optimal evidence based eye care for patients.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4103/jovr.jovr_50_18DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5905310PMC
May 2018

A comparative study to determine the optimal intravitreal injection angle to the eye: A computational fluid-structure interaction model.

Technol Health Care 2018 ;26(3):483-498

Department of Mechanical Engineering, Kyushu University, Fukuoka, Japan.

This study was aimed at investigating the role of IVI angle on the induced stresses and deformations among the components of the eye. Thereafter, the most optimal angle of IVI to minimize the complications of post IVI at the injection site on a basis of the computed stresses via a Fluid-Structure Interaction (FSI) computational model was proposed. IntraVitreal Injection (IVI) is broadly employed as a principal treatment of vascular vitro-retinal diseases. So far, there have been reports regarding the complications of post IVI and determine them as severe uveitis, tractional retinal detachment, IntraOcular Pressure (IOP) elevation as well as ocular haemorrhage. However, there is a lack of knowledge on how to reduce the subsequent ocular tissue damage and patient symptoms in the injection site. Seven different IVI angles were simulated, including 0∘, 15∘, 30∘, 45∘, 60∘, 75∘, and 90∘, through the Finite Element (FE) code; and the term, 'post IVI complication' or 'injury', in the results was interpreted as the level of maximal principal stress in the eye components. The results revealed the lowest amount of stresses at the angle of 45∘ in respect to the horizontal line (acute to the surface of the sclera) for the lens, iris, vitreous body, aqueous body, ciliary body, sclera, retina, and choroid. The cornea illustrated the same amount of stress at the angles of 45∘, 60∘, 75∘, and 90∘ with the highest one at the IVI angle of 30∘. The lowest and the highest stresses among the eye components regardless of IVI angle were observed in the choroid and retina/sclera, respectively, which imply the importance of the IVI angle on the stresses of these eye components. The findings of the contemporary research revealed that the IVI angle of 45∘ would trigger less post IVI complications and, as a result, a more effective surgery outcome compared to the other angles, i.e., 0∘, 15∘, 30∘, 60∘, 75∘, and 90∘.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3233/THC-160777DOI Listing
December 2018

The relationship between abduction deficit and reoperation among patients with infantile esotropia.

Int J Ophthalmol 2018 18;11(3):478-483. Epub 2018 Mar 18.

Basir Eye Health Research Center, Basir Eye Clinic, Tehran 1418643113, Iran.

Aim: To determine the relationship between abduction deficit and reoperation among patients with infantile esotropia (IET).

Methods: The records of 216 patients (432 eyes) with IET who underwent surgery, from 2010 to 2015 were studied. Patients with IET whose deviation appeared before 6mo of age and had stable preoperative deviation in two examinations with at least 2wk apart and a minimum 3mo postoperative follow up were included. Cases with early onset accommodative esotropia, congenital cataract, retinopathy of prematurity (ROP), manifest nystagmus, fundus lesions, neurologic and ophthalmic anomalies, 6 nerve palsy and Duane's syndrome were excluded. Preoperative abduction deficit was considered from -1 to -3 grading scale. Three months after surgery, children were classified into no-need reoperation [deviation≤15 prism diopters (PD)], and need-reoperation groups (deviation>15 PD).

Results: In this retrospective study, 117 female and 99 male patients with the mean surgical age of 4.7±6.4y were included. Reoperation rate was 33.3% and 16.0% in IET patients with and without abduction deficit, respectively in patients who had a history of late surgery. Abduction deficit increased the odds of reoperation by 82% [OR=1.82, 95% confidence interval (CI) =1.05 to 3.19, =0.003] in patients who had a history of late surgery (>2 years old, =0.021). Abduction deficit was improved significantly after operation (<0.001).

Conclusion: Based on our results, abduction deficit can be considered as a risk factor of reoperation in IET patients who are operated at the age of more than 2y.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18240/ijo.2018.03.19DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5861239PMC
March 2018

Graded versus ungraded inferior oblique anterior transposition in patients with asymmetric dissociated vertical deviation.

J AAPOS 2017 Dec 27;21(6):476-479.e1. Epub 2017 Oct 27.

Department of Ophthalmology, Torfeh Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To report the surgical outcomes of graded versus ungraded inferior oblique anterior transposition (IOAT) in treatment of patients with asymmetric dissociated vertical deviation (DVD) and bilateral inferior oblique overaction (IOOA).

Methods: A total of 74 eyes of 37 patients with asymmetric DVD (interocular difference of ≥5) and bilateral IOOA of > +1 were included in this randomized clinical trial. In the ungraded group (n = 18), both inferior oblique muscles were sutured at the inferior rectus level; in the graded group (n = 19), the inferior oblique muscles of eyes with more DVD were sutured at the level of the inferior rectus and inferior oblique muscles of eyes with less DVD were sutured 2 mm posterior to the level of the inferior rectus muscle.

Results: DVD was significantly reduced in each group (P < 0.001 for both). Although the postoperative mean difference of asymmetry of DVD was less in the ungraded group compared to the graded group (1.2 ± 1.9 vs 3.2 ± 1.2 [P = 0.001]), the absolute amounts of reduction of DVD asymmetry were similar (4.3 ± 2.3 vs 4.4 ± 3.1 [P = 0.78]). IOOA and V patterns were also reduced postoperatively.

Conclusions: Each method of IOAT was effective in reducing DVD, asymmetry, IOOA, and V patterns.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jaapos.2017.07.213DOI Listing
December 2017

Inferior Oblique Overaction: Anterior Transposition Versus Myectomy.

J Pediatr Ophthalmol Strabismus 2017 Jul 17;54(4):232-237. Epub 2017 May 17.

Purpose: To compare the efficacy of inferior oblique myectomy and anterior transposition for correcting inferior oblique overaction (IOOA).

Methods: This retrospective study was conducted on 56 patients with IOOA who had either myectomy or anterior transposition of the inferior oblique muscle from 2010 to 2015. The authors compared preoperative and postoperative inferior oblique muscle function grading (-4 to +4) as the main outcome measure and vertical and horizontal deviation, dissociated vertical deviation (DVD), and A- and V-pattern between the two surgical groups as secondary outcomes.

Results: A total of 99 eyes of 56 patients with a mean age of 5.9 ± 6.5 years were included (47 eyes in the myectomy group and 52 eyes in the anterior transposition group). There were no differences in preoperative best corrected visual acuity, amblyopia, spherical equivalent, and primary versus secondary IOOA between the two groups. Both surgical procedures were effective in reducing IOOA and satisfactory results were similar between the two groups: 61.7% and 67.3% in the myectomy and anterior transposition groups, respectively (P = .56). After adjustment for the preoperative DVD, there was no statistically significant difference between the two groups postoperatively. The preoperative hypertropia was 6 to 14 and 6 to 18 prism diopters (PD) in the myectomy and anterior transposition groups, respectively. After surgery, no patient had a vertical deviation greater than 5 PD.

Conclusions: Both the inferior oblique myectomy and anterior transposition procedures are effective in reducing IOOA with similar satisfactory results. DVD and hypertropia were also corrected similarly by these two surgical procedures. [J Pediatr Ophthalmol Strabismus. 2017;54(4):232-237.].
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3928/01913913-20170309-01DOI Listing
July 2017

Rapid Assessment of Avoidable Blindness and Diabetic Retinopathy in Gilan Province, Iran.

Ophthalmic Epidemiol 2017 12 19;24(6):381-387. Epub 2017 Apr 19.

d Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences , Tehran , Iran.

Purpose: To conduct an assessment of avoidable blindness and diabetic retinopathy (DR) in Gilan, 2014.

Methods: A cross-sectional population-based survey was performed on a representative sample of urban and rural individuals aged ≥50 years of the province. Blindness was defined as presenting visual acuity (PVA) <3/60 in the better eye. Moderate visual impairment (MVI) and severe visual impairment (SVI) were defined as 6/60 ≤ PVA <6/18 and 3/60 ≤ PVA <6/60 in the better eye, respectively. Diabetes mellitus (DM) was determined based on random blood sugar (RBS) levels ≥200 mg/dL or a previous diagnosis. We used the Scottish grading system to grade DR.

Results: We invited 2975 individuals from 85 clusters. Age- and sex-adjusted prevalence and 95% confidence interval (CI) of blindness, SVI, MVI, and DM in 2587 participants (response rate: 86.9%) were 1.5% (95% CI: 1.1-2.0), 1.5% (95% CI: 0.9-2.0), 11.3% (95% CI: 9.9-12.7) and 21.4% (95% CI: 19.2-23.7), respectively. The leading causes of blindness were cataract (47.1%), age-related macular degeneration (14.7%) and DR (8.8%). Cataract surgery (CS) coverage was 69.3%. The main challenges for CS were cost and unawareness. The outcome of CS was good in 66.9% of operated eyes. Any DR and/or maculopathy were observed in 25.3% (95% CI: 21.0-29.5) of subjects including 12.6% (95% CI: 9.7-15.6) sight-threatening DR. In previously known DM cases, 215 (41.7%) had never undergone an eye examination for DR.

Conclusion: The proportion of avoidable blindness and DR is considerable in Gilan Province.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/09286586.2017.1307993DOI Listing
December 2017
-->