Publications by authors named "Florian Reichmann"

30 Publications

  • Page 1 of 1

Endothelial Lipase Modulates Paraoxonase 1 Content and Arylesterase Activity of HDL.

Int J Mol Sci 2021 Jan 13;22(2). Epub 2021 Jan 13.

Gottfried Schatz Research Center for Cell Signaling, Metabolism and Aging, Molecular Biology and Biochemistry, Medical University of Graz, Neue Stiftingtalstraße 6/6, 8010 Graz, Austria.

Endothelial lipase (EL) is a strong modulator of the high-density lipoprotein (HDL) structure, composition, and function. Here, we examined the impact of EL on HDL paraoxonase 1 (PON1) content and arylesterase (AE) activity in vitro and in vivo. The incubation of HDL with EL-overexpressing HepG2 cells decreased HDL size, PON1 content, and AE activity. The EL modification of HDL did not diminish the capacity of HDL to associate with PON1 when EL-modified HDL was incubated with PON1-overexpressing cells. The overexpression of EL in mice significantly decreased HDL serum levels but unexpectedly increased HDL PON1 content and HDL AE activity. Enzymatically inactive EL had no effect on the PON1 content of HDL in mice. In healthy subjects, EL serum levels were not significantly correlated with HDL levels. However, HDL PON1 content was positively associated with EL serum levels. The EL-induced changes in the HDL-lipid composition were not linked to the HDL PON1 content. We conclude that primarily, the interaction of enzymatically active EL with HDL, rather than EL-induced alterations in HDL size and composition, causes PON1 displacement from HDL in vitro. In vivo, the EL-mediated reduction of HDL serum levels and the consequently increased PON1-to-HDL ratio in serum increase HDL PON1 content and AE activity in mice. In humans, additional mechanisms appear to underlie the association of EL serum levels and HDL PON1 content.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3390/ijms22020719DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7828365PMC
January 2021

Galanin receptor 3 attenuates inflammation and influences the gut microbiota in an experimental murine colitis model.

Sci Rep 2021 Jan 12;11(1):564. Epub 2021 Jan 12.

Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, University Hospital of the Paracelsus Medical University, Muellner Hauptstr. 48, 5020, Salzburg, Austria.

The regulatory (neuro)peptide galanin and its three receptors (GALR) are involved in immunity and inflammation. Galanin alleviated inflammatory bowel disease (IBD) in rats. However, studies on the galanin receptors involved are lacking. We aimed to determine galanin receptor expression in IBD patients and to evaluate if GALR and GALR contribute to murine colitis. Immunohistochemical analysis revealed that granulocytes in colon specimens of IBD patients (Crohn's disease and ulcerative colitis) expressed GALR and GALR but not GALR. After colitis induction with 2% dextran sulfate sodium (DSS) for 7 days, mice lacking GALR (GALR-KO) lost more body weight, exhibited more severe colonic inflammation and aggravated histologic damage, with increased infiltration of neutrophils compared to wild-type animals. Loss of GALR resulted in higher local and systemic inflammatory cytokine/chemokine levels. Remarkably, colitis-associated changes to the intestinal microbiota, as assessed by quantitative culture-independent techniques, were most pronounced in GALR-KO mice, characterized by elevated numbers of enterobacteria and bifidobacteria. In contrast, GALR deletion did not influence the course of colitis. In conclusion, granulocyte GALR and GALR expression is related to IBD activity in humans, and DSS-induced colitis in mice is strongly affected by GALR loss. Consequently, GALR poses a novel therapeutic target for IBD.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41598-020-79456-yDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7803768PMC
January 2021

Skin swabbing is a refined technique to collect DNA from model fish species.

Sci Rep 2020 10 23;10(1):18212. Epub 2020 Oct 23.

Department of Neuroscience, Psychology and Behaviour, College of Life Sciences, University of Leicester, Leicester, LE1 7RH, UK.

Model fish species such as sticklebacks and zebrafish are frequently used in studies that require DNA to be collected from live animals. This is typically achieved by fin clipping, a procedure that is simple and reliable to perform but that can harm fish. An alternative procedure to sample DNA involves swabbing the skin to collect mucus and epithelial cells. Although swabbing appears to be less invasive than fin clipping, it still requires fish to be netted, held in air and handled-procedures that can cause stress. In this study we combine behavioural and physiological analyses to investigate changes in gene expression, behaviour and welfare after fin clipping and swabbing. Swabbing led to a smaller change in cortisol release and behaviour on the first day of analysis compared to fin clipping. It also led to less variability in data suggesting that fewer animals need to be measured after using this technique. However, swabbing triggered some longer term changes in zebrafish behaviour suggesting a delayed response to sample collection. Skin swabbing does not require the use of anaesthetics and triggers fewer changes in behaviour and physiology than fin clipping. It is therefore a more refined technique for DNA collection with the potential to improve fish health and welfare.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41598-020-75304-1DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7584585PMC
October 2020

The zebrafish histamine H3 receptor modulates aggression, neural activity and forebrain functional connectivity.

Acta Physiol (Oxf) 2020 12 12;230(4):e13543. Epub 2020 Aug 12.

Department of Neuroscience, Psychology and Behaviour, College of Life Sciences, University of Leicester, Leicester, UK.

Aim: Aggression is a behavioural trait characterized by the intention to harm others for offensive or defensive purposes. Neurotransmitters such as serotonin and dopamine are important mediators of aggression. However, the physiological role of the histaminergic system during this behaviour is currently unclear. Here, we aimed to better understand histaminergic signalling during aggression by characterizing the involvement of the histamine H3 receptor (Hrh3).

Methods: We have generated a novel zebrafish Hrh3 null mutant line using CRISPR-Cas9 genome engineering and investigated behavioural changes and alterations to neural activity using whole brain Ca imaging in zebrafish larvae and ribosomal protein S6 (rpS6) immunohistochemistry in adults.

Results: We show that genetic inactivation of the histamine H3 receptor (Hrh3) reduces aggression in zebrafish, an effect that can be reproduced by pharmacological inhibition. In addition, hrh3 zebrafish show behavioural impairments consistent with heightened anxiety. Larval in vivo whole brain Ca imaging reveals higher neuronal activity in the forebrain of mutants, but lower activity in specific hindbrain areas and changes in measures of functional connectivity between subregions. Adult hrh3 zebrafish display brain region-specific neural activity changes in response to aggression of both key regions of the social decision-making network, and the areas containing histaminergic neurons in the zebrafish brain.

Conclusion: These results highlight the importance of zebrafish Hrh3 signalling for aggression and anxiety and uncover the brain areas involved. Targeting this receptor might be a potential novel therapeutic route for human conditions characterized by heightened aggression.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/apha.13543DOI Listing
December 2020

Experimental colitis reduces microglial cell activation in the mouse brain without affecting microglial cell numbers.

Sci Rep 2019 12 27;9(1):20217. Epub 2019 Dec 27.

Research Unit of Translational Neurogastroenterology, Division of Pharmacology, Otto Loewi Research Centre for Vascular Biology, Immunology and Inflammation, Medical University of Graz, Graz, Austria.

Inflammatory bowel disease (IBD) patients frequently suffer from anxiety disorders and depression, indicating that altered gut-brain axis signalling during gastrointestinal inflammation is a risk factor for psychiatric disease. Microglia, immune cells of the brain, is thought to be involved in a number of mental disorders, but their role in IBD is largely unknown. In the current work, we investigated whether colitis induced by dextran sulphate sodium (DSS), a murine model of IBD, alters microglial phenotypes in the brain. We found that colitis caused a reduction of Iba-1 and CD68 immunoreactivity, microglial activation markers, in specific brain regions of the limbic system such as the medial prefrontal cortex (mPFC), while other areas remained unaffected. Flow cytometry showed an increase of monocyte-derived macrophages during colitis and gene expression analysis in the mPFC showed pronounced changes of microglial markers including cluster of differentiation 86 (CD86), tumour necrosis factor-α, nitric oxide synthase 2, CD206 and chitinase-like protein 3 consistent with both M1 and M2 activation. Taken together, these findings suggest that experimental colitis-induced inflammation is propagated to the brain altering microglial function.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41598-019-56859-0DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6934553PMC
December 2019

Intranasal Neuropeptide Y Blunts Lipopolysaccharide-Evoked Sickness Behavior but Not the Immune Response in Mice.

Neurotherapeutics 2019 10;16(4):1335-1349

Research Unit of Translational Neurogastroenterology, Division of Pharmacology, Otto Loewi Research Center, Medical University of Graz, Universitätsplatz 4, A-8010, Graz, Austria.

Neuropeptide Y (NPY) has been demonstrated to exert stress buffering effects and promote resilience. Non-invasive intranasal (IN) application of NPY to rodents is able to mitigate traumatic stress-induced behavioral changes as well as dysfunction of the hypothalamic-pituitary-adrenal (HPA) axis. However, it is unknown whether IN NPY could prevent the behavioral, pro-inflammatory and neurochemical responses to peripheral immune activation by the Toll-like receptor 4 (TLR4) stimulant lipopolysaccharide (LPS). Therefore, we analyzed the effects of IN NPY (100 μg) on the behavioral sickness response (reduced locomotion and exploration) and the underlying molecular mechanisms, 3 h and 21 h after intraperitoneal injections of LPS (0.03 mg/kg) in male C57BL/6N mice. The acute behavioral sickness response was significantly dampened by pretreatment with IN NPY 3 h after LPS injection. This effect was accompanied by diminished weight loss and lowered plasma corticosterone (CORT) levels 21 h after LPS injection. In contrast, acute circulating cytokine levels and hypothalamic cytokine mRNA expression remained unaltered by IN NPY, which indicates that the peripheral and cerebral immune response to LPS was left undisturbed. Our findings are in agreement with the reported activity of NPY to dampen the response of the HPA axis to stress. We propose that IN NPY ablates sickness behavior at a site beyond the peripheral and cerebral cytokine response, an action that is associated with reduced activity of the HPA axis as determined by decreased plasma CORT.These results indicate that IN NPY administration may be relevant to the management of neuropsychiatric disorders arising from immune-induced neuroendocrine dysfunction.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s13311-019-00758-9DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6985076PMC
October 2019

Amyloid-beta impairs insulin signaling by accelerating autophagy-lysosomal degradation of LRP-1 and IR-β in blood-brain barrier endothelial cells in vitro and in 3XTg-AD mice.

Mol Cell Neurosci 2019 09 2;99:103390. Epub 2019 Jul 2.

Division of Immunology and Pathophysiology, Otto Loewi Research Center for Vascular Biology, Immunology and Inflammation, Medical University of Graz, Graz, Austria; BioTechMed-Graz, Graz, Austria. Electronic address:

Aberrant insulin signaling constitutes an early change in Alzheimer's disease (AD). Insulin receptors (IR) and low-density lipoprotein receptor-related protein-1 (LRP-1) are expressed in brain capillary endothelial cells (BCEC) forming the blood-brain barrier (BBB). There, insulin may regulate the function of LRP-1 in Aβ clearance from the brain. Changes in IR-β and LRP-1 and insulin signaling at the BBB in AD are not well understood. Herein, we identified a reduction in cerebral and cerebrovascular IR-β levels in 9-month-old male and female 3XTg-AD (PS1, APP, and tau) as compared to NTg mice, which is important in insulin mediated signaling responses. Reduced cerebral IR-β levels corresponded to impaired insulin signaling and LRP-1 levels in brain. Reduced cerebral and cerebrovascular IR-β and LRP-1 levels in 3XTg-AD mice correlated with elevated levels of autophagy marker LC3B. In both genotypes, high-fat diet (HFD) feeding decreased cerebral and hepatic LRP-1 expression and elevated cerebral Aβ burden without affecting cerebrovascular LRP-1 and IR-β levels. In vitro studies using primary porcine (p)BCEC revealed that Aβ peptides 1-40 or 1-42 (240 nM) reduced cellular levels and interaction of LRP-1 and IR-β thereby perturbing insulin-mediated signaling. Further mechanistic investigation revealed that Aβ treatment accelerated the autophagy-lysosomal degradation of IR-β and LRP-1 in pBCEC. LRP-1 silencing in pBCEC decreased IR-β levels through post-translational pathways further deteriorating insulin-mediated responses at the BBB. Our findings indicate that LRP-1 proves important for insulin signaling at the BBB. Cerebral Aβ burden in AD may accelerate LRP-1 and IR-β degradation in BCEC thereby contributing to impaired cerebral and cerebromicrovascular insulin effects.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.mcn.2019.103390DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6897558PMC
September 2019

The Visually Mediated Social Preference Test: A Novel Technique to Measure Social Behavior and Behavioral Disturbances in Zebrafish.

Methods Mol Biol 2019 ;2011:121-132

Otto Loewi Research Centre, Medical University of Graz, Graz, Austria.

Zebrafish are an emerging model in behavioral neuroscience. They display a wide range of measurable behaviors such as locomotion, aggression, anxiety, learning and memory, and social behavior. In addition, the relative ease of genetic manipulation and the increasing availability of disease models mean that zebrafish have gained in popularity as an animal model for various neurological and psychiatric diseases including autism spectrum disorder (ASD). In order to better characterize social behavior and behavioral abnormalities in zebrafish, we have developed the visually mediated social preference (VMSP) test, a novel assay to measure social preference and social novelty in two consecutive 5-min sessions. Using recording and video tracking, the time spent in different areas of the tank, the time spent immobile, swimming speed, and distance moved can be easily measured and analyzed. Untreated experimentally naive AB WT zebrafish typically show a strong preference for spending time near and interacting with a compartment containing unfamiliar conspecifics over the empty compartments during session 1 and a stronger preference for a group of unfamiliar zebrafish over familiar conspecifics from session 1, during session 2 of the test. Research in our lab has shown that the VMSP is suitable to measure the social behavior of individual zebrafish, to uncover social phenotypes of mutant strains, and to better understand animal models of disease that include impaired sociability such as ASD. The current paper provides a step-by-step guide on how to implement and perform this test and highlights important considerations for data acquisition, analysis, and interpretation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/978-1-4939-9554-7_8DOI Listing
March 2020

Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome.

Eur J Nutr 2020 Aug 1;59(5):1831-1844. Epub 2019 Jul 1.

Research Unit of Translational Neurogastroenterology, Division of Pharmacology, Otto Loewi Research Center, Medical University of Graz, Universitätsplatz 4, 8010, Graz, Austria.

Purpose: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure.

Methods: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts.

Results: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery.

Conclusions: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00394-019-02035-zDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7351849PMC
August 2020

Intermittent Fasting Exacerbates the Acute Immune and Behavioral Sickness Response to the Viral Mimic Poly(I:C) in Mice.

Front Neurosci 2019 17;13:359. Epub 2019 Apr 17.

Research Unit of Translational Neurogastroenterology, Division of Pharmacology, Otto Loewi Research Center, Medical University of Graz, Graz, Austria.

Intermitted fasting and other forms of calorie restriction are increasingly demonstrated to exert potential health benefits. Interestingly, restricted feeding is also able to mitigate sickness in response to bacterial factors stimulating Toll-like receptor 4 (TLR4). However, little is known about how fasting modifies the activity of virus-associated molecular patterns. We therefore analyzed the impact of an intermittent fasting (IF) regimen on the immune and behavioral response to the TLR3 agonist and viral mimic polyinosinic:polycytidylic acid [Poly(I:C)] in mice. The effects of intraperitoneally injected Poly(I:C) (12 mg/kg) on plasma and cerebral cytokine expression and behavior (locomotion, exploration, and ingestion) were examined in male C57BL/6N mice under control conditions and following a 9 days period of intermittent (alternate day) fasting (IF). Poly(I:C) increased the circulating levels of cytokines (TNF-α, MCP-1, IL-6, IL-10, IFN-α, IFN-γ), an effect amplified by IF. In addition, IF aggravated sickness behavior in response to Poly(I:C), while cerebral cytokine expression was enhanced by application of Poly(I:C) in the absence of a significant effect of IF. Furthermore, IF augmented the expression of neuropeptide Y (NPY) mRNA in the hypothalamus and increased the plasma levels of corticosterone, while Poly(I:C) had little effect on these readouts. Our data show that IF does not abate, but exaggerates the immune and sickness response to the viral mimic Poly(I:C). This adverse effect of IF occurs despite increased hypothalamic NPY expression and enhanced plasma corticosterone. We therefore propose that the effects of IF on the immune and behavioral responses to viral and bacterial factors are subject to different neuronal and neuroendocrine control mechanisms.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fnins.2019.00359DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6478699PMC
April 2019

An Unbiased Approach of Sampling TEM Sections in Neuroscience.

J Vis Exp 2019 04 13(146). Epub 2019 Apr 13.

Department of Cell Biology, Histology and Embryology, Gottfried Schatz Research Center, Medical University of Graz;

Investigations of the ultrastructural features of neurons and their synapses are only possible with electron microscopy. Especially for comparative studies of the changes in densities and distributions of such features, an unbiased sampling protocol is vital for reliable results. Here, we present a workflow for the image acquisition of brain samples. The workflow allows systematic uniform random sampling within a defined brain region, and the images can be analyzed using a disector. This technique is much faster than extensive examination of serial sections but still presents a feasible approach to estimate the densities and distributions of ultrastructure features. Before embedding, stained vibratome sections were used as a reference to identify the brain region under investigation, which helped speed up the overall specimen preparation process. This approach was used for comparative studies investigating the effect of an enriched-housing environment on several ultrastructural parameters in the mouse brain. Based on the successful use of the workflow, we adapted it for the purpose of elemental analysis of brain samples. We optimized the protocol in terms of the time of user-interaction. Automating all the time-consuming steps by compiling a script for the open source software SerialEM helps the user to focus on the main work of acquiring the elemental maps. As in the original workflow, we paid attention to the unbiased sampling approach to guarantee reliable results.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3791/58745DOI Listing
April 2019

Endothelin neurotransmitter signalling controls zebrafish social behaviour.

Sci Rep 2019 02 28;9(1):3040. Epub 2019 Feb 28.

Department of Neuroscience, Psychology and Behaviour, College of Life Sciences, University of Leicester, Leicester, LE1 7RH, UK.

The formation of social groups is an adaptive behaviour that can provide protection from predators, improve foraging and facilitate social learning. However, the costs of proximity can include competition for resources, aggression and kleptoparasitism meaning that the decision whether to interact represents a trade-off. Here we show that zebrafish harbouring a mutation in endothelin receptor aa (ednraa) form less cohesive shoals than wild-types. ednraa mutants exhibit heightened aggression and decreased whole-body cortisol levels suggesting that they are dominant. These behavioural changes correlate with a reduction of parvocellular arginine vasopressin (AVP)-positive neurons in the preoptic area, an increase in the size of magnocellular AVP neurons and a higher concentration of 5-HT and dopamine in the brain. Manipulation of AVP or 5-HT signalling can rescue the shoaling phenotype of ednraa providing an insight into how the brain controls social interactions.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41598-019-39907-7DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6395658PMC
February 2019

High-fat diet induces depression-like behaviour in mice associated with changes in microbiome, neuropeptide Y, and brain metabolome.

Nutr Neurosci 2019 Dec 26;22(12):877-893. Epub 2018 Apr 26.

Research Unit of Translational Neurogastroenterology, Division of Pharmacology, Otto Loewi Research Centre, Medical University of Graz, Graz, Austria.

The biological mechanisms linking diet-related obesity and depression remain unclear. Therefore, we examined the impact of high-fat diet (HFD) on murine behaviour, intestinal microbiome, brain metabolome, neuropeptide Y (NPY) expression, and dipeptidyl peptidase-4 (DPP-4) activity. Male C57Bl/6J mice were fed an HFD (60 kJ% from fat) or control diet (12 kJ% from fat) for 8 weeks, followed by behavioural phenotyping. Caecal microbiome was analysed by 16S rDNA sequencing, brain metabolome by H nuclear magnetic resonance, NPY expression by PCR and immunoassay, and dipeptidyl peptidase-4 (DPP-4) activity by enzymatic assay. The effect of a 4-week treatment with imipramine (7 mg/kg/day) and the DPP-4 inhibitor sitagliptin (50 mg/kg/day) on HFD-induced behavioural changes was also tested. HFD led to a depression-like phenotype as revealed by reduced sociability and sucrose preference. In the caecum, HFD diminished the relative abundance of Bacteroidetes and increased the relative abundance of Firmicutes and Cyanobacteria. In the brain, HFD modified the metabolome of prefrontal cortex and striatum, changing the relative concentrations of molecules involved in energy metabolism (e.g. lactate) and neuronal signalling (e.g. γ-aminobutyric acid). The expression of NPY in hypothalamus and hippocampus was decreased by HFD, whereas plasma NPY and DPP-4-like activity were increased. The HFD-induced anhedonia remained unaltered by imipramine and sitagliptin. The depression-like behaviour induced by prolonged HFD in mice is associated with distinct alterations of intestinal microbiome, brain metabolome, NPY system, and DPP-4-like activity. Importantly, the HFD-evoked behavioural disturbance remains unaltered by DPP-4 inhibition and antidepressant treatment with imipramine.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/1028415X.2018.1465713DOI Listing
December 2019

Visceral Inflammation and Immune Activation Stress the Brain.

Front Immunol 2017 22;8:1613. Epub 2017 Nov 22.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz, Graz, Austria.

Stress refers to a dynamic process in which the homeostasis of an organism is challenged, the outcome depending on the type, severity, and duration of stressors involved, the stress responses triggered, and the stress resilience of the organism. Importantly, the relationship between stress and the immune system is bidirectional, as not only stressors have an impact on immune function, but alterations in immune function themselves can elicit stress responses. Such bidirectional interactions have been prominently identified to occur in the gastrointestinal tract in which there is a close cross-talk between the gut microbiota and the local immune system, governed by the permeability of the intestinal mucosa. External stressors disturb the homeostasis between microbiota and gut, these disturbances being signaled to the brain multiple communication pathways constituting the gut-brain axis, ultimately eliciting stress responses and perturbations of brain function. In view of these relationships, the present article sets out to highlight some of the interactions between peripheral immune activation, especially in the visceral system, and brain function, behavior, and stress coping. These issues are exemplified by the way through which the intestinal microbiota as well as microbe-associated molecular patterns including lipopolysaccharide communicate with the immune system and brain, and the mechanisms whereby overt inflammation in the GI tract impacts on emotional-affective behavior, pain sensitivity, and stress coping. The interactions between the peripheral immune system and the brain take place along the gut-brain axis, the major communication pathways of which comprise microbial metabolites, gut hormones, immune mediators, and sensory neurons. Through these signaling systems, several transmitter and neuropeptide systems within the brain are altered under conditions of peripheral immune stress, enabling adaptive processes related to stress coping and resilience to take place. These aspects of the impact of immune stress on molecular and behavioral processes in the brain have a bearing on several disturbances of mental health and highlight novel opportunities of therapeutic intervention.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fimmu.2017.01613DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5702648PMC
November 2017

Visceral hyperalgesia caused by peptide YY deletion and Y2 receptor antagonism.

Sci Rep 2017 01 20;7:40968. Epub 2017 Jan 20.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz, Universitätsplatz 4, 8010 Graz, Austria.

Altered levels of colonic peptide YY (PYY) have been reported in patients suffering from functional and inflammatory bowel disorders. While the involvement of neuropeptide Y (NPY) and Y receptors in the regulation of nociception is well established, the physiological role of PYY in somatic and visceral pain is poorly understood. In this work, the role of PYY in pain sensitivity was evaluated using PYY knockout (PYY) mice and Y2 receptor ligands. PYY mice were more sensitive to somatic thermal pain compared to wild type (WT) mice. Visceral pain was assessed by evaluating pain-related behaviors, mouse grimace scale (MGS) and referred hyperalgesia after intrarectal administration of allyl isothiocyanate (AITC, 1 or 2%) or its vehicle, peanut oil. The pain-related behaviors induced by AITC were significantly exaggerated by PYY deletion, whereas the MGS readout and the referred hyperalgesia were not significantly affected. The Y2 receptor antagonist, BII0246, increased pain-related behaviors in response to intrarectal AITC compared to vehicle treatment while the Y2 receptor agonist, PYY(3-36), did not have a significant effect. These results indicate that endogenous PYY has a hypoalgesic effect on somatic thermal and visceral chemical pain. The effect on visceral pain seems to be mediated by peripheral Y2 receptors.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/srep40968DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5247702PMC
January 2017

Diverse action of lipoteichoic acid and lipopolysaccharide on neuroinflammation, blood-brain barrier disruption, and anxiety in mice.

Brain Behav Immun 2017 Feb 14;60:174-187. Epub 2016 Oct 14.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz, Universitätsplatz 4, 8010 Graz, Austria; BioTechMed-Graz, Mozartgasse 12, 8010 Graz, Austria. Electronic address:

Microbial metabolites are known to affect immune system, brain, and behavior via activation of pattern recognition receptors such as Toll-like receptor 4 (TLR4). Unlike the effect of the TLR4 agonist lipopolysaccharide (LPS), the role of other TLR agonists in immune-brain communication is insufficiently understood. We therefore hypothesized that the TLR2 agonist lipoteichoic acid (LTA) causes immune activation in the periphery and brain, stimulates the hypothalamic-pituitary-adrenal (HPA) axis and has an adverse effect on blood-brain barrier (BBB) and emotional behavior. Since LTA preparations may be contaminated by LPS, an extract of LTA (LTA), purified LTA (LTA), and pure LPS (LPS) were compared with each other in their effects on molecular and behavioral parameters 3h after intraperitoneal (i.p.) injection to male C57BL/6N mice. The LTA (20mg/kg) induced anxiety-related behavior in the open field test, enhanced the circulating levels of particular cytokines and the cerebral expression of cytokine mRNA, and blunted the cerebral expression of tight junction protein mRNA. A dose of LPS matching the amount of endotoxin/LPS contaminating the LTA reproduced several of the molecular and behavioral effects of LTA. LTA (20mg/kg) increased plasma levels of tumor necrosis factor-α (TNF-α), interleukin-6 and interferon-γ, and enhanced the transcription of TNF-α, interleukin-1β and other cytokines in the amygdala and prefrontal cortex. These neuroinflammatory effects of LTA were associated with transcriptional down-regulation of tight junction-associated proteins (claudin 5, occludin) in the brain. LTA also enhanced circulating corticosterone, but failed to alter locomotor and anxiety-related behavior in the open field test. These data disclose that TLR2 agonism by LTA causes peripheral immune activation and initiates neuroinflammatory processes in the brain that are associated with down-regulation of BBB components and activation of the HPA axis, although emotional behavior (anxiety) is not affected. The results obtained with an LTA preparation contaminated with LPS hint at a facilitatory interaction between TLR2 and TLR4, the adverse impact of which on long-term neuroinflammation, disruption of the BBB and mental health warrants further analysis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bbi.2016.10.011DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5419569PMC
February 2017

Environmental enrichment induces behavioural disturbances in neuropeptide Y knockout mice.

Sci Rep 2016 06 16;6:28182. Epub 2016 Jun 16.

Research Unit Electron Microscopic Techniques, Institute of Cell Biology, Histology and Embryology, Medical University of Graz, Harrachgasse 21, 8010 Graz, Austria.

Environmental enrichment (EE) refers to the provision of a complex and stimulating housing condition which improves well-being, behaviour and brain function of laboratory animals. The mechanisms behind these beneficial effects of EE are only partially understood. In the current report, we describe a link between EE and neuropeptide Y (NPY), based on findings from NPY knockout (KO) mice exposed to EE. Relative to EE-housed wildtype (WT) animals, NPY KO mice displayed altered behaviour as well as molecular and morphological changes in amygdala and hippocampus. Exposure of WT mice to EE reduced anxiety and decreased central glucocorticoid receptor expression, effects which were absent in NPY KO mice. In addition, NPY deletion altered the preference of EE items, and EE-housed NPY KO mice responded to stress with exaggerated hyperthermia, displayed impaired spatial memory, had higher hippocampal brain-derived neurotrophic factor mRNA levels and altered hippocampal synaptic plasticity, effects which were not seen in WT mice. Accordingly, these findings suggest that NPY contributes to the anxiolytic effect of EE and that NPY deletion reverses the beneficial effects of EE into a negative experience. The NPY system could thus be a target for "enviromimetics", therapeutics which reproduce the beneficial effects of enhanced environmental stimulation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/srep28182DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4910086PMC
June 2016

Cognitive impairment by antibiotic-induced gut dysbiosis: Analysis of gut microbiota-brain communication.

Brain Behav Immun 2016 Aug 23;56:140-55. Epub 2016 Feb 23.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz, Universitätsplatz 4, 8010 Graz, Austria. Electronic address:

Emerging evidence indicates that disruption of the gut microbial community (dysbiosis) impairs mental health. Germ-free mice and antibiotic-induced gut dysbiosis are two approaches to establish causality in gut microbiota-brain relationships. However, both models have limitations, as germ-free mice display alterations in blood-brain barrier and brain ultrastructure and antibiotics may act directly on the brain. We hypothesized that the concerns related to antibiotic-induced gut dysbiosis can only adequately be addressed if the effect of intragastric treatment of adult mice with multiple antibiotics on (i) gut microbial community, (ii) metabolite profile in the colon, (iii) circulating metabolites, (iv) expression of neuronal signaling molecules in distinct brain areas and (v) cognitive behavior is systematically investigated. Of the antibiotics used (ampicillin, bacitracin, meropenem, neomycin, vancomycin), ampicillin had some oral bioavailability but did not enter the brain. 16S rDNA sequencing confirmed antibiotic-induced microbial community disruption, and metabolomics revealed that gut dysbiosis was associated with depletion of bacteria-derived metabolites in the colon and alterations of lipid species and converted microbe-derived molecules in the plasma. Importantly, novel object recognition, but not spatial, memory was impaired in antibiotic-treated mice. This cognitive deficit was associated with brain region-specific changes in the expression of cognition-relevant signaling molecules, notably brain-derived neurotrophic factor, N-methyl-d-aspartate receptor subunit 2B, serotonin transporter and neuropeptide Y system. We conclude that circulating metabolites and the cerebral neuropeptide Y system play an important role in the cognitive impairment and dysregulation of cerebral signaling molecules due to antibiotic-induced gut dysbiosis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bbi.2016.02.020DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5014122PMC
August 2016

Neuropeptide Y: A stressful review.

Neuropeptides 2016 Feb 30;55:99-109. Epub 2015 Sep 30.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz, Universitätsplatz 4, A-8010 Graz, Austria.

Stress is defined as an adverse condition that disturbs the homeostasis of the body and activates adaptation responses. Among the many pathways and mediators involved, neuropeptide Y (NPY) stands out due to its unique stress-relieving, anxiolytic and neuroprotective properties. Stress exposure alters the biosynthesis of NPY in distinct brain regions, the magnitude and direction of this effect varying with the duration and type of stress. NPY is expressed in particular neurons of the brainstem, hypothalamus and limbic system, which explains why NPY has an impact on stress-related changes in emotional-affective behaviour and feeding as well as on stress coping. The biological actions of NPY in mammals are mediated by the Y1, Y2, Y4 and Y5 receptors, Y1 receptor stimulation being anxiolytic whereas Y2 receptor activation is anxiogenic. Emerging evidence attributes NPY a role in stress resilience, the ability to cope with stress. Thus there is a negative correlation between stress-induced behavioural disruption and cerebral NPY expression in animal models of post-traumatic stress disorder. Exogenous NPY prevents the negative consequences of stress, and polymorphisms of the NPY gene are predictive of impaired stress processing and increased risk of neuropsychiatric diseases. Stress is also a factor contributing to, and resulting from, neurodegenerative diseases such as Alzheimer's, Parkinson's and Huntington's disease, in which NPY appears to play an important neuroprotective role. This review summarizes the evidence for an implication of NPY in stress-related and neurodegenerative pathologies and addresses the cerebral NPY system as a therapeutic target.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.npep.2015.09.008DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4830398PMC
February 2016

Neuroimmune pharmacological approaches.

Curr Opin Pharmacol 2015 Dec 29;25:13-22. Epub 2015 Sep 29.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz, Universitätsplatz 4, A-8010 Graz, Austria.

Intestinal inflammation is a major health problem which impairs the quality of life, impacts mental health and is exacerbated by stress and psychiatric disturbances which, in turn, can affect disease prognosis and response to treatment. Accumulating evidence indicates that the immune system is an important interface between intestinal inflammation and the enteric, sensory, central and autonomic nervous systems. In addition, the neuroimmune interactions originating from the gastrointestinal tract are orchestrated by the gut microbiota. This article reviews some major insights into this complex homeostatic network that have been achieved during the past two years and attempts to put these advances into perspective with novel opportunities of pharmacological intervention.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.coph.2015.09.003DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4830400PMC
December 2015

Behavioral and molecular processing of visceral pain in the brain of mice: impact of colitis and psychological stress.

Front Behav Neurosci 2015 10;9:177. Epub 2015 Jul 10.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz Graz, Austria.

Gastrointestinal disorders with abdominal pain are associated with central sensitization and psychopathologies that are often exacerbated by stress. Here we investigated the impact of colitis induced by dextran sulfate sodium (DSS) and repeated water avoidance stress (WAS) on spontaneous and nociception-related behavior and molecular signaling in the mouse brain. DSS increased the mechanical pain sensitivity of the abdominal skin while both WAS and DSS enhanced the mechanical and thermal pain sensitivity of the plantar skin. These manifestations of central sensitization were associated with augmented c-Fos expression in spinal cord, thalamus, hypothalamus, amygdala and prefrontal cortex. While WAS stimulated phosphorylation of mitogen-activated protein kinase (MAPK) p42/44, DSS activated another signaling pathway, both of which converged on c-Fos. The DSS- and WAS-induced hyperalgesia in the abdominal and plantar skin and c-Fos expression in the brain disappeared when the mice were subjected to WAS+DSS treatment. Intrarectal allyl isothiocyanate (AITC) evoked aversive behavior (freezing, reduction of locomotion and exploration) in association with p42/44 MAPK and c-Fos activation in spinal cord and brain. These effects were inhibited by morphine, which attests to their relationship with nociception. DSS and WAS exerted opposite effects on AITC-evoked p42/44 MAPK and c-Fos activation, which indicates that these transduction pathways subserve different aspects of visceral pain processing in the brain. In summary, behavioral perturbations caused by colitis and psychological stress are associated with distinct alterations in cerebral signaling. These findings provide novel perspectives on central sensitization and the sensory and emotional processing of visceral pain stimuli in the brain.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fnbeh.2015.00177DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4498125PMC
July 2015

Dextran sulfate sodium-induced colitis alters stress-associated behaviour and neuropeptide gene expression in the amygdala-hippocampus network of mice.

Sci Rep 2015 Jun 12;5:9970. Epub 2015 Jun 12.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz, Graz, Austria.

Psychological stress causes disease exacerbation and relapses in inflammatory bowel disease (IBD) patients. Since studies on stress processing during visceral inflammation are lacking, we investigated the effects of experimental colitis as well as psychological stress on neurochemical and neuroendocrine changes as well as behaviour in mice. Dextran sulfate sodium (DSS)-induced colitis and water avoidance stress (WAS) were used as mouse models of colitis and mild psychological stress, respectively. We measured WAS-associated behaviour, gene expression and proinflammatory cytokine levels within the amygdala, hippocampus and hypothalamus as well as plasma levels of cytokines and corticosterone in male C57BL/6N mice. Animals with DSS-induced colitis presented with prolonged immobility during the WAS session, which was associated with brain region-dependent alterations of neuropeptide Y (NPY), NPY receptor Y1, corticotropin-releasing hormone (CRH), CRH receptor 1, brain-derived neurotrophic factor and glucocorticoid receptor gene expression. Furthermore, the combination of DSS and WAS increased interleukin-6 and growth regulated oncogene-α levels in the brain. Altered gut-brain signalling in the course of DSS-induced colitis is thought to cause the observed distinct gene expression changes in the limbic system and the aberrant molecular and behavioural stress responses. These findings provide new insights into the effects of stress during IBD.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/srep09970DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4464346PMC
June 2015

A novel unbiased counting method for the quantification of synapses in the mouse brain.

J Neurosci Methods 2015 Jan 3;240:13-21. Epub 2014 Nov 3.

Research Unit Electron Microscopic Techniques, Institute of Cell Biology, Histology and Embryology, Medical University of Graz, Harrachgasse 21, 8010 Graz, Austria. Electronic address:

Background: The numerical density of synapses and their ultrastructural features are best assessed with electron microscopy. Counting is done within counting frames placed on a pair of sections (disector technique). But this requires that the thin sections are taken from comparable brain regions and the disectors are placed in a uniform random fashion. Small brain areas like the polymorph layer of the mouse dentate gyrus are difficult to encounter, and manually moving the microscope stage for placing the micrographs seems arbitrary.

New Method: Here the polymorph layer was approximated with 20μm thin, Nissl-stained vibratome sections. The subsequent vibratome section was processed for electron microscopy and serially thin sectioned. The microscope stage was moved using a random number generator, placing at least 20 disectors onto a pair of sections. The numerical synapse density, the numerical density of dense-core vesicles, and other ultrastructural features were compared between mice that had been kept in an enriched environment and mice kept under standard housing conditions.

Results: Environmental enrichment significantly decreased the numerical density of dense-core vesicles and synaptic cleft widths within the polymorph layer, associated with behavioral improvement in the Morris water maze, a hippocampus-dependent task of spatial learning and memory.

Comparison With Existing Methods: This procedure was easy to handle and enabled us to produce thin sections in small, defined brain areas. Furthermore, placing the disectors with random numbers excluded observer bias.

Conclusions: Our procedure provides an uncomplicated way of assessing numerical densities in small brain areas in an unbiased manner.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jneumeth.2014.10.020DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4282307PMC
January 2015

Repeated predictable stress causes resilience against colitis-induced behavioral changes in mice.

Front Behav Neurosci 2014 6;8:386. Epub 2014 Nov 6.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz Graz, Austria.

Inflammatory bowel disease is associated with an increased risk of mental disorders and can be exacerbated by stress. In this study which was performed with male 10-week old C57Bl/6N mice, we used dextran sulfate sodium (DSS)-induced colitis to evaluate behavioral changes caused by intestinal inflammation, to assess the interaction between repeated psychological stress (water avoidance stress, WAS) and colitis in modifying behavior, and to analyze neurochemical correlates of this interaction. A 7-day treatment with DSS (2% in drinking water) decreased locomotion and enhanced anxiety-like behavior in the open field test and reduced social interaction. Repeated exposure to WAS for 7 days had little influence on behavior but prevented the DSS-induced behavioral disturbances in the open field and SI tests. In contrast, repeated WAS did not modify colon length, colonic myeloperoxidase content and circulating proinflammatory cytokines, parameters used to assess colitis severity. DSS-induced colitis was associated with an increase in circulating neuropeptide Y (NPY), a rise in the hypothalamic expression of cyclooxygenase-2 mRNA and a decrease in the hippocampal expression of NPY mRNA, brain-derived neurotrophic factor mRNA and mineralocorticoid receptor mRNA. Repeated WAS significantly decreased the relative expression of corticotropin-releasing factor mRNA in the hippocampus. The effect of repeated WAS to blunt the DSS-evoked behavioral disturbances was associated with a rise of circulating corticosterone and an increase in the expression of hypothalamic NPY mRNA. These results show that experimental colitis leads to a particular range of behavioral alterations which can be prevented by repeated WAS, a model of predictable chronic stress, while the severity of colitis remains unabated. We conclude that the mechanisms underlying the resilience effect of repeated WAS involves hypothalamic NPY and the hypothalamic-pituitary-adrenal axis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fnbeh.2014.00386DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4222228PMC
November 2014

Synergistic effects of NOD1 or NOD2 and TLR4 activation on mouse sickness behavior in relation to immune and brain activity markers.

Brain Behav Immun 2015 Feb 11;44:106-20. Epub 2014 Sep 11.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz, Universitätsplatz 4, 8010 Graz, Austria.

Toll-like receptors (TLRs) and nuclear-binding domain (NOD)-like receptors (NLRs) are sensors of bacterial cell wall components to trigger an immune response. The TLR4 agonist lipopolysaccharide (LPS) is a strong immune activator leading to sickness and depressed mood. NOD agonists are less active but can prime immune cells to augment LPS-induced cytokine production. Since the impact of NOD and TLR co-activation in vivo has been little studied, the effects of the NOD1 agonist FK565 and the NOD2 agonist muramyl dipeptide (MDP), alone and in combination with LPS, on immune activation, brain function and sickness behavior were investigated in male C57BL/6N mice. Intraperitoneal injection of FK565 (0.001 or 0.003mg/kg) or MDP (1 or 3mg/kg) 4h before LPS (0.1 or 0.83mg/kg) significantly aggravated and prolonged the LPS-evoked sickness behavior as deduced from a decrease in locomotion, exploration, food intake and temperature. When given alone, FK565 and MDP had only minor effects. The exacerbation of sickness behavior induced by FK565 or MDP in combination with LPS was paralleled by enhanced plasma protein and cerebral mRNA levels of proinflammatory cytokines (IFN-γ, IL-1β, IL-6, TNF-α) as well as enhanced plasma levels of kynurenine. Immunohistochemical visualization of c-Fos in the brain revealed that NOD2 synergism with TLR4 resulted in increased activation of cerebral nuclei relevant to sickness. These data show that NOD1 or NOD2 synergizes with TLR4 in exacerbating the immune, sickness and brain responses to peripheral immune stimulation. Our findings demonstrate that the known interactions of NLRs and TLRs at the immune cell level extend to interactions affecting brain function and behavior.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.bbi.2014.08.011DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4295938PMC
February 2015

GAL3 receptor KO mice exhibit an anxiety-like phenotype.

Proc Natl Acad Sci U S A 2014 May 29;111(19):7138-43. Epub 2014 Apr 29.

Laura Bassi Centre of Expertise-Therapeutic Application of Neuropeptides (THERAPEP), Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, and

The neuropeptide galanin (GAL) is widely distributed in the central and peripheral nervous systems. It is a modulator of various physiological and pathological processes, and it mediates its effects via three G protein-coupled receptors (GAL1-3 receptors). A role for GAL as a modulator of mood and anxiety was suggested, because GAL and its receptors are highly expressed in limbic brain structures of rodents. In recent years, numerous studies of animal models have suggested an involvement of GAL and GAL1 and GAL2 receptors in anxiety- and depression-related behavior. However, to date, there is sparse literature implicating GAL3 receptors in behavioral functions. Therefore, we studied the behavior of GAL3 receptor-deficient (GAL3-KO) mice to elucidate whether GAL3 receptors are involved in mediating behavior-associated actions of GAL. The GAL3-KO mouse line exhibited normal breeding and physical development. In addition to behavioral tests, phenotypic characterization included analysis of hematology, amino acid profiles, metabolism, and sudomotor function. In contrast to WT littermates, male GAL3-KO mice exhibited an anxiety-like phenotype in the elevated plus maze, open field, and light/dark box tests, and they were less socially affiliated than WT animals to a stranger mouse in a social interaction test. In conclusion, our data suggest involvement of GAL3 receptors in GAL-mediated effects on mood, anxiety, and behavior, making it a possible target for alternative treatment strategies for mood disorders.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1073/pnas.1318066111DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4024886PMC
May 2014

Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system.

PLoS One 2013 17;8(1):e54811. Epub 2013 Jan 17.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz, Graz, Austria.

Environmental enrichment (EE) has a beneficial effect on rodent behaviour, neuronal plasticity and brain function. Although it may also improve stress coping, it is not known whether EE influences the brain response to an external (psychological) stressor such as water avoidance stress (WAS) or an internal (systemic) stressor such as gastrointestinal inflammation. This study hence explored whether EE modifies WAS-induced activation of the mouse corticolimbic system and whether this stress response is altered by gastritis or colitis. Male C67BL/6N mice were housed under standard or enriched environment for 9 weeks, after which they were subjected to a 1-week treatment with oral iodoacetamide to induce gastritis or oral dextran sulfate sodium to induce colitis. Following exposure to WAS the expression of c-Fos, a marker of neuronal activation, was measured by immunocytochemistry. EE aggravated experimentally induced colitis, but not gastritis, as shown by an increase in the disease activity score and the colonic myeloperoxidase content. In the brain, EE enhanced the WAS-induced activation of the dentate gyrus and unmasked an inhibitory effect of gastritis and colitis on WAS-evoked c-Fos expression within this part of the hippocampus. Conversely, EE inhibited the WAS-evoked activation of the central amygdala and prevented the inhibitory effect of gastritis and colitis on WAS-evoked c-Fos expression in this region. EE, in addition, blunted the WAS-induced activation of the infralimbic cortex and attenuated the inhibitory effect of gastritis and colitis on WAS-evoked c-Fos expression in this area. These data reveal that EE has a region-specific effect on stress-induced c-Fos expression in the corticolimbic system, which is likely to improve stress resilience. The response of the prefrontal cortex - amygdala - hippocampus circuitry to psychological stress is also modified by the systemic stress of gut inflammation, and this interaction between external and internal stressors is modulated by the housing environment.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0054811PLOS
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3547954PMC
July 2013

Neuropeptide Y, peptide YY and pancreatic polypeptide in the gut-brain axis.

Neuropeptides 2012 Dec 11;46(6):261-74. Epub 2012 Sep 11.

Research Unit of Translational Neurogastroenterology, Institute of Experimental and Clinical Pharmacology, Medical University of Graz, Universitätsplatz 4, A-8010 Graz, Austria.

The gut-brain axis refers to the bidirectional communication between the gut and the brain. Four information carriers (vagal and spinal afferent neurons, immune mediators such as cytokines, gut hormones and gut microbiota-derived signalling molecules) transmit information from the gut to the brain, while autonomic neurons and neuroendocrine factors carry outputs from the brain to the gut. The members of the neuropeptide Y (NPY) family of biologically active peptides, NPY, peptide YY (PYY) and pancreatic polypeptide (PP), are expressed by cell systems at distinct levels of the gut-brain axis. PYY and PP are exclusively expressed by endocrine cells of the digestive system, whereas NPY is found at all levels of the gut-brain and brain-gut axis. The major systems expressing NPY comprise enteric neurons, primary afferent neurons, several neuronal pathways throughout the brain and sympathetic neurons. In the digestive tract, NPY and PYY inhibit gastrointestinal motility and electrolyte secretion and in this way modify the input to the brain. PYY is also influenced by the intestinal microbiota, and NPY exerts, via stimulation of Y1 receptors, a proinflammatory action. Furthermore, the NPY system protects against distinct behavioural disturbances caused by peripheral immune challenge, ameliorating the acute sickness response and preventing long-term depression. At the level of the afferent system, NPY inhibits nociceptive input from the periphery to the spinal cord and brainstem. In the brain, NPY and its receptors (Y1, Y2, Y4, Y5) play important roles in regulating food intake, energy homeostasis, anxiety, mood and stress resilience. In addition, PP and PYY signal to the brain to attenuate food intake, anxiety and depression-related behaviour. These findings underscore the important role of the NPY-Y receptor system at several levels of the gut-brain axis in which NPY, PYY and PP operate both as neural and endocrine messengers.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.npep.2012.08.005DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3516703PMC
December 2012

Association of cardiorespiratory fitness and morphological brain changes in the elderly: results of the Austrian Stroke Prevention Study.

Neurodegener Dis 2012 21;10(1-4):135-7. Epub 2012 Jan 21.

Institute of Molecular Biology and Biochemistry, Center of Molecular Medicine, Medical University of Graz, Graz, Austria.

Background: Physical activity and cardiorespiratory fitness relate to better cognitive performance. Little is known about the effects of fitness on structural brain abnormalities in the elderly.

Objective: Assess the association between maximal oxygen consumption (VO(2)max), white matter lesion (WML) volume and brain parenchymal fraction (BPF) in a large cohort of community-dwelling elderly individuals.

Methods: The study population consisted of 715 participants of the Austrian Stroke Prevention Study who underwent brain MRI with semi-automated measurement of WML volume (cm(3)) and automated assessment of BPF (%) by the use of SIENAX. A maximal exercise stress test was done on a bicycle ergometer. VO(2)max was calculated based on maximum and resting heart rate.

Results: After adjustment for possible confounders, VO(2)max was independently associated with WML volume (β = -0.10; p = 0.02); no significant relationship existed with silent cerebral infarcts and BPF. Associations between VO(2)max and WML load were only significant in men, but not in women.

Conclusion: Our findings may have important preventive implications because WMLs are known to be a major determinant of cognitive decline and disability in old age.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1159/000334760DOI Listing
August 2012

Thyroid metastases of renal cell carcinoma: clinical course in 45 patients undergoing surgery. Assessment of factors affecting patients' survival.

Thyroid 2008 Jun;18(6):615-24

Department of Surgery, University of Regensburg, Regensburg, Germany.

Background: Metastases of renal cell carcinoma (RCC) to the thyroid gland are uncommon. There is no clear consensus regarding the role of surgery in metastatic disease to the thyroid since most clinical studies include small numbers of patients. Also, risk factors associated with disease progression following thyroidectomy are not yet defined. We examined the determinants of the outcome in patients undergoing surgery for thyroid metastases of RCC.

Methods: The medical records of 45 patients undergoing resection of thyroid metastases of RCC at 15 institutions in Germany and Austria were reviewed retrospectively. The outcome parameters assessed were overall survival and tumor-related survival. Factors associated with disease progression following thyroid surgery have been calculated.

Results: The overall 5-year survival rate following thyroid metastasectomy was 51%. Nineteen patients died during the study: 14 of disseminated disease and 5 of non-tumor-related causes. In the multivariate analysis, the prognosis was significantly worse in patients older than > or = 70 years and in patients who had undergone nephrectomy for metastases in the contralateral kidney during the course of the disease. Nine patients developed a thyroid recurrence following surgery. No local disease relapse occurred if resection margins were documented to be free of the tumor. Of the 45 patients with thyroid metastases, 14 (31%) developed pancreatic metastases during the course of disease. Ten of these patients also underwent pancreatic surgery with a 5-year survival rate of 43% in this subgroup.

Conclusions: The overall survival of patients undergoing thyroidectomy for metastases of RCC is affected rather by general health status than by tumor-related factors. There is a significant coincidence of thyroid and pancreatic metastases of RCC.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1089/thy.2007.0343DOI Listing
June 2008