Publications by authors named "Fatemeh Suri"

25 Publications

  • Page 1 of 1

Unraveling the genetic complexities of combined retinal dystrophy and hearing impairment.

Hum Genet 2021 Jun 20. Epub 2021 Jun 20.

Institute of Human Genetics, Julius Maximilians University Würzburg, 97074, Würzburg, Germany.

Usher syndrome, the most prevalent cause of combined hereditary vision and hearing impairment, is clinically and genetically heterogeneous. Moreover, several conditions with phenotypes overlapping Usher syndrome have been described. This makes the molecular diagnosis of hereditary deaf-blindness challenging. Here, we performed exome sequencing and analysis on 7 Mexican and 52 Iranian probands with combined retinal degeneration and hearing impairment (without intellectual disability). Clinical assessment involved ophthalmological examination and hearing loss questionnaire. Usher syndrome, most frequently due to biallelic variants in MYO7A (USH1B in 16 probands), USH2A (17 probands), and ADGRV1 (USH2C in 7 probands), was diagnosed in 44 of 59 (75%) unrelated probands. Almost half of the identified variants were novel. Nine of 59 (15%) probands displayed other genetic entities with dual sensory impairment, including Alström syndrome (3 patients), cone-rod dystrophy and hearing loss 1 (2 probands), and Heimler syndrome (1 patient). Unexpected findings included one proband each with Scheie syndrome, coenzyme Q10 deficiency, and pseudoxanthoma elasticum. In four probands, including three Usher cases, dual sensory impairment was either modified/aggravated or caused by variants in distinct genes associated with retinal degeneration and/or hearing loss. The overall diagnostic yield of whole exome analysis in our deaf-blind cohort was 92%. Two (3%) probands were partially solved and only 3 (5%) remained without any molecular diagnosis. In many cases, the molecular diagnosis is important to guide genetic counseling, to support prognostic outcomes and decisions with currently available and evolving treatment modalities.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00439-021-02303-1DOI Listing
June 2021

Intravitreal connective tissue growth factor neutralizing antibody or bevacizumab alone or in combination for prevention of proliferative vitreoretinopathy in an experimental model.

Exp Eye Res 2021 Jul 19;208:108622. Epub 2021 May 19.

Ophthalmic Research Center, Research Institute for Ophthalmology and Vision Science, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Electronic address:

Connective tissue growth factor (CTGF) is released by retinal pigment epithelial (RPE) cells and detectable in proliferative membranes (PrMs). This experimental study was performed to investigate the mRNA and protein levels of both CTGF and vascular endothelial growth factor A (VEGF-A) in a rabbit model of proliferative vitreoretinopathy (PVR). In addition, the effects of a single intravitreal injection of the safe dose of anti-CTGF or bevacizumab as monotherapy and in combination were evaluated. PVR was induced in the right eye of albino rabbits by intravitreal injection of cultured adult human RPE cells. Quantitative real-time reverse transcription PCR (qRT-PCR) and Western blot analysis of CTGF and VEGF-A were performed on whole eye tissue in the PVR model versus controls at different time points. In the next step, the PVR models were assigned to five groups. The monotherapy groups received a single intravitreal injection of 0.1 ml of anti-CTGF 100 μg/ml (final concentration of 6.6 μg/ml in the vitreous) or 0.03 ml of 25 mg/ml bevacizumab. In the combined group, the abovementioned amounts of anti-CTGF and bevacizumab were injected intravitreally from separate sites in one session. No antibody injection was performed in the control group. Intravitreal injection of 0.1 ml of control IgG (1 mg/ml of isotype matched) antibody was performed in the placebo group. After 2 weeks, histologic evaluation including, trichrome staining for collagen, immunostaining by anti-alpha-smooth muscle actin for myofibroblasts, and anti-collagen type-1 antibody on paraffin embedded anterior-posterior sections was done. In addition, fundus photography was performed for clinically equivalent PVR staging. Twenty-four hours following PVR induction, CTGF mRNA and protein levels increased five- and- three-fold compared to controls, respectively (P < 0.001). VEGF-A mRNA and protein levels decreased significantly after 72 h of PVR induction compared to controls (P < 0.05). Means of PrM thickness and myofibroblast cell counts significantly decreased in the anti-CTGF group (P < 0.001 and P < 0.05, respectively). The mean area of collagen type-1 fibers of PrM in the mono- and combination therapy groups that received intravitreal anti-CTGF was significantly reduced (P < 0.001); in addition, mild PVR (stage-1 and 2) formation occurred in comparison with moderate to severe PVR (stage-4 and higher) in other groups. In conclusion, we found that intravitreal injection of CTGF neutralizing antibody resulted in a reduction in PrM thickness, collagen fibers and myofibroblast density in the PVR model. CTGF inhibition may represent a potential therapeutic target for PVR.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.exer.2021.108622DOI Listing
July 2021

Autosomal Recessive Bestrophinopathy: Clinical and Genetic Characteristics of Twenty-Four Cases.

J Ophthalmol 2021 30;2021:6674290. Epub 2021 Apr 30.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Background: To describe ocular manifestations, imaging characteristics, and genetic test results of autosomal recessive bestrophinopathy (ARB). The study design is an observational case series.

Methods: Forty-eight eyes of 24 patients diagnosed with ARB underwent complete ophthalmic examinations including refraction, anterior and posterior segment examination, enhanced depth imaging optical coherence tomography (EDI-OCT), fluorescein angiography (FA), electroretinography (ERG), and electrooculography (EOG). Optical coherence tomography angiography (OCTA) and BEST1 gene sequencing were performed in selected patients.

Results: The age at onset was 4-35 years (mean: 18.6 years). The male-to-female ratio was 0.45. All patients were hyperopic, except one with less than one diopter myopia. EOG was abnormal in 18 cases with near-normal ERGs. Six patients did not undergo EOG due to their young age. Eighteen patients (75%) had a thick choroid on EDI-OCT, of which three had advanced angle-closure glaucoma, 15 patients were hyperopic, and eight of them had more than four diopters hyperopia in both eyes. Macular retinoschisis was observed in 46 eyes of 23 patients (95%) with cysts mostly located in the inner nuclear layer (INL) to the outer nuclear layer (ONL). Of the 18 patients who underwent FA, mild peripheral leakage was seen in eight eyes of four patients (22%). Subfoveal choroidal neovascularization (CNV) was seen in three eyes of two patients (6%) that responded well to intravitreal bevacizumab (IVB). Seven mutations of the bestrophin-1 (BEST1) gene were found in this study; however, only two of them (p.Gly34 = and p.Leu319Pro) had been previously reported as the cause of ARB based on ClinVar and other literature studies.

Conclusions: ARB can be presented with a wide spectrum of ocular abnormalities that may not be easily diagnosed. Pachychoroid can occur alongside retinal schisis and may be the underlying cause of angle-closure glaucoma in ARB. Our study also expands the pathogenic mutation spectrum of the BEST1 gene associated with ARB.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1155/2021/6674290DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8105111PMC
April 2021

SVEP1 as a Genetic Modifier of TEK-Related Primary Congenital Glaucoma.

Invest Ophthalmol Vis Sci 2020 10;61(12)

Genetics Research Center, Molecular and Clinical Sciences Institute, St George's, University of London, Cranmer Terrace, London, United Kingdom.

Purpose: Affecting children by age 3, primary congenital glaucoma (PCG) can cause debilitating vision loss by the developmental impairment of aqueous drainage resulting in high intraocular pressure (IOP), globe enlargement, and optic neuropathy. TEK haploinsufficiency accounts for 5% of PCG in diverse populations, with low penetrance explained by variable dysgenesis of Schlemm's canal (SC) in mice. We report eight families with TEK-related PCG, and provide evidence for SVEP1 as a disease modifier in family 8 with a higher penetrance and severity.

Methods: Exome sequencing identified coding/splice site variants with an allele frequency less than 0.0001 (gnomAD). TEK variant effects were assayed in construct-transfected HEK293 cells via detection of autophosphorylated (active) TEK protein. An enucleated eye from an affected member of family 8 was examined via histology. SVEP1 expression in developing outflow tissues was detected by immunofluorescent staining of 7-day mouse anterior segments. SVEP1 stimulation of TEK expression in human umbilical vascular endothelial cells (HUVECs) was measured by TaqMan quantitative PCR.

Results: Heterozygous TEK loss-of-function alleles were identified in eight PCG families, with parent-child disease transmission observed in two pedigrees. Family 8 exhibited greater disease penetrance and severity, histology revealed absence of SC in one eye, and SVEP1:p.R997C was identified in four of the five affected individuals. During SC development, SVEP1 is secreted by surrounding tissues. SVEP1:p.R997C abrogates stimulation of TEK expression by HUVECs.

Conclusions: We provide further evidence for PCG caused by TEK haploinsufficiency, affirm autosomal dominant inheritance in two pedigrees, and propose SVEP1 as a modifier of TEK expression during SC development, affecting disease penetrance and severity.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1167/iovs.61.12.6DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7545080PMC
October 2020

Choroidal Thickness in Different Types of Inherited Retinal Dystrophies.

J Ophthalmic Vis Res 2020 Jul-Sep;15(3):351-361. Epub 2020 Aug 6.

Ocular Tissue Engineering Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Purpose: To compare the choroidal thickness among eyes with retinitis pigmentosa (RP), Stargardt disease, Usher syndrome, cone-rod dystrophy, and healthy eyes of sex- and age-matched individuals.

Methods: In this comparative study, 503 eyes with RP ( = 264), cone-rod dystrophy ( = 109), Stargardt disease ( = 76), and Usher syndrome ( = 54) were included. To validate the data, 109 healthy eyes of 56 sex- and age-matched individuals were studied as controls. Choroidal imaging was performed using enhanced depth imaging-optical coherence tomography. Choroidal thickness was measured manually using MATLAB software at 13 points in nasal and temporal directions from the foveal center with the interval of 500 µm and the choroidal area encompassing the measured points was calculated automatically.

Results: The mean age was 36.33 13.07 years (range, 5 to 72 years). The mean choroidal thickness at 13 points of the control eyes was statistically significantly higher than that in eyes with RP ( 0.001) and Usher syndrome ( 0.05), but not significantly different from that in eyes with Stargardt disease and cone-rod dystrophy. Among different inherited retinal dystrophies (IRDs), the choroidal thickness was the lowest in eyes with RP ( 0.001). Choroidal thickness in the subfoveal area correlated negatively with best-corrected visual acuity ( = 0.264, 0.001) and the duration of ocular symptoms ( = 0.341, 0.001) in all studied IRDs. No significant correlation was observed between the subfoveal choroidal thickness and central macular thickness ( = 0.24, = 0.576).

Conclusion: Choroidal thinning in four different types of IRDs does not follow a similar pattern and depends on the type of IRD and the duration of ocular symptoms. A larger cohort is required to verify these findings.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.18502/jovr.v15i3.7454DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7431727PMC
August 2020

The First Inherited Retinal Disease Registry in Iran: Research Protocol and Results of a Pilot Study.

Arch Iran Med 2020 07 1;23(7):445-454. Epub 2020 Jul 1.

Ophthalmic Research Center, Research Institute for Ophthalmology and Vision Science, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Background: To describe the protocol for developing a national inherited retinal disease (IRD) registry in Iran and present its initial report.

Methods: This community-based participatory research was approved by the Ministry of Health and Medical Education of Iran in 2016. To provide the minimum data set (MDS), several focus group meetings were held. The final MDS was handed over to an engineering team to develop a web-based software. In the pilot phase, the software was set up in two referral centers in Iran. Final IRD diagnosis was made based on clinical manifestations and genetic findings. Ultimately, patient registration was done based on all clinical and non-clinical manifestations.

Results: Initially, a total of 151 data elements were approved with Delphi technique. The registry software went live at www. IRDReg.org based on DHIS2 open source license agreement since February 2016. So far, a total of 1001 patients have been registered with a mean age of 32.41±15.60 years (range, 3 months to 74 years). The majority of the registered patients had retinitis pigmentosa (42%, 95% CI: 38.9% to 45%). Genetic testing was done for approximately 20% of the registered individuals.

Conclusion: Our study shows successful web-based software design and data collection as a proof of concept for the first IRD registry in Iran. Multicenter integration of the IRD registry in medical centers throughout the country is well underway as planned. These data will assist researchers to rapidly access information about the distribution and genetic patterns of this disease.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.34172/aim.2020.41DOI Listing
July 2020

Association of Saitohin gene rs62063857 polymorphism with dry type age-related macular degeneration.

Ophthalmic Genet 2020 10 2;41(5):505-506. Epub 2020 Jul 2.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences , Tehran,Iran.

Purpose: Age-related macular degeneration (AMD) as the leading cause of central visual loss in the developed countries has extensive pathologic similarities with Alzheimer's disease (AD). Saitohin rs62063857 Q7 R polymorphism is associated with increased risk of AD though we decided to evaluate the possible association of this polymorphism with advanced AMD.

Materials And Methods: 152 advanced AMD patients (134 wet AMD and 18 geographic atrophy) and 75 healthy controls included in this study. Cases and controls went through a standard ophthalmologic examination by a retinal specialist. Saitohin gene rs62063857 polymorphism determined by using PCR technique and restriction enzyme HinFI. To evaluate the differences between groups we used t-test, Chi-Squared and one-tailed Fisher exact test.

Results: Distribution of genotypes was not significantly different between total AMD or wet AMD patients compared to that of controls (total AMD RR+QR: OR = 1.51, CI = 0.82-2.79, = .12; wet AMD RR+QR: OR = 1.39, CI = 0.74-2.59, = .19). The RR+QR genotypes were significantly higher in dry AMD group compared to that of controls (RR+QR: OR = 2.75, CI = 0.96-7.9, = .05).

Conclusion: Our results showed that although STH Q7 R polymorphism was not associated with wet AMD susceptibility it was significantly associated with geographic atrophy.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/13816810.2020.1786842DOI Listing
October 2020

mutation as the cause of various clinical manifestations in a family affected with inherited retinal dystrophy.

Ophthalmic Genet 2019 10 16;40(5):436-442. Epub 2019 Oct 16.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

: To reveal the underlying genetic defect in a complex family affected with different clinical features of inherited retinal dystrophy, we carried out whole exome sequencing followed by confirmatory molecular tests.: Complete ophthalmic examinations were performed for available affected family members. Whole exome sequencing, bioinformatics analysis, Sanger sequencing confirmation, and segregation analysis were done to identify the causative mutation.: Clinical findings suggested fundus flavimaculatus as an early clinical feature progressing to an extensive chorioretinal atrophy involving the macula and mid-periphery of the fundus in one parent and central areolar chorioretinal dystrophy (CACD) as the most probable clinical diagnosis in another parent. Macular pattern dystrophy for one of their daughters and a Leber congenital amaurosis (LCA) like phenotype for the daughter with an early onset retinal dystrophy (EORD) phenotype was suggested. We found a known pathogenic nonsense variation in the gene (NM_000322: p.Gln239Ter). The parents with end stage fundus flavimaculatus and CACD diagnosis and their daughter with macular pattern dystrophy were heterozygous for the identified variant. The daughter affected with EORD/LCA like retinal dystrophy was homozygous for the same variation.: In this family, the same pathogenic variant in gene showed a wide range of clinical features of extensive chorioretinal macular atrophy with flecks as fundus falvimaculatus to CACD and macular pattern dystrophy in the heterozygous inheritance pattern and early onset/LCA like retinal dystrophy in the patient who was homozygous for the causative variant.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/13816810.2019.1678178DOI Listing
October 2019

Incomplete penetrance of gene for autosomal dominant form of cone-rod dystrophy.

Ophthalmic Genet 2019 06 19;40(3):259-266. Epub 2019 Jun 19.

b Ophthalmic Research Center , Shahid Beheshti University of Medical Sciences , Tehran , Iran.

: Cone-rod dystrophy (CRD) is an inherited retinal dystrophy that is transmitted via different modes of inheritance. Mutations in more than 30 genes have been identified to cause the disease. We aimed to investigate the genetic agents of two unrelated cone-rod dystrophy affected Iranian families with autosomal recessive inheritance patterns. : Whole-exome sequencing (WES) was performed for identification of the disease-causing mutations in the probands of both families. The candidate mutations were further confirmed by Sanger sequencing. Samples from five available members of each family were then sequenced for the mutations present in the probands. Comprehensive ocular examinations for all members of the families carrying the mutations were completed by ophthalmologists. : We identified a novel premature stop codon c.310C>T in gene in heterozygote form in two symptomatic and two non-symptomatic members of one family (family-A), and a known mutation c.122G>A in homozygote form in another (family B). c.122G>A has been reported to cause late-onset autosomal dominant form of the disease in previous studies. However, the middle-aged heterozygous carriers of the mutation in this family showed normal phenotype. : The gene has been previously linked to the autosomal dominant form of cone-rod dystrophy. We report incomplete penetrance of gene for autosomal dominant form of the disease. Incomplete penetrance of the mutations may be partly caused by the influence of other genes in the complex genetic network underlying retinal regulation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/13816810.2019.1622023DOI Listing
June 2019

Effects of intravitreal connective tissue growth factor neutralizing antibody on choroidal neovascular membrane-associated subretinal fibrosis.

Exp Eye Res 2019 07 25;184:286-295. Epub 2019 Apr 25.

Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Electronic address:

Connective tissue growth factor (CTGF) plays an essential role in the regulation of extracellular matrix proteins and pro-fibrotic and angiogenic factors. This experimental research was conducted to evaluate if CTGF is elevated after induction of a choroidal neovascular membrane (CNVM) and whether intravitreal anti-CTGF without and with intravitreal bevacizumab (IVB) may have any effect on the CNVM associated sub-retinal fibrosis. In adherence to ARRIVE guidelines, CNVM was induced by laser spots in the right eye retinas of ninety-four pigmented rats. Quantitative real-time reverse transcription PCR (qRT-PCR) and western-blot analysis were performed on sclerochoroidal tissues of forty-four rats before and at different time intervals after laser application. The remaining fifty rats were randomly divided into five groups after laser application. Group A received intravitreal injection of 2  μl of the 50 μg/ml anti-CTGF. In group B, intravitreal injection of 2  μl of 25 mg/ml bevacizumab was performed. Group C received 1  μl intravitreal anti-CTGF and 1  μl IVB. Group D did not receive any intravitreal injection as the control group. In group E, intravitreal injection of 2  μl of nonspecific purified mouse IgG antibody was performed as the placebo group. After two weeks, double immunohistochemistry was performed by isolectin B4 and anti-collagen type1 on the sclerochoroidal flat-mounts. Masked measurement of the fluorescent images of the CNVM and CNVM associated sub-retinal fibrosis areas was performed using the image J software. Ctgf mRNA and CTGF protein levels increased to the maximum level in 24 h after laser application and remained higher than the control level up to the 14th day for the Ctgf mRNA and up to the 7th day for the CTGF protein level. Means of CNVM associated sub-retinal fibrosis areas in three treatment groups (A, B and C) were significantly less than the control (D) and placebo (E) groups (P < 0.001, <0.05, <0.001 respectively). For groups A and C, mean CNVM associated sub-retinal fibrosis areas were also significantly less than group B (P < 0.05 and < 0.01, respectively). In conclusion, this study showed significant reduction of the CNVM associated sub-retinal fibrosis via inhibition of the CTGF which mediates the final steps of fibrosis in various inflammatory and angiogenic pathways.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.exer.2019.04.027DOI Listing
July 2019

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment.

Ophthalmic Genet 2019 04 15;40(2):146-149. Epub 2019 Apr 15.

c Ophthalmic Research Center , Shahid Beheshti University of Medical Sciences , Tehran , Iran.

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1080/13816810.2019.1597374DOI Listing
April 2019

P.Gly61Glu and P.Arg368His Mutations in CYP1B1 that Cause Congenital Glaucoma may be Relatively Frequent in Certain Regions of Gilan Province, Iran.

J Ophthalmic Vis Res 2018 Oct-Dec;13(4):403-410

Department of Biotechnology, College of Science, University of Tehran, Tehran, Iran.

Purpose: To perform a population-based screening of four mutations-p.Gly61Glu, p.Arg368His, p.Arg390His, and p.Arg469Trp-in the province of Gilan, Iran. Previous studies have shown that is a cause of disease in approximately 70% of Iranian patients with primary congenital glaucoma (PCG), and that these four mutations constitute the majority of mutated alleles. The carrier frequencies may even justify premarital screenings.

Methods: DNA was extracted from the blood samples of 700 individuals recruited in a population-based epidemiology study in Gilan. Screenings were performed using polymerase chain reaction protocols based on restriction fragment length polymorphism or the amplification-refractory mutation system. For confirmation, the DNA of individuals with mutations was sequenced using the Sanger protocol.

Results: Five individuals carried the p.Gly61Glu mutation, and seven carried the p.Arg368His mutation. The p.Arg390His and p.Arg469Trp mutations were not observed in any of the 700 individuals screened. The mutations were not geographically randomly distributed in Gilan; four of the p.Gly61Glu-harboring individuals were from Talesh, and six of the p.Arg368His-harboring individuals were from the eastern regions of Gilan.

Conclusion: The frequency of individuals who carry either p.Gly61Glu or p.Arg368His is relatively high in Gilan, and notably high in certain localities within Gilan. We suggest further screenings be performed to definitively assess the need for implementing measures to encourage screening for p.Gly61Glu and p.Arg368His before marriage in Talesh and the eastern regions of Gilan, respectively. Finally, our assessment showed that regional frequencies of mutations do not necessarily mirror national frequencies.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4103/jovr.jovr_147_17DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6210879PMC
November 2018

COL18A1 is a candidate eye iridocorneal angle-closure gene in humans.

Hum Mol Genet 2018 11;27(21):3772-3786

School of Biology, University College of Science, University of Tehran, Tehran, Iran.

Primary angle-closure glaucoma (PACG) is a common form of glaucoma in the Far East. Its defining feature is iridocorneal angle closure. In addition to PACG, indications of angle closure are included in the diagnostic criteria of related conditions primary angle-closure suspect (PACS) and primary angle closure (PAC). To the best of our knowledge, a causative gene for iridocorneal angle closure in humans has not been identified. This study aimed to identify the genetic cause of iridocorneal angle closure in a pedigree with at least 10 individuals diagnosed with PACS, PAC or PACG. Results of linkage analysis, segregation analysis of 44 novel variations, whole exome sequencing of 10 individuals, screenings of controls and bioinformatics predictions identified a mutation in COL18A1 that encodes collagen type XVIII as the most likely cause of angle closure in the pedigree. The role of COL18A1 in the etiology of Knobloch syndrome (KS) that is consistently accompanied by optic anomalies, available functional data on the encoded protein and the recognized role of collagens and the extracellular matrix in glaucoma pathogenesis supported the proposed role of the COL18A1 mutation in the pedigree. Subsequent identification of other COL18A1 mutations in PACS affected individuals of two unrelated families further supported that COL18A1 may affect angle closure. These PACS individuals were parents and grandparents of KS-affected children. In conclusion, a gene that affects angle closure in humans, a critical feature of PACG, has been identified. The findings also reinforce the importance of collagens in eye features and functions.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/hmg/ddy256DOI Listing
November 2018

LTBP2 knockdown and oxidative stress affect glaucoma features including TGFβ pathways, ECM genes expression and apoptosis in trabecular meshwork cells.

Gene 2018 Oct 14;673:70-81. Epub 2018 Jun 14.

School of Biology, University College of Science, University of Tehran, Tehran, Iran; Department of Biotechnology, University College of Science, University of Tehran, Tehran, Iran. Electronic address:

Glaucoma is the leading cause of irreversible blindness worldwide. Although the etiology of glaucoma is incompletely understood, it is known that the extracellular matrix (ECM) of the trabecular meshwork, oxidative stress, TGFβ signaling pathways, and apoptosis are important components of glaucoma pathogenesis. These components appear to be interrelated, but knowledge on their interactions remains incomplete. Relevant to this gap in knowledge, LTBP2, glaucoma causing gene, may also be related to the mentioned components of glaucoma pathogenesis because of its putative roles in TGFβ signaling and ECM functions. This background prompted us to further query interactions among some molecules and pathways thought to be important in glaucoma etiology, with emphasis on oxidative stress and LTBP2. To this end, effects of LTBP2 siRNA knockdown, oxidative stress induction, TGFβ2 and gremlin exposures on canonical TGFβ and BMP signaling pathways, expression of ECM related genes, and apoptosis were assayed in primary human trabecular meshwork cell cultures. We found that oxidative stress induction and LTBP2 knockdown both affected all the processes queried, and that their affects paralleled one another. We suggest that effects of both oxidative stress and LTBP2 knockdown on the ECM and apoptosis may be mediated by TGFβ and BMP signaling pathway activation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.gene.2018.06.038DOI Listing
October 2018

The p.Gly61Glu Mutation in CYP1B1 Affects the Extracellular Matrix in Glaucoma Patients.

Ophthalmic Res 2016 Jul 17;56(2):98-103. Epub 2016 Mar 17.

School of Biology, University College of Science, University of Tehran, Tehran, Iran.

Purpose: The aim of this work was to assess the possible effects of CYP1B1 mutations on the extracellular matrix (ECM) in glaucoma patients. CYP1B1 mutations are the cause of disease in a notable fraction of primary congenital glaucoma (PCG) patients and in a smaller fraction of primary open angle glaucoma (POAG) patients.

Methods: The study was performed on a glaucoma family with the common homozygous p.Gly61Glu CYP1B1 mutation. The father was affected with POAG and three siblings had PCG. Microscopy was performed on the skin of the father and one son, as well as controls. Immunohistochemical studies were done using anti-CYP1B1 and anti-fibrillin-1 antibodies. Fibrillin-1 served as a marker for the ECM, and electron microscopy was also performed.

Results: CYP1B1 expression patterns were the same in the patients and controls. However, microfibrils that are associated with fibrillin-1 were less abundant and more fragmented in both patients. Electron microscopy showed disturbed collagen fibers only in the PCG patient.

Conclusions: The p.Gly61Glu mutation in CYP1B1 affects the ECM structure. This implies that the ECM of the trabecular meshwork may also be disrupted in a manner that affects aqueous humor flow resulting in increased intraocular pressure and contributing to the glaucoma phenotype.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1159/000443508DOI Listing
July 2016

Glaucoma in iran and contributions of studies in iran to the understanding of the etiology of glaucoma.

J Ophthalmic Vis Res 2015 Jan-Mar;10(1):68-76

Department of Cell and Molecular Biology, School of Biology, College of Science, University of Tehran, Tehran, Iran ; Department of Biotechnology, College of Science, University of Tehran, Tehran, Iran.

Epidemiologic and genetic/molecular research on glaucoma in Iran started within the past decade. A population-based study on the epidemiology of glaucoma in Yazd, a city in central Iran, revealed that 4.4% of studied individuals were affected with glaucoma: 1.6% with high tension primary open angle glaucoma (POAG), 1.6% with normal tension POAG, and 0.4% each with primary angle closure glaucoma (PACG) and pseudoexfoliation glaucoma (PEXG), and other types of secondary glaucoma. Two notable observations were the relatively high frequency of normal tension glaucoma cases (1.6%) and the large fraction of glaucoma affected individuals (nearly 90%) who were unaware of their condition. The first and most subsequent genetic studies on glaucoma in Iran were focused on primary congenital glaucoma (PCG) showing that cytochrome P450 1B1 (CYP1B1) is the cause of PCG in the majority of Iranian patients, many different CYP1B1 mutations are present among Iranian patients but only four mutations constitute the vast majority, and the origins of most mutations in the Iranians are identical by descent (IBD) with the same mutations in other populations. Furthermore, most of the PCG patients are from the northern and northwestern provinces of Iran. A statistically significant male predominance of PCG was observed only among patients without CYP1B1 mutations. Clinical investigations on family members of PCG patients revealed that CYP1B1 mutations exhibit variable expressivity, but almost complete penetrance. A great number of individuals harboring CYP1B1 mutations become affected with juvenile onset POAG. Screening of JOAG patients showed that an approximately equal fraction of the patients harbor CYP1B1 and (myocilin) MYOC mutations; MYOC is a well-known adult onset glaucoma causing gene. Presence of CYP1B1 mutations in JOAG patients suggests that in some cases, the two conditions may share a common etiology. Further genetic analysis of Iranian PCG patients led to identification of Latent-transforming growth factor beta-binding protein 2 (LTBP2) as a causative gene for both PCG and several diseases which are often accompanied by glaucomatous presentations, such as Weill-Marchesani syndrome 3 (WMS3). The findings on LTBP2 have contributed to recognize the importance of the extracellular matrix in pathways leading to glaucoma.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.4103/2008-322X.156120DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4424722PMC
May 2015

Diagnosis of cystathionine beta-synthase deficiency by genetic analysis.

J Neurol Sci 2014 Dec 22;347(1-2):305-9. Epub 2014 Oct 22.

School of Biology, College of Science, University of Tehran, Tehran, Iran; Department of Biotechnology, College of Science, University of Tehran, Tehran, Iran. Electronic address:

Intellectual disability like other common diseases is often complex because they are genetically heterogeneous, with many different genetic defects giving rise to clinically indistinguishable phenotypes. We present diagnosis of cystathionine beta-synthase (CBS) deficiency in a multiply affected Iranian family with obvious intellectual disability based on whole genome SNP homozygosity mapping. Diagnosis based on clinical presentations had not been made because of unavailability of appropriate medical services. Genetic analysis led to identification of homozygous c.346G>A in CBS that causes p.Gly116Arg in the encoded protein, cystathionine beta-synthase. CBS is the most common causative gene of homocystinurea. Later, the same mutation was found in three other apparently unrelated Iranian homocystinuria patients. p.Gly116Arg was reported once before in a Turkish patient, suggesting it may be a common CBS deficiency causing mutation in the Middle East. Clinical features of the patients are reported that evidence to variable presentations caused by the same mutation. Finally, observations in heterozygous carriers of the mutation suggest data that a single allele of the p.Gly116Arg causing mutation may have phenotypic consequences, including cardiac related phenotypes. Our study attests to the powers of genetic analysis for diagnosis especially for some forms of intellectual disability, with known genetic causing agents.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.jns.2014.10.031DOI Listing
December 2014

FOXC1 in human trabecular meshwork cells is involved in regulatory pathway that includes miR-204, MEIS2, and ITGβ1.

Exp Eye Res 2013 Jun 27;111:112-21. Epub 2013 Mar 27.

School of Biology, Damghan University, Damghan, Iran.

Forkhead box C1 (FOXC1) is a transcription factor that affects eye development. FOXC1 is implicated in the etiology of glaucoma because mutations in the gene are among the causes of Axenfeld-Rieger syndrome which is often accompanied by glaucoma. Glaucoma is the second leading cause of blindness. It is a complex disorder whose genetic basis in most patients remains unknown. Microarrays expression analysis was performed to identify genes in human trabecular meshwork (TM) primary cultures that are affected by FOXC1 and genes that may have roles in glaucoma. This represents the first genome wide analysis of FOXC1 target genes in any tissue. FOXC1 knock down by siRNAs affected the expression of 849 genes. Results on selected genes were confirmed by real time PCR, immunoblotting, and dual luciferase reporter assays. Observation of MEIS2 as a FOXC1 target and consideration of FOXC1 as a potential target of miR-204 prompted testing the effect of this micro RNA on expression of FOXC1 and several genes identified by array analysis as FOXC1 target genes. It was observed that miR-204 caused decreased expression of FOXC1 and the FOXC1 target genes CLOCK, PLEKHG5, ITGβ1, and MEIS2 in the TM cultures. Expression of CLOCK, PLEKHG5, ITGβ1 has not previously been reported to be affected by miR-204. The data suggest existence of a complex regulatory pathway in the TM part of which includes interactions between FOXC1, miR-204, MEIS2, and ITGβ1. All these molecules are known to have TM relevant functions, and the TM is strongly implicated in the etiology of glaucoma.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.exer.2013.03.009DOI Listing
June 2013

Contribution of the latent transforming growth factor-β binding protein 2 gene to etiology of primary open angle glaucoma and pseudoexfoliation syndrome.

Mol Vis 2013 7;19:333-47. Epub 2013 Feb 7.

School of Biology, University College of Science, University of Tehran, Tehran, Iran.

Purpose: To assess for the first time the possible contribution of latent transforming growth factor (TGF)-beta binding protein 2 (LTBP2), an extracellular matrix (ECM) protein that associates with fibrillin-1-containing microfibrils, to the etiology of primary open angle glaucoma (POAG) and pseudoexfoliation (PEX) syndrome. Mutations in LTBP2 have previously been shown to be the cause of primary congenital glaucoma (PCG) and other disorders that often manifest as secondary glaucoma.

Methods: All exons of LTBP2 were sequenced in the DNA of 42 unrelated patients with POAG and 48 unrelated patients with PEX syndrome. Contribution of candidate variations to disease was assessed by screening in control individuals and use of biochemical, bioinformatics, and evolutionary criteria, and in one case by segregation analysis within the family of a proband with POAG. Microscopy was performed on the skin of a patient with PEX syndrome whose condition developed into PEX glaucoma during the course of the study and on the skin of her son previously identified with PCG who harbored the same LTBP2 mutation.

Results: Among the 30 sequence variations observed in LTBP2, five found in five patients with POAG and two found in two patients with PEX glaucoma syndrome may contribute to their diseases. One of the mutations was observed in a patient with POAG and in a patient with PEX glaucoma syndrome. Light, fluorescent, and electron microscopy showed that a mutation present in one of the individuals affected with PEX glaucoma syndrome and in her son affected with PCG causes disruptions in the ECM.

Conclusions: Some LTBP2 sequence variations can contribute to the etiology of POAG and PEX glaucoma syndrome. It is not expected that in these diseases LTBP2 mutations behave in a strictly Mendelian fashion with complete penetrance. In conjunction with recent findings, the results suggest that anomalies in the ECM are among the factors that can contribute to POAG and PEX glaucoma syndrome. LTBP2 and other related ECM protein coding genes should be screened in larger cohorts with these diseases, which are common disorders and important to the public health.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3568400PMC
September 2013

Myocilin mutations are not a major cause of primary congenital glaucoma in Iranian patients.

J Ophthalmic Vis Res 2010 Apr;5(2):101-4

School of Biology, College of Science, University of Tehran, Tehran, Iran.

Purpose: To assess the frequency of mutations in the Myocilin (MYOC) gene in Iranian patients affected with primary congenital glaucoma (PCG).

Methods: The individuals evaluated herein are among a larger cohort of 100 patients who had previously been screened for CYP1B1 mutations. Eighty subjects carried mutations in CYP1B1, but the remaining 20 patients who did not, underwent screening for MYOC mutations for the purpose of the study. MYOC exons in the DNA were polymerase chain reaction (PCR) amplified and sequenced. Sequencing was performed using PCR primers, the ABI big dye chemistry and an ABI3730XL instrument. Sequences were analyzed by comparing them to reference MYOC sequences using the Sequencher software.

Results: Four MYOC sequence variations were observed among the patients, but none of them were considered to be associated with disease status. Three of these variations were single nucleotide polymorphisms already reported not to be disease causing, the fourth variation created a synonymous codon and did not affect any amino acid change.

Conclusion: In this cohort, MYOC mutations were not observed in any Iranian subject with PCG. It is possible that in a larger sample, a few subjects carrying disease causing MYOC mutations could have been observed. But our results show that the contribution of MYOC to PCG status in Iran is small if any.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3380681PMC
April 2010

Variable expressivity and high penetrance of CYP1B1 mutations associated with primary congenital glaucoma.

Ophthalmology 2009 Nov 10;116(11):2101-9. Epub 2009 Sep 10.

School of Biology, University College of Science, University of Tehran, Tehran, Iran.

Objective: To investigate penetrance and expressivity of CYP1B1 genotypes associated with primary congenital glaucoma (PCG).

Design: Observational case series, systematic review, and comparative analysis of the literature.

Participants: Forty probands affected with PCG, 16 siblings affected with PCG, and 103 siblings and 75 parents of the probands reported not to be affected by history. The participants were members of 40 unrelated families.

Methods: Mutations were screened by restriction fragment length polymorphism, allele-specific polymerase chain reaction amplification, and direct sequencing. Ophthalmologic examination included slit-lamp biomicroscopy, intraocular pressure (IOP) measurement, gonioscopy, and high magnification stereoscopic fundus examination, followed by standard achromatic perimetry.

Main Outcome Measures: Identification of subjects carrying CYP1B1 mutations. Glaucoma diagnosis based on slit-lamp examination, IOP measurement, gonioscopic findings, optic nerve appearance, and perimetry.

Results: Fifteen different homozygous or compound heterozygous mutant CYP1B1 genotypes were identified. Most probands and previously diagnosed subjects harbored G61E, R368H, R390H, and R469W mutations. Among the 178 apparently unaffected family members, 20 subjects from 12 families were observed to harbor 2 CYP1B1 mutations, suggesting an average penetrance of 73% for all the mutations. These 20 subjects ranged in age from 14 to 54 years. R390H appeared to have a notably high penetrance. Penetrance was 50% in the subset of families with incomplete penetrance. Ophthalmologic examination on 14 of the 20 apparently nonpenetrant individuals showed that 8 subjects were affected with juvenile open-angle glaucoma (JOAG) or primary open-angle glaucoma (POAG), and that 3 subjects were glaucoma suspect. One of the individuals with a JOAG diagnosis was the identical twin sibling of a proband affected with PCG.

Conclusions: At least 57% of the PCG nonpenetrant individuals examined clinically were affected with JOAG or POAG to varying degrees, and overall penetrance of "affected CYP1B1 genotypes" with respect to glaucoma may be more than 90%. These findings suggest that "affected CYP1B1 genotypes" exhibit variable expressivity rather than nonpenetrance. The clinical implication of this observation is that seemingly unaffected relatives of patients with PCG, particularly those known to harbor CYP1B1 mutations, should undergo regular ophthalmologic examination to allow early diagnosis.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.ophtha.2009.04.045DOI Listing
November 2009

Loss of function mutations in the gene encoding latent transforming growth factor beta binding protein 2, LTBP2, cause primary congenital glaucoma.

Hum Mol Genet 2009 Oct 4;18(20):3969-77. Epub 2009 Aug 4.

National Institute of Genetic Engineering and Biotechnology, Tehran, Iran.

Glaucoma is a heterogeneous group of optic neuropathies that manifests by optic nerve head cupping or degeneration of the optic nerve, resulting in a specific pattern of visual field loss. Glaucoma leads to blindness if left untreated, and is considered the second leading cause of blindness worldwide. The subgroup primary congenital glaucoma (PCG) is characterized by an anatomical defect in the trabecular meshwork, and age at onset in the neonatal or infantile period. It is the most severe form of glaucoma. CYP1B1 was the first gene genetically linked to PCG, and CYP1B1 mutations are the cause of disease in 20-100% of patients in different populations. Here, we report that LTBP2 encoding latent transforming growth factor beta binding protein 2 is a PCG causing gene, confirming results recently reported. A disease-associated locus on chromosome 14 was identified by performing whole genome autozygosity mapping in Iranian PCG families using high density single nucleotide polymorphism chips, and two disease-segregating loss of function mutations in LTBP2, p.Ser472fsX3 and p.Tyr1793fsX55, were observed in two families while sequencing candidate genes in the locus. The p.Tyr1793fsX55 mutation affects an amino acid close to the C-terminal of the encoded protein. Subsequently, LTBP2 expression was shown in human eyes, including the trabecular meshwork and ciliary processes that are thought to be relevant to the etiology of PCG.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1093/hmg/ddp338DOI Listing
October 2009

Sex Bias in Primary Congenital Glaucoma Patients with and without CYP1B1 Mutations.

J Ophthalmic Vis Res 2009 Apr;4(2):75-8

School of Biology, College of Science, Tehran University, Tehran, Iran.

Purpose: To investigate variations in sex ratio among Iranian primary congenital glaucoma (PCG) patients with and without mutations in the CYP1B1 gene and to evaluate possible clinical variations associated with sex in these two groups.

Methods: Phenotypical data on 104 unrelated Iranian PCG patients who had previously been screened for CYP1B1 mutations were analyzed. Emphasis was placed on analysis of sex ratios among patients with and without CYP1B1 mutations. In addition to sex, familial and sporadic incidence and clinical features including age at onset, bilateral/unilateral involvement, corneal diameter, intraocular pressure, and cup-disc ratios were compared between these two groups. Information on phenotypical parameters was available for most but not all patients.

Results: Among the 93 PCG patients whose sex was recorded, 57 were male (61.3%) and 36 were female (38.7%) (P=0.03). Patients with CYP1B1 mutations included 37 male (66.1%) and 29 female (43.9%) subjects (P=0.30), while patients without the mutation included 20 (74.1%) male and 7 (25.9%) female individuals (P=0.013). Our data did not provide conclusive evidence on difference in severity of the disease between those with and without CYP1B1 mutations, nor between the two sexes.

Conclusion: Consistent with data on PCG patients from other populations, the overall incidence of PCG in Iran seems to be higher among male subjects. The difference in incidence between the two sexes was not significant among patients whose disease was due to mutations in CYP1B1. The overall higher incidence of PCG among male subjects seems to be attributable to a higher incidence in male patients not harboring CYP1B1 mutations, suggesting that other genes or factors may be involved in manifestation of PCG phenotypes in a sex dependent manner.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3498552PMC
April 2009

Screening of common CYP1B1 mutations in Iranian POAG patients using a microarray-based PrASE protocol.

Mol Vis 2008 18;14:2349-56. Epub 2008 Dec 18.

School of Biology, University College of Science, University of Tehran, Tehran, Iran.

Purpose: The gene coding cytochrome P4501B1 (CYP1B1) has been shown to be a major cause of primary congenital glaucoma in the Iranian population. More recently it was shown to also be important in juvenile-onset open angle glaucoma (JOAG). We aimed to further investigate the role of CYP1B1 in a larger cohort of primary open angle glaucoma (POAG) patients which included late-onset patients. We also aimed to set up a microarray based protocol for mutation screening with an intent of using the protocol in a future population level screening program.

Methods: Sixty three POAG patients, nine affected family members, and thirty three previously genotyped primary congenital glaucoma (PCG) patients were included in the study. Clinical examination included slit lamp biomicroscopy, IOP measurement, gonioscopic evaluation, fundus examination, and measurement of perimetry. G61E, R368H, R390H, and R469W were screened by a protocol that included multiplexed allele specific amplification in the presence of a protease (PrASE), use of sequence tagged primers, and hybridization to generic arrays on microarray slides. The entire coding sequences of CYP1B1 and myocilin (MYOC) genes were sequenced in all individuals assessed by the microarray assay to carry a mutation. Intragenic single nucleotide polymorphism (SNP) haplotpes were determined for mutated alleles.

Results: Genotypes assessed by the array-based PrASE methodology were in 100% concordance with sequencing results. Seven mutation carrying POAG patients (11.1%) were identified, and their distribution was quite skewed between the juvenile-onset individuals (5/21) as compared to late-onset cases (2/42). Four of the seven mutation carrying Iranian patients harbored two mutated alleles. CYP1B1 mutated alleles in Iranian PCG and POAG patients shared common haplotypes. MYOC mutations were not observed in any of the patients.

Conclusions: The PrASE approach allowed reliable simultaneous genotyping of many individuals. It can be an appropriate tool for screening common mutations in large sample sizes. The results suggest that CYP1B1 is implicated in POAG among Iranians, notably in the juvenile-onset form. Contrary to POAG patients studied in other populations, many mutation harboring Iranian patients carry two mutated alleles. We propose an explanation for this observation.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2603445PMC
March 2009

Contributions of MYOC and CYP1B1 mutations to JOAG.

Mol Vis 2008 Mar 13;14:508-17. Epub 2008 Mar 13.

National Institute of Genetic Engineering and Biotechnology, Tehran, Iran.

Purpose: To investigate the role of MYOC and CYP1B1 in Iranian juvenile open angle glaucoma (JOAG) patients.

Methods: Twenty-three JOAG probands, their available affected and unaffected family members, and 100 ethnically matched control individuals without history of ocular disease were recruited. Clinical examinations of the probands included slit lamp biomicroscopy, intraocular pressure (IOP) measurement, gonioscopic evaluation, fundus examination, and perimetry measurement. Familial cases were classified according to the mode of inheritance. Exons of MYOC and CYP1B1 were sequenced, and novel variations assessed in the control individuals. Potential disease-associated variations were tested for segregation with disease status in available family members.

Results: The mode of inheritance of the disease in the families of four probands (17.4%) appeared to be autosomal dominant and in at least eight (34.8%) to be autosomal recessive. Four patients carried MYOC mutations, and an equal number carried CYP1B1 mutations. The MYOC mutations were heterozygous; two of them (p.C8X and p.L334P) are novel, and one codes for the shortest truncated protein so far reported. Autosomal recessive inheritance was consistent with inheritance observed in families of patients carrying CYP1B1 mutations. All these patients carried homozygous mutations.

Conclusions: MYOC and CYP1B1 contributed equally to the disease status of the Iranian JOAG patients studied. The contribution of the two genes appeared to be independent in that no patient carried mutations in both genes. The fraction of Iranian patients carrying MYOC mutations was comparable to previously reported populations.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2268862PMC
March 2008