Publications by authors named "Fang Lu"

502 Publications

Influence of anesthetic induction of propofol combined with esketamine on perioperative stress and inflammatory responses and postoperative cognition of elderly surgical patients.

Am J Transl Res 2021 15;13(3):1701-1709. Epub 2021 Mar 15.

Department of Anesthesiology, Yichun People's Hospital Yichun 336000, Jiangxi Province, China.

Objective: To analyze the influence of anesthetic induction of propofol combined with esketamine on perioperative stress and inflammatory responses and postoperative cognition in elderly surgical patients.

Methods: A total of 80 elderly surgical patients were randomly divided into a control group (n=40) and a study group (n=40). The control group received anesthetic induction with propofol combined with sufentanil, while the study group received anesthetic induction with propofol combined with esketamine. Hemodynamics, stress and inflammatory responses and changes in cognitive function, perioperative related indexes and adverse responses were compared between the two groups.

Results: At T, the levels of adrenaline, norepinephrine, endothelin, C-reactive protein, white blood cell and procalcitonin in the two groups were not markedly changed compared with those at T. The levels of the indices at T and T were elevated compared with those at T. However, the levels of the indices at T were almost close to those at T, and the levels in the study group were higher than those in the control group. There were statistically significant differences in the comparison of the interaction of the levels of the aforementioned indices between groups, between time points, and between groups and time points ( < 0.05). At 24 h after surgery, the Montreal Cognitive Assessment (MoCA) scores were decreased in both groups, and the MoCA scores in the study group were higher than those in the control group ( < 0.05). The anesthesia time and consciousness recovery time in the study group were shorter than those in the control group ( < 0.05).

Conclusion: The anesthetic induction of propofol combined with esketamine, exhibits a good safety profile and reliability, it can improve hemodynamics and surgical stress and inflammatory responses, shorten anesthesia time, promote the recovery of postoperative cognitive function, and cause relatively mild adverse responses.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8014402PMC
March 2021

Exploring the Safety, Effectiveness, and Cost-Effectiveness of a Chinese Patent Medicine (Fufang E'jiao Syrup) for Alleviating Cancer-Related Fatigue: A Protocol for a Randomized, Double-Blinded, Placebo-Controlled, Multicenter Trial.

Integr Cancer Ther 2021 Jan-Dec;20:15347354211002919

Xiyuan Hospital of Chinese Academy of Chinese Medical Sciences, Beijing, China.

Objective: To provide higher level evidence on the benefits of a Chinese patent medicine (CPM) (Fufang E'jiao Syrup, FFEJS) for alleviating cancer-related fatigue (CRF), this article describes a protocol for a randomized controlled trial.

Methods/design: We designed a double-blind, placebo-controlled stratified permuted block randomization clinical trial on CRF among 3 types of cancer in China. Participants will be equally allocated to FFEJS group or placebo group according to the randomization sequence and the hospitals they were enrolled at. Each patient will receive 20 ml of either the study formula FFEJS or a placebo formula, 3 times a day for 6 weeks. The follow-up period will be another 4 weeks for safety evaluation. The primary outcome is the difference in improvement of fatigue as measured with the Revised Piper Fatigue Scale-Chinese Version (RPFS-CV). Secondary outcomes include change in fatigue (measured by routine blood panel and hormones in peripheral blood) and QoL (measured by Edmonton symptom assessment scale and Functional Assessment of Cancer Therapy). Patient safety will be measured by liver, renal or cardiac damage, and the risk of FFEJS having a tumor promotion and progression effect will be monitored throughout this study. Cost-effectiveness will also be evaluated mainly by incremental cost per each quality-adjusted life year gained.

Discussion: This article describes the study design of a CPM for CRF in patients with advanced cancer through exploring the effectiveness, safety, and cost-effectiveness of FFEJS.

Trial Registration: ClinicalTrials.gov, NCT04147312. Registered on 1 Sep 2019.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1177/15347354211002919DOI Listing
April 2021

Magnetic resonance quantitative susceptibility mapping in the evaluation of hepatic fibrosis in chronic liver disease: a feasibility study.

Quant Imaging Med Surg 2021 Apr;11(4):1170-1183

Shanghai Key Laboratory of Magnetic Resonance, School of Physics and Electronic Science, East China Normal University, Shanghai, China.

Background: Noninvasive methods for the early diagnosis and staging of hepatic fibrosis are needed. The present study aimed to investigate the alteration of magnetic susceptibility in the liver of patients with various fibrosis stages and to evaluate the feasibility of using susceptibility to stage hepatic fibrosis.

Methods: A total of 30 consecutive patients with chronic liver diseases (CLDs) underwent magnetic resonance imaging (MRI) and liver biopsy evaluation of hepatic fibrosis, necroinflammatory activity, iron load, and steatosis. Quantitative susceptibility mapping (QSM), R2* and proton density fat fraction (PDFF) images were postprocessed from the same gradient-echo data for quantitative tissue characterization using region of interest (ROI) analysis. The differences for MRI measurements between cohorts of non-significant (Ishak-F <3) and significant fibrosis (Ishak-F ≥3) and the correlation of MRI measurements with fibrosis stages and necroinflammatory activity grades were tested. Receiver operating characteristic (ROC) analysis was also performed.

Results: There was a significant difference in liver susceptibility between the cohorts of significant and non-significant fibrosis (Z=-2.880, P=0.004). A moderate negative correlation between the stages of liver fibrosis and liver susceptibility was observed (r=-0.471, P=0.015). Liver magnetic susceptibility differentiated non-significant from significant hepatic fibrosis with an area under the receiver operating curve (AUC) of 0.836 (P=0.004). A highly sensitive diagnostic performance with an AUC of 0.933 was obtained using magnetic susceptibility and PDFF together (P<0.001).

Conclusions: A noninvasive liver QSM-based evaluation promises an accurate assessment of significant fibrosis in patients with CLDs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.21037/qims-20-720DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7930689PMC
April 2021

Increased sensitivity to TNF-α promotes keloid fibroblast hyperproliferation by activating the NF-κB, JNK and p38 MAPK pathways.

Exp Ther Med 2021 May 17;21(5):502. Epub 2021 Mar 17.

Department of Plastic and Burn Surgery, West China School of Medicine, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, P.R. China.

Hyperproliferation of fibroblasts is the main cause of keloid formation. However, the pathogenesis of keloids has yet to be fully elucidated. Tumor necrosis factor (TNF)-α may play an important role in the formation and proliferation of keloids, as it is implicated in the pathogenesis of various fibrous disorders. In the present study, the expression level of TNF-α and its receptors, soluble TNF receptor (sTNFR)1 and sTNFR2, in the peripheral blood and skin tissues was detected by ELISA, reverse transcription-quantitative PCR or immunohistochemistry. There was no statistically significant difference in the expression of TNF-α and sTNFR2 in the peripheral blood and skin tissues between patients with keloids and healthy participants (P>0.05), while the sTNFR1 mRNA level in fibroblasts cultured and its protein level in keloid skin samples were significantly higher compared with those in normal skin (P<0.05). Subsequently, TNF-α recombinant protein was used to treat keloid-derived and normal skin fibroblasts, and it was observed that TNF-α promoted the proliferation of keloid fibroblasts (KFs), but had little effect on normal skin fibroblasts. Furthermore, it was observed that TNF-α stimulation led to the activation of the nuclear factor (NF)-κB, c-Jun N-terminal kinase (JNK) and p38 mitogen-activated protein kinase (MAPK) pathways in KFs. In conclusion, KFs exhibited increased expression of sTNFR1, which may contribute to the increased sensitivity to TNF-α, resulting in low concentrations of TNF-α activating the NF-κB, JNK and p38 MAPK pathways, thereby promoting the sustained and excessive proliferation of KFs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3892/etm.2021.9933DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8005672PMC
May 2021

Use of Three-Dimensional Arterial Spin Labeling to Evaluate Renal Perfusion in Patients With Chronic Kidney Disease.

J Magn Reson Imaging 2021 Mar 26. Epub 2021 Mar 26.

Department of Radiology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine, Shanghai, China.

Background: A noninvasive method for evaluating renal blood flow (RBF) in patients with chronic kidney disease (CKD) may have clinical value in disease staging, management, and prognostication.

Purpose: To evaluate effectiveness of three-dimensional pseudocontinuous arterial spin labeling (pCASL) and pulsed arterial spin labeling (PASL) in assessment of cortex and outer medulla (cortex/OM) RBF in CKD patients and healthy volunteers (HVs).

Study Type: Prospective, in a single institution.

Subjects: A total of 48 CKD patients (stage 1, 2, 3, and 4-5: N = 11, 12, 13, and 12, respectively) and 18 HVs FIELD STRENGTH/SEQUENCE: 3 T, pCASL, and PASL with a three-dimensional hybrid gradient echo/spin echo sequence.

Assessment: Quality of RBF images derived from pCASL and PASL were evaluated and RBF in cortex/OM measured. Clinical and laboratory data were recorded.

Statistical Tests: Image quality differences between pCASL and PASL were evaluated with Wilcoxon signed-rank test. For both methods, analysis of variance, followed by Fisher's LSD-t test, was used to determine whether RBF differed between CKD stages and HVs. Pearson correlation coefficients were calculated to assess strength of relationships between cortex/OM RBF and data from clinical and laboratory tests.

Results: Image quality differences were significantly higher in pCASL than PASL in both patients and HVs (both P < 0.05). For pCASL, cortex/OM RBF of patients were significantly lower than those of HVs (P < 0.05). Cortex/OM RBF were higher in S1 and S2 patients than those in S3 and S4-5 (P < 0.05). For PASL, only RBF in cortex of S1 and S2 patients were significantly higher than those of S4-5 (P < 0.05). Good correlations between pCASL RBF and estimated glomerular filtration (eGFR) were found in cortex/OM of patients (rho = 0.796 and 0.798, respectively, both P < 0.05), higher than those between PASL RBF and eGFR (rho = 0.430 and 0.374, respectively, both P < 0.05).

Data Conclusion: Three-dimensional pCASL may potentially be a noninvasive technique to assess renal perfusion in CKD patients in different stages.

Level Of Evidence: 1 TECHNICAL EFFICACY: Stage 2.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/jmri.27609DOI Listing
March 2021

A Comparative Study for License Application Regulations on Proprietary Chinese Medicines in Hong Kong and Canada.

Front Med (Lausanne) 2021 9;8:617625. Epub 2021 Mar 9.

Leslie Dan Faculty of Pharmacy, University of Toronto, Toronto, ON, Canada.

Chinese Medicine plays a symbolic role among traditional medicines. As Chinese Medicine products are widely used around the globe, regulations for Chinese Medicine products are often used as models for the efficient regulation of natural products that are safe, and high-quality. We aimed to compare the regulatory registration requirements for Proprietary Chinese Medicines in Hong Kong and Canada. We compared registration requirements for Proprietary Chinese Medicine in Hong Kong and Canada based on publicly available information provided by the respective Regulators. A marketed product, Zhizhu Kuanzhong Capsule (SFDA approval number Z20020003; NPN approval number 80104354), was used as a case study to demonstrate the similarities and differences of the requirements in both Hong Kong and Canada. There were similarities and differences between the two regulatory systems in terms of the quality, safety and efficacy requirements. Despite the superficial appearance of similar categories and groups/classes, Hong Kong requires significantly more primary test data compared to Canada's reliance on attestation to manufacturing according the standards outlined in approved reference pharmacopeias/texts. Improved understand of the similarity and differences will enable applicants to plan appropriate strategies for gaining product approval. Exploring ways to harmonize the regulatory process has the potential to benefit manufacturers, regulators, and patients by increasing efficiency and decreasing costs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3389/fmed.2021.617625DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7985161PMC
March 2021

Water-Soluble Carbon Dots in Cigarette Mainstream Smoke: Their Properties and the Behavioural, Neuroendocrinological, and Neurotransmitter Changes They Induce in Mice.

Int J Nanomedicine 2021 16;16:2203-2217. Epub 2021 Mar 16.

Beijing Institute of Traditional Chinese Medicine, Beijing University of Chinese Medicine, Beijing, 100029, People's Republic of China.

Background: It is well known that smoking is harmful to health; however, it can also ameliorate anxiety. To date, it is unclear whether any nanoparticles found in cigarette mainstream smoke (CS) contribute to this effect.

Aim: The aim of this study was to assess the particle composition of CS to identify novel anti-anxiety components.

Methods: Carbon dots (CDs) from CS (CS-CDs) were characterised using high-resolution transmission electron microscopy, Fourier-transform infrared, ultraviolet, fluorescence, X-ray photoelectron spectroscopy, X-ray diffraction and high-performance liquid chromatography. The anti-anxiety effects of CS-CDs in mouse models were evaluated and confirmed with the elevated plus maze and open-field tests.

Results: The quantum yield of CS-CDs was 13.74%, with a composition of C, O, and N. In addition, the surface groups contained O-H, C-H, C=O, C-N, N-H, C-O-C, and COO- bonds. Acute toxicity testing revealed that CS-CDs had low in vitro and in vivo toxicity within a certain concentration range. The results of the elevated plus maze and open-field tests showed that CS-CDs had a significant anti-anxiety effect and a certain sedative effect in mice. The mechanism of these effects may be related to the decrease in glutamate levels and promotion of norepinephrine production in the mouse brain, and the decrease in dopamine in mouse serum due to CS-CDs.

Conclusion: CS-CDs may have anti-anxiety and certain sedative effects. This study provides a new perspective for a more comprehensive understanding of the components, properties, and functions of CS. Furthermore, it offers a novel target for the development of smoking cessation treatments, such as nicotine replacement therapy.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.2147/IJN.S291670DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7982445PMC
April 2021

Maternal exposure to phenanthrene during gestation disturbs glucose homeostasis in adult mouse offspring.

Chemosphere 2021 May 14;270:128635. Epub 2020 Oct 14.

State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Xiamen University, Xiamen, PR China. Electronic address:

Epidemiological studies have indicated that polycyclic aromatic hydrocarbons were related to diabetes and insulin resistance. However, studies in mammals on the development of diabetes caused by polycyclic aromatic hydrocarbons are lacking. Pregnant mice were orally exposed to phenanthrene (0, 60 and 600 μg kg body weight) once every 3 days during gestation. In adult mouse offspring, in-utero phenanthrene exposure caused glucose intolerance and decreased insulin levels in females, while caused elevated fasting blood glucose and insulin levels in males. Serum resistin and interleukin-6 levels were elevated in offspring of both sexes. Serum adiponectin levels were decreased in females but increased in males. The insulin receptor signals were upregulated in the liver and downregulated in the skeletal muscle of F1 females, while they were inhibited in both tissues of F1 males. The visceral fat weight and body weight of the treated mice were not increased, suggesting that phenanthrene is not an obesogen, which is supported by the nonsignificant alteration in pparγ transcription in visceral adipose tissue. The transcription of retn in visceral adipose tissue was upregulated in both sexes, and that of adipoq was downregulated in females but upregulated in males, which were matched with the promoter methylation levels of these genes. The results indicated that phenanthrene exposure during gestation could disturb adipocytokine levels via epigenetic modification in adult offspring, and further influence glucose metabolism. These results might be helpful for understanding nonobesogenic pollutant-induced insulin resistance and preventing against diabetes without obesity.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.chemosphere.2020.128635DOI Listing
May 2021

Homocysteine induced a calcium-mediated disruption of mitochondrial function and dynamics in endothelial cells.

J Biochem Mol Toxicol 2021 Mar 9:e22737. Epub 2021 Mar 9.

Institute of Pharmacology and Toxicology, Zhejiang University, Hangzhou, China.

Homocysteine (Hcy) is a sulfur-containing amino acid that originated in methionine metabolism and the elevated level of Hcy in plasma is considered to be an independent risk factor for cardiovascular diseases (CVD). Endothelial dysfunction plays a major role in the development of CVD, while the potential mechanism of Hcy-induced endothelial dysfunction is still unclear. Here, in Hcy-treated endothelial cells, we observed the destruction of mitochondrial morphology and the decline of mitochondrial membrane potential. Meanwhile, the level of ATP was reduced and the reactive oxygen species was increased. The expressions of dynamin-related protein 1 (Drp1) and phosphate-Drp1 (Ser616) were upregulated, whereas the expression of mitofusin 2 was inhibited by Hcy treatment. These findings suggested that Hcy not only triggered mitochondrial dysfunction but also incurred an imbalance of mitochondrial dynamics in endothelial cells. The expression of mitochondrial calcium uniporter (MCU) was activated by Hcy, contributing to calcium transferring into mitochondria. Interestingly, the formation of mitochondria-associated membranes (MAMs) was increased in endothelial cells after Hcy administration. The inositol 1,4,5-triphosphate receptor (IP3R)-glucose-regulated protein 75 (Grp75)-voltage-dependent anion channel (VDAC) complex, which was enriched in MAMs, was also increased. The accumulation of mitochondrial calcium could be blocked by inhibiting with the IP3R inhibitor Xestospongin C (XeC) in Hcy-treated cells. Then, we confirmed that the mitochondrial dysfunction and the increased mitochondrial fission induced by Hcy could be attenuated after Hcy and XeC co-treatment. In conclusion, Hcy-induced mitochondrial dysfunction and dynamics disorder in endothelial cells were mainly related to the increase of calcium as a result of the upregulated expressions of the MCU and the IP3R-Grp75-VDAC complex in MAMs.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/jbt.22737DOI Listing
March 2021

Extracellular vesicles derived from oesophageal cancer containing P4HB promote muscle wasting via regulating PHGDH/Bcl-2/caspase-3 pathway.

J Extracell Vesicles 2021 Mar 10;10(5):e12060. Epub 2021 Mar 10.

State Key Laboratory of Molecular Oncology National Cancer Center/National Clinical Research Center for Cancer/Cancer Hospital Chinese Academy of Medical Sciences and Peking Union Medical College Beijing China.

Cachexia, characterized by loss of skeletal muscle mass and function, is estimated to inflict the majority of patients with oesophageal squamous cell carcinoma (ESCC) and associated with their poor prognosis. However, its underlying mechanisms remain elusive. Here, we developed an ESCC-induced cachexia mouse model using human xenograft ESCC cell lines and found that ESCC-derived extracellular vesicles (EVs) containing prolyl 4-hydroxylase subunit beta (P4HB) induced apoptosis of skeletal muscle cells. We further identified that P4HB promoted apoptotic response through activating ubiquitin-dependent proteolytic pathway and regulated the stability of phosphoglycerate dehydrogenase (PHGDH) and subsequent antiapoptotic protein Bcl-2. Additionally, we proved that the P4HB inhibitor, CCF642, not only rescued apoptosis of muscle cells in vitro, but also prevented body weight loss and muscle wasting in ESCC-induced cachexia mouse model. Overall, these findings demonstrate a novel pathway for ESCC-induced muscle wasting and advocate for the development of P4HB as a potential intervention target for cachexia in patients with ESCC.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1002/jev2.12060DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7944388PMC
March 2021

Two AOS genes attributed to familial exudative vitreoretinopathy with microcephaly: Two case reports.

Medicine (Baltimore) 2021 Mar;100(9):e24633

Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, Sichuan Province.

Rationale: Familial exudative vitreoretinopathy (FEVR) is an inherited disorder, which is mostly reported to be associated with the mutation of genes involved in the Wnt signaling pathway related to β-catenin. To the best of our knowledge, the involvement of Adams-Oliver syndrome (AOS) genes in FEVR patients have not been reported before.

Patient Concerns: Two patients with FEVR presented with microcephaly. One of them showed slight scarring of the scalp vertex which is a typical manifestation of AOS. The whole exon sequencing confirmed the diagnosis of AOS with 2 AOS-gene mutations at DOCK6 and ARHGAP31. Further clinical examination revealed that their parents with the same mutations showed FEVR-like vascular anomalies.

Diagnosis: Both patients were diagnosed with AOS through whole exon sequencing, and they presented with some FEVR-like retinopathy including retinal detachment.

Interventions: Both patients received vitrectomy for tractional retinal detachment with proliferative vitreoretinopathy. During the follow-up, 1 patient received additional laser photocoagulation for tractional retinal detachment.

Outcomes: The 2 patients remained stable in the latest follow up after the treatment.

Lessons: Microcephaly could be associated with some form of retinopathy. We proposed that mutation of DOCK6 and ARHGAP31 genes could be the possible cause of FEVR associated with microcephaly. Our study suggested that these genes may be candidate genes of FEVR.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1097/MD.0000000000024633DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7939203PMC
March 2021

[Effects of rapid and progressive ascent to Tibet plateau on cardiovascular function and stress factors of pre-selected expeditioners for Chinese Antarctic expedition for Kunlun station].

Zhongguo Ying Yong Sheng Li Xue Za Zhi 2020 Sep;36(5):419-424

Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences/School of Basic Medicine Peking Union Medical College, Beijing 100005, China.

To explore the different effects of rapid and progressive ascent to Tibet plateau on cardiovascular function and stress factors in pre-selected expeditioners for the 31, 32 and 33 Chinese Antarctic expedition for inland station, to provide a scientific basis for the selection of qualified expeditioners. A total of 85 pre-selected expeditioners for the 31, 32 and 33 Chinese Antarctic expedition for Kunlun station were enrolled in this study. According to the different manners of entering the plateau, they were divided into the rapid ascent group by aircraft (RAG, =55) and the progressive ascent group by train (PAG, =30). Hemodynamics and electrocardiogram were examined at 4 m (Shanghai), areas at altitude of 3 658 m (Lhasa) and 4 300 m(Yangbajain), respectively. Saliva levels of stress factors, including testosterone (T), cortisol (COR) and immunoglobulin A (IgA), were tested by ELISA. The heart rates (HR) were increased significantly, while the SpO was decreased significantly in the two groups within 24 hours at altitudes of 3 658 m and 4 300 m (<0.05), while there was no significant difference between the two groups at the same altitude. Compared with 4 m, the blood pressure (BP) of the two groups at 3 658 m and 4 300 m was significantly increased (<0.05), and some indexes of myocardial contraction and pumping function were significantly reduced (<0.05). However, due to the increase of HR, there was no significant change in Cardiac Output (CO). At 4 300 m, the Thoracic Fluid Content (TFC) of the rapid ascent group was significantly higher than that of the progressive ascent group (<0.05). Compared with 4m, there was no significant difference in salivary testosterone change between the two groups at 3 658 m above sea level (>0.05), while COR and IgA changes in the rapid ascent group were significantly higher than those in another group (<0.05). Compared with the progressive ascent by train,expeditioners that rapid ascent to high altitude have significant effects on cardiovascular function and the stress hormones and immunoglobulin levels in saliva. It's suggested that hypoxia adaptation before Antarctic expediting for Kunlun Station could ensure the selected expeditioners' physical and psychological health, so that the mission could be finished smoothly.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.12047/j.cjap.5910.2020.089DOI Listing
September 2020

Boosting Single Image Super-Resolution Learnt From Implicit Multi-Image Prior.

IEEE Trans Image Process 2021 2;30:3240-3251. Epub 2021 Mar 2.

Learning-based single image super-resolution (SISR) aims to learn a versatile mapping from low resolution (LR) image to its high resolution (HR) version. The critical challenge is to bias the network training towards continuous and sharp edges. For the first time in this work, we propose an implicit boundary prior learnt from multi-view observations to significantly mitigate the challenge in SISR we outline. Specifically, the multi-image prior that encodes both disparity information and boundary structure of the scene supervise a SISR network for edge-preserving. For simplicity, in the training procedure of our framework, light field (LF) serves as an effective multi-image prior, and a hybrid loss function jointly considers the content, structure, variance as well as disparity information from 4D LF data. Consequently, for inference, such a general training scheme boosts the performance of various SISR networks, especially for the regions along edges. Extensive experiments on representative backbone SISR architectures constantly show the effectiveness of the proposed method, leading to around 0.6 dB gain without modifying the network architecture.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1109/TIP.2021.3059507DOI Listing
March 2021

Impact of the coronavirus disease 2019 pandemic on irritable bowel syndrome.

J Gastroenterol Hepatol 2021 Feb 21. Epub 2021 Feb 21.

Department of Medicine, Yong Loo Lin School of Medicine, National University Hospital, Singapore.

Background And Aim: Gastrointestinal manifestations of the coronavirus disease 2019 (COVID-19) pandemic may mimic irritable bowel syndrome (IBS), and social distancing measures may affect IBS patients negatively. We aimed to study the impact of COVID-19 on respondents with self-reported IBS.

Methods: We conducted an anonymized survey from May to June 2020 in 33 countries. Knowledge, attitudes, and practices on personal hygiene and social distancing as well as psychological impact of COVID-19 were assessed. Statistical analysis was performed to determine differences in well-being and compliance to social distancing measures between respondents with and without self-reported IBS. Factors associated with improvement or worsening of IBS symptoms were evaluated.

Results: Out of 2704 respondents, 2024 (74.9%) did not have IBS, 305 (11.3%) had self-reported IBS, and 374 (13.8%) did not know what IBS was. Self-reported IBS respondents reported significantly worse emotional, social, and psychological well-being compared with non-IBS respondents and were less compliant to social distancing measures (28.2% vs 35.3%, P = 0.029); 61.6% reported no change, 26.6% reported improvement, and 11.8% reported worsening IBS symptoms. Higher proportion of respondents with no change in IBS symptoms were willing to practice social distancing indefinitely versus those who deteriorated (74.9% vs 51.4%, P = 0.016). In multivariate analysis, willingness to continue social distancing for another 2-3 weeks (vs longer period) was significantly associated with higher odds of worsening IBS.

Conclusion: Our study showed that self-reported IBS respondents had worse well-being and compliance to social distancing measures than non-IBS respondents. Future research will focus on occupational stress and dietary changes during COVID-19 that may influence IBS.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1111/jgh.15466DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8014795PMC
February 2021

Synergistic Inhibition of Renal Fibrosis by Nintedanib and Gefitinib in a Murine Model of Obstructive Nephropathy.

Kidney Dis (Basel) 2021 Jan 23;7(1):34-49. Epub 2020 Aug 23.

Department of Nephrology, Shanghai East Hospital, Tongji University School of Medicine, Shanghai, China.

Background: Our recent studies demonstrated that both nintedanib, an FDA-approved quadruple kinase inhibitor, and gefitinib, an epidermal growth factor receptor (EGFR) inhibitor, protect against obstructive kidney disease. It remains unknown whether they have a synergistic effect.

Methods: In this study, we investigated the effect of combined administration of nintedanib and gefitinib on renal fibrosis in a murine model of renal fibrosis induced by unilateral ureteral obstruction (UUO).

Results: Combined treatment with nintedanib and gefitinib after UUO resulted in a greater antifibrotic effect compared with their individual application. Mechanistically, administration of nintedanib blocked UUO-induced phosphorylation of multiple kinase receptors associated renal fibrosis, including platelet-derived growth factor receptors, fibroblast growth factor receptors, vascular endothelial growth factor receptors, and Src family kinase, while gefitinib inhibited EGFR phosphorylation. Their combination also exhibited a more pronounced effect in reducing expression of tissue inhibitors of metalloproteinase-2 (TIMP-2), increasing expression of matrix metalloproteinase-2 (MMP-2), and suppressing renal proinflammatory cytokine expression and macrophage infiltration in the injured kidney. Furthermore, simultaneous administration of nintedanib and gefitinib was more potent in inhibiting UUO-induced renal phosphorylation of signal transducer and activator of transcription-3 (STAT3), nuclear factor-κB, and Smad-3 compared with monotherapy. In cultured renal interstitial fibroblasts, cotreatment with these 2 inhibitors also had synergistic effects in abrogating transforming growth factor β1-induced activation of renal fibroblasts and phosphorylation of Akt, STAT3, and Smad3.

Conclusions: Combined application of nintedanib and gefitinib has a synergistic antifibrotic effect in the kidney and may hold translational potential for the treatment of chronic kidney disease.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1159/000509670DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7879279PMC
January 2021

Dynamic changes of inflammation and apoptosis in cerebral ischemia‑reperfusion injury in mice investigated by ferumoxytol‑enhanced magnetic resonance imaging.

Mol Med Rep 2021 Apr 19;23(4):1-13. Epub 2021 Feb 19.

MR Scientific Marketing, Siemens Healthcare, Shanghai 201318, P.R. China.

The inflammatory response and apoptosis are key factors in cerebral ischemia‑reperfusion injury. The severity of the inflammatory reaction and apoptosis has an important impact on the prognosis of stroke. The ultrasmall superparamagnetic iron oxide particle has provided an effective magnetic resonance molecular imaging method for dynamic observation of the cell infiltration process . The aims of the present study were to investigate the inflammatory response of cerebral ischemia‑reperfusion injury in mice using ferumoxytol‑enhanced magnetic resonance imaging, and to observe the dynamic changes of inflammatory response and apoptosis. In the present study a C57BL/6n mouse cerebral ischemia‑reperfusion model was established by blocking the right middle cerebral artery with an occluding suture. Subsequently, the mice were injected with ferumoxytol via the tail vein, and magnetic resonance scanning was performed at corresponding time points to observe the signal changes. Furthermore, blood samples were used to measure the level of serum inflammatory factors, and histological staining was performed to assess the number of iron‑swallowing microglial cells and apoptotic cells. The present results suggested that there was no significant difference in the serum inflammatory factors tumor necrosis factor‑α and interleukin 1β between the middle cerebral artery occlusion (MCAO) and MCAO + ferumoxytol groups injected with ferumoxytol and physiological saline. The lowest signal ratio in the negative enhancement region was decreased 24 h after reperfusion in mice injected with ferumoxytol. The proportion of iron‑swallowing microglial cells and TUNEL‑positive cells were the highest at 24 h after reperfusion, and decreased gradually at 48 and 72 h after reperfusion. Therefore, the present results indicated that ferumoxytol injection of 18 mg Fe/kg does not affect the inflammatory response in the acute phase of cerebral ischemia and reperfusion. Ferumoxytol‑enhanced magnetic resonance imaging can be used as an effective means to monitor the inflammatory response in the acute phase of cerebral ischemia‑reperfusion injury. Furthermore, it was found that activation of the inflammatory response and apoptosis in the acute stage of cerebral ischemia‑reperfusion injury is consistent.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3892/mmr.2021.11921DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7905325PMC
April 2021

A modular hierarchical array camera.

Light Sci Appl 2021 Feb 18;10(1):37. Epub 2021 Feb 18.

Department of Electronic Engineering, Tsinghua University, Beijing, 100084, China.

Array cameras removed the optical limitations of a single camera and paved the way for high-performance imaging via the combination of micro-cameras and computation to fuse multiple aperture images. However, existing solutions use dense arrays of cameras that require laborious calibration and lack flexibility and practicality. Inspired by the cognition function principle of the human brain, we develop an unstructured array camera system that adopts a hierarchical modular design with multiscale hybrid cameras composing different modules. Intelligent computations are designed to collaboratively operate along both intra- and intermodule pathways. This system can adaptively allocate imagery resources to dramatically reduce the hardware cost and possesses unprecedented flexibility, robustness, and versatility. Large scenes of real-world data were acquired to perform human-centric studies for the assessment of human behaviours at the individual level and crowd behaviours at the population level requiring high-resolution long-term monitoring of dynamic wide-area scenes.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1038/s41377-021-00485-xDOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7892845PMC
February 2021

Protocol for a gallbladder cancer registry study in China: the Chinese Research Group of Gallbladder Cancer (CRGGC) study.

BMJ Open 2021 Feb 16;11(2):e038634. Epub 2021 Feb 16.

Shanghai Key Laboratory of Biliary Tract Disease Research, Shanghai, China

Introduction: Gallbladder cancer (GBC), the sixth most common gastrointestinal tract cancer, poses a significant disease burden in China. However, no national representative data are available on the clinical characteristics, treatment and prognosis of GBC in the Chinese population.

Methods And Analysis: The Chinese Research Group of Gallbladder Cancer (CRGGC) study is a multicentre retrospective registry cohort study. Clinically diagnosed patient with GBC will be identified from 1 January 2008 to December, 2019, by reviewing the electronic medical records from 76 tertiary and secondary hospitals across 28 provinces in China. Patients with pathological and radiological diagnoses of malignancy, including cancer in situ, from the gallbladder and cystic duct are eligible, according to the National Comprehensive Cancer Network 2019 guidelines. Patients will be excluded if GBC is the secondary diagnosis in the discharge summary. The demographic characteristics, medical history, physical examination results, surgery information, pathological data, laboratory examination results and radiology reports will be collected in a standardised case report form. By May 2021, approximately 6000 patient with GBC will be included. The clinical follow-up data will be updated until 5 years after the last admission for GBC of each patient. The study aimed (1) to depict the clinical characteristics, including demographics, pathology, treatment and prognosis of patient with GBC in China; (2) to evaluate the adherence to clinical guidelines of GBC and (3) to improve clinical practice for diagnosing and treating GBC and provide references for policy-makers.

Ethics And Dissemination: The protocol of the CRGGC has been approved by the Committee for Ethics of Xinhua Hospital, Shanghai Jiao Tong University School of Medicine (SHEC-C-2019-085). All results of this study will be published in peer-reviewed journals and presented at relevant conferences.

Trial Registration Number: NCT04140552, Pre-results.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1136/bmjopen-2020-038634DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7888310PMC
February 2021

[Genetic and phenotypic analysis of a patient with phosphogylcerate dehydrogenase deficiency].

Authors:
Zhiyan Tao Fang Lu

Zhonghua Yi Xue Yi Chuan Xue Za Zhi 2021 Feb;38(2):170-173

Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, Sichuan 640041, China. cn.

Objective: To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction.

Methods: The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis.

Results: The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic.

Conclusion: The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3760/cma.j.cn511374-20200622-00462DOI Listing
February 2021

Fast calculation of 3D radiofrequency ablation zone based on a closed-form solution of heat conduction equation fitted by ex vivo measurements.

Phys Med Biol 2021 Feb 25;66(5):055022. Epub 2021 Feb 25.

School of Mathematical Sciences, Qufu Normal University, Qufu 273165, People's Republic of China.

Fast calculation or simulation of the ablation zone induced by radiofrequency ablation (RFA) has a critical role in hepatic RFA planning and therapy. However, it remains challenging to approximate the ablation zone in real time, especially when more than one probe is involved in one ablation session. This paper presents a novel computational technique to calculate the 3D ablation zone of one probe RFA and two-probe switching RFA. The main idea is to get an approximate solution of the temperature distribution from a simplified Pennes bioheat equation, and further fit the solution to the coagulation measurements on ex vivo porcine liver. With a closed-form solution of temperature distribution, the calculation of the ablation zone is as simple as the commonly used ellipsoidal model, but it allows a more realistic prediction of combined ablation zones with different inter-probe spacing. The new approximation technique could potentially replace the original ellipsoidal model in the intervention planning step.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1088/1361-6560/abe052DOI Listing
February 2021

A multi-omics approach to Epstein-Barr virus immortalization of B-cells reveals EBNA1 chromatin pioneering activities targeting nucleotide metabolism.

PLoS Pathog 2021 Jan 26;17(1):e1009208. Epub 2021 Jan 26.

The Wistar Institute, Philadelphia, Pennsylvania, United States of America.

Epstein-Barr virus (EBV) immortalizes resting B-lymphocytes through a highly orchestrated reprogramming of host chromatin structure, transcription and metabolism. Here, we use a multi-omics-based approach to investigate these underlying mechanisms. ATAC-seq analysis of cellular chromatin showed that EBV alters over a third of accessible chromatin during the infection time course, with many of these sites overlapping transcription factors such as PU.1, Interferon Regulatory Factors (IRFs), and CTCF. Integration of RNA-seq analysis identified a complex transcriptional response and associations with EBV nuclear antigens (EBNAs). Focusing on EBNA1 revealed enhancer-binding activity at gene targets involved in nucleotide metabolism, supported by metabolomic analysis which indicated that adenosine and purine metabolism are significantly altered by EBV immortalization. We further validated that adenosine deaminase (ADA) is a direct and critical target of the EBV-directed immortalization process. These findings reveal that purine metabolism and ADA may be useful therapeutic targets for EBV-driven lymphoid cancers.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1371/journal.ppat.1009208DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7864721PMC
January 2021

Chiral Control of Carbon Dots via Surface Modification for Tuning the Enzymatic Activity of Glucose Oxidase.

ACS Appl Mater Interfaces 2021 Feb 22;13(4):5877-5886. Epub 2021 Jan 22.

Institute of Functional Nano & Soft Materials (FUNSOM), Jiangsu Key Laboratory for Carbon-Based Functional Materials & Devices, Soochow University, 199 Ren'ai Road, Suzhou 215123, Jiangsu, China.

Chiral carbon dots (CDs) integrated the advantages of achiral CDs and the unique chiral property, which expand the prospect of the biological applications of CDs. However, the structure control and the origin of chirality for chiral CDs remain unclear. Herein, chiral CDs were obtained by thermal polymerization of chiral amino acids and citric acid, and their handedness of chirality could be controlled by adjusting the reaction temperature, which leads to different kinds of surface modifications. With aliphatic amino acids as a chiral source, all of the CDs that reacted at different temperatures (90-200 °C) have the same handedness of the chiral source. But with aromatic amino acids as a chiral source, CDs with maintained or inversed handedness compared with the chiral source could be obtained by adjusting the reaction temperature. Below a temperature of 120 °C, the chiral source was modified with CDs by esterification and transferred the handedness of chirality; at high temperatures (above 150 °C), which mainly connected by amidation accompanying with the formation of rigid structure generated by the π conjugation between the aromatic nucleus of chiral source and the carbon core of CDs, caused the inversing of the chiral signal. Further, we investigated the chiral effects of CDs on the glucose oxidase activity for a highly sensitive electrochemical biosensor.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acsami.0c21949DOI Listing
February 2021

Effects of continuous positive airway pressure on plasma fibrinogen levels in obstructive sleep apnea patients: a systemic review and meta-analysis.

Biosci Rep 2021 Jan;41(1)

Department of Respiratory and Critical Care Medicine, The First Affiliated Hospital of Xiamen University, Xiamen, Fujian, China.

Objective: Fibrinogen has been implicated to play a role in the pathophysiology of obstructive sleep apnea (OSA). Many studies have evaluated the effect of continuous positive airway pressure (CPAP) on plasma fibrinogen levels in OSA patients. However, results from different reports were not consistent. To assess the effect of CPAP treatment on plasma fibrinogen levels of patients with OSA, a meta-analysis was performed.

Methods: A systematic search of Pubmed, Embase, Cochrane, Wanfang Database and Chinese National Knowledge Infrastructure was performed. Data were extracted, and then weighted mean difference (WMD) and 95% confidence intervals (CIs) were calculated using a random-effects model.

Results: Twenty-two studies involving 859 patients were included in this meta-analysis. Combined data showed that plasma fibrinogen concentrations decreased after CPAP therapy (WMD = -0.38 g/l, 95% CI [-0.54 to -0.22 g/l], P<0.001). In the subgroup analyses by therapy duration, plasma fibrinogen concentrations declined significantly in the long-term (≥1 month) CPAP therapy subgroup (WMD = -0.33 g/l, 95% CI [-0.49 to -0.16 g/l], P<0.001) but not in the short-term (<1 month) CPAP therapy subgroup (WMD = -0.84 g/l, 95% CI [-1.70 to 0.03 g/l], P=0.058). Moreover, in patients with long-term CPAP therapy duration, plasma fibrinogen levels decreased with good CPAP compliance (≥4 h/night) (WMD = -0.37 g/l, 95% CI [-0.55 to -0.19 g/l], P<0.001) but not with poor CPAP compliance (<4 h/night) (WMD = 0.12 g/l, 95% CI [-0.09 to 0.33 g/l], P=0.247).

Conclusion: Long-term CPAP treatment with good compliance can reduce the plasma fibrinogen levels in patients with OSA.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1042/BSR20203856DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7846965PMC
January 2021

[Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome].

Authors:
Zhiyan Tao Fang Lu

Zhonghua Yi Xue Yi Chuan Xue Za Zhi 2021 Jan;38(1):42-46

Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, Sichuan 640000, China.

Objective: To explore the genetic basis for three children patients with CHARGE syndrome.

Methods: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.

Results: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.

Conclusion: Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3760/cma.j.cn511374-20200622-00461DOI Listing
January 2021

[Corrigendum] Downregulation of nucleolar and spindle‑associated protein 1 expression suppresses cell migration, proliferation and invasion in renal cell carcinoma.

Oncol Rep 2020 Nov 30. Epub 2020 Nov 30.

Department of Urology, Shenzhen Second People's Hospital, The First Affiliated Hospital of Shenzhen University, Shenzhen, Guangdong 518037, P.R. China.

Following the publication of the above article, the authors have realized that Fig. 5A was published with certain errors; essentially, the authors needed to perform further experiments to validate certain of their results, and the Blank and si‑NC control data in Fig. 5A were included from an incorrect set of experiments (the intended si‑NUSAP1 experimental data from the flow cytometric analyses, however, were presented correctly in the published Figure). The corrected version of Fig. 5, featuring the panels for the Blank and si‑NC control data in Fig. 5A from the same set of experiments, is shown opposite. The authors have confirmed that the errors associated with this figure did not have any significant impact on either the results or the conclusions reported in this study, and are grateful to the Editor of Oncology Reports for allowing them the opportunity to publish this Corrigendum. Furthermore, they apologize to the readership of the Journal for any inconvenience caused. [the original article was published in Oncology Reports 36: 1506-1516, 2016; DOI: 10.3892/or.2016.4955].
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.3892/or.2020.7875DOI Listing
November 2020

Origin of Magnetic Relaxation Barriers in a Family of Cobalt(II)-Radical Single-Chain Magnets: Density Functional Theory and Calculations.

Inorg Chem 2021 Jan 7;60(2):1007-1015. Epub 2021 Jan 7.

Jiangsu Key Lab for NSLSCS, School of Physical Science and Technology, Nanjing Normal University, Nanjing 210023, P. R. China.

Density functional theory (DFT) and calculations were performed to probe the origin of the magnetic relaxation barriers for two finite single-chain magnets (SCMs) featuring a one-dimension chain, Co(hfac)(R-NapNIT) (R-NapNIT = 2-(2'-(-)naphthyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide, R = MeO () or EtO ()). Our calculations show that the strong intrachain Co-Co exchange coupling interactions transmitted by radicals can contribute much more than ionic anisotropy to the height of the reversal barrier of magnetization for the single-chain magnets (SCMs) with |2| < |4/3|. In addition, the anisotropic energy barrier Δ decreases with the decrease of |2/| ratio and finally vanishes in the limit of broad domain walls (|2| < < |4 /3|). Therefore, the total magnetic relaxation energy barriers of two SCMs mostly originate from the correlation energy barrier Δ deriving from the indirect ferromagnetic interaction between Co-Co transmitted by the strong Co-radical antiferromagnetic interactions.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1021/acs.inorgchem.0c03115DOI Listing
January 2021

Utilization of circulating cell-free DNA profiling to guide first-line chemotherapy in advanced lung squamous cell carcinoma.

Theranostics 2021 1;11(1):257-267. Epub 2021 Jan 1.

Department of Medical Oncology, Shanghai Pulmonary Hospital, Thoracic Cancer Institute, Tongji University School of Medicine, Shanghai, China.

Platinum-based chemotherapy is one of treatment mainstay for patients with advanced lung squamous cell carcinoma (LUSC) but it is still a "one-size fits all" approach. Here, we aimed to investigate the predictive and monitoring role of circulating cell-free DNA (cfDNA) profiling for the outcome of first-line chemotherapy in patients with advanced LUSC. Peripheral blood samples of 155 patients from a phase IV trial and 42 cases from an external real-world cohort were prospectively collected. We generated a copy number variations-based classifier via machine learning algorithm to integrate molecular profiling of cfDNA, named RESPONSE SCORE (RS) to predict the treatment outcome. To monitor the treatment efficacy, cfDNA samples collected at different time points were subjected to an ultra-deep sequencing platform. The results showed that patients with high RS showed substantially higher objective response rate than those with low RS in training set ( < 0.001), validation set ( < 0.001) and real-world cohort ( = 0.019). Furthermore, a significant difference was observed in both progression-free survival (training set, < 0.001; validation set: < 0.001; real-world cohort: = 0.019) and overall survival (training set, < 0.001; validation set: = 0.037) between high and low RS group. Notably, variant allele frequency (VAF) calculated from an ultra-deep sequencing platform significantly reduced in patients experienced a complete or partial response after 2 cycles of chemotherapy ( < 0.001), while it significantly increased in these of non-responder ( < 0.001). Moreover, VAF undetectable after 2 cycles of chemotherapy was correlated with markedly better objective response rate ( < 0.001) and progression-free survival ( < 0.001) than those with detectable VAF. These findings indicated that the RS, a circulating cfDNA sequencing-based stratification index, could help to guide first-line chemotherapy in advanced LUSC. The change of VAF is valuable to monitor the treatment response.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.7150/thno.51243DOI Listing
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7681090PMC
January 2021

Single-shot compressed ultrafast photography based on U-net network.

Opt Express 2020 Dec;28(26):39299-39310

The compressive ultrafast photography (CUP) has achieved real-time femtosecond imaging based on the compressive-sensing methods. However, the reconstruction performance usually suffers from artifacts brought by strong noise, aberration, and distortion, which prevents its applications. We propose a deep compressive ultrafast photography (DeepCUP) method. Various numerical simulations have been demonstrated on both the MNIST and UCF-101 datasets and compared with other state-of-the-art algorithms. The result shows that our DeepCUP has a superior performance in both PSNR and SSIM compared to previous compressed-sensing methods. We also illustrate the outstanding performance of the proposed method under system errors and noise in comparison to other methods.
View Article and Find Full Text PDF

Download full-text PDF

Source
http://dx.doi.org/10.1364/OE.398083DOI Listing
December 2020